The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	215654	279930	5572075	plate,transposase,tRNA	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215654_216950_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217002_217263_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217249_217450_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217615_218161_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218157_218568_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218581_219292_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219491_220316_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220368_222087_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222197_222905_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222901_223306_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223423_224239_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224278_224932_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224924_225956_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226143_226719_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232478_233282_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233278_234193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234433_235234_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235311_236082_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236129_237488_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237559_238315_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238348_239071_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239067_239535_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239599_240331_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240868_241669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242146_242596_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242598_243195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|243304_243496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243516_243996_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243961_245371_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001303798.1|245381_248816_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248952_250365_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250369_251113_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|251109_253881_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|253889_254651_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254655_255987_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255989_256514_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256510_257791_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257815_258898_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258861_260712_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260715_261129_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261219_262611_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262661_262886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262920_263421_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264117_264636_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264845_266987_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267062_271295_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271434_272151_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001356573.1|273909_274467_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275212_276349_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278313_278577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278491_278677_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278757_279930_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	298716	315868	5572075	integrase,transposase,tail	Escherichia_phage(35.29%)	18	305324:305337	321229:321242
WP_000749881.1|298716_299772_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300059_301163_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301174_302428_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303497_303743_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304069_305283_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000708831.1|305308_305692_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
305324:305337	attL	TCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001274756.1|305819_306533_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306633_306834_+	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306952_307246_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|308197_308509_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308508_309303_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309302_309896_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|309867_310311_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|310331_310742_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310771_311326_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311383_312157_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312980_313724_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130488.1|314686_315868_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.3e-142
321229:321242	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 3
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	894556	932657	5572075	protease,portal,lysis,integrase,terminase,holin,tail	Enterobacteria_phage(48.84%)	50	883998:884012	916292:916306
883998:884012	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|894556_895627_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|895604_895823_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|895862_896030_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|896272_896875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|897085_897307_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|897405_897621_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|897697_897889_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|897861_898044_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|898040_898721_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|899418_899601_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|899597_899768_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|899760_900381_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|900377_901043_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|901254_902214_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|902551_902674_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|902688_903378_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|903561_904305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|904390_904549_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|904629_905028_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|905170_905386_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|905385_905883_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|905879_906347_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|906334_906487_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|907161_907653_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|907652_909755_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|909751_909964_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|909891_911016_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|911137_911473_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|911417_913445_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|913531_913855_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|913847_914123_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|914134_914713_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|914709_915111_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|915121_915865_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|915925_916312_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
916292:916306	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|916320_916650_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|916621_919687_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|919686_920016_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|920025_920724_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|920729_921473_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|921409_922018_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|922078_925492_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|925562_926162_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|926221_927538_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|927539_927809_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|927985_928966_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|928999_930019_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|930515_930677_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|930846_931728_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|931958_932657_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	1149365	1220510	5572075	protease,portal,capsid,transposase,head,holin,tail	Escherichia_phage(25.58%)	76	NA	NA
WP_000156526.1|1149365_1151126_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1151311_1151764_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1151838_1152879_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1153235_1153745_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1153963_1154593_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1154555_1156718_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1156727_1157174_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1157296_1159351_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1159382_1159841_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1159936_1160599_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1160771_1161185_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1161229_1161547_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1161604_1162795_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1162889_1163168_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1163164_1163494_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1163584_1164244_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1165635_1165878_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1165945_1168417_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1168510_1168702_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1168698_1168887_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1169460_1169646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1169832_1170222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1170363_1170519_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1170796_1171084_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1171083_1171275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1171302_1171704_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1171812_1172085_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1172068_1172494_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1172700_1173156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1173234_1174326_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|1174332_1175079_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1175100_1175871_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1175886_1176300_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1176651_1177425_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1178029_1178185_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1178352_1178631_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1178632_1179682_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1179694_1180066_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1180055_1180427_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1180578_1181397_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1182017_1182731_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1183498_1185349_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1185524_1186737_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1186942_1187257_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1187784_1187970_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1188191_1188305_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1188525_1189059_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1189218_1189491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001416698.1|1189746_1189911_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	94.4	3.5e-22
WP_162829202.1|1189980_1191193_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000235421.1|1192016_1192292_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1192367_1192748_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1192744_1193092_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1193141_1194680_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1196856_1197063_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1197059_1198652_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1198641_1200147_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1200183_1200531_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1200588_1200855_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1200836_1201577_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1201590_1202022_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1202048_1202462_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|1202442_1205022_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847274.1|1205018_1205348_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1205347_1206046_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1206056_1206800_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1206745_1207378_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1207568_1208096_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|1208229_1211703_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|1211770_1212370_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1212433_1213747_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1213748_1214018_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1216291_1217410_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1217406_1219200_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1219218_1219926_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1219922_1220510_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	1482235	1601270	5572075	protease,portal,lysis,integrase,capsid,terminase,transposase,tRNA,head,holin,tail	Enterobacteria_phage(36.27%)	147	1534038:1534052	1560290:1560304
WP_000952736.1|1482235_1483057_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1483212_1484259_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1484255_1485050_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1485216_1486335_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1486303_1486573_-	excisionase	NA	NA	NA	NA	NA
WP_000241021.1|1486634_1487072_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.5	5.9e-40
WP_000559928.1|1487156_1487672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1487786_1487939_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1488254_1488731_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1488855_1489179_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1489162_1489588_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1489656_1490694_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1490605_1491148_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1491181_1491898_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1491930_1492212_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1492208_1492511_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1492500_1492818_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1492771_1493089_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1493075_1493513_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1493514_1493706_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1493708_1494296_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1494411_1494516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1494704_1494917_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1495084_1495363_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1495364_1496414_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001213059.1|1498104_1498287_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1498324_1498594_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1498669_1498885_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1498889_1499234_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1499284_1499818_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1500088_1500658_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1500657_1500804_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1501031_1501238_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1501302_1501527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1501883_1502024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1502153_1502339_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1502380_1502746_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1503035_1503599_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|1503595_1505257_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1505320_1507258_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1507302_1507524_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001301962.1|1507469_1509971_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.8	0.0e+00
WP_000126019.1|1510050_1510377_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1510386_1510737_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1510733_1511180_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1511176_1511521_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1511586_1512303_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710956.1|1512317_1512692_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	2.3e-64
WP_001453698.1|1512787_1512997_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|1513049_1516292_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807950.1|1516284_1516626_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|1516625_1517324_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1517340_1517595_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1517704_1517815_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1518117_1518996_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1519049_1519787_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1519732_1519969_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1519981_1520071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1520090_1522439_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1523029_1526431_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1528739_1529015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1529075_1530437_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1530800_1531664_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1531647_1532784_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1533033_1534260_+	peptidase T	NA	NA	NA	NA	NA
1534038:1534052	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001301987.1|1534308_1535430_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1535678_1536908_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1537272_1537461_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1538265_1538463_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1538455_1538668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1538657_1539122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1539114_1539348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1539353_1539653_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1539649_1541050_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1541250_1541502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1541498_1541909_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1541919_1542192_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1542318_1542543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1542794_1543001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1543000_1544056_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1544068_1544404_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|1544416_1544830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1545035_1545578_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1545833_1546115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1546715_1548176_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1548175_1548847_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1549015_1550386_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1550389_1551031_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1551066_1552173_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1552226_1552688_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1552697_1553351_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1553522_1554773_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1554886_1556029_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1556018_1556255_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1557179_1557881_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1557877_1558180_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1558247_1558580_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1558644_1558767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|1560848_1561304_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
1560290:1560304	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000224907.1|1561303_1561474_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1561466_1561757_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099696.1|1561753_1562116_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
WP_000971093.1|1562112_1562253_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1562249_1562939_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1563260_1563566_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1563552_1564029_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1564245_1564428_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1564518_1564812_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1565103_1565514_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1565799_1566006_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1566170_1566365_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1566753_1567299_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1567273_1569199_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1569195_1569402_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1569398_1571000_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1570980_1572300_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1572309_1572642_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1572697_1573723_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1573764_1574163_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1574174_1574528_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1574539_1575118_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1575114_1575510_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1575517_1576258_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1576273_1576696_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1576677_1577112_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1577104_1579654_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1579650_1579980_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1579979_1580678_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1580683_1581427_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1581363_1581996_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1582056_1585455_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1585521_1586121_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1586185_1589101_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1589100_1589682_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1589801_1590692_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1590710_1591217_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1591253_1591754_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1591832_1592015_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1592512_1593181_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1593237_1593486_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|1593561_1593942_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1593938_1594286_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1594335_1595874_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1596176_1597661_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1597847_1598801_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1599299_1599884_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|1600057_1601270_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	1679044	1798102	5572075	protease,portal,lysis,integrase,capsid,terminase,transposase,head,holin,tail	Enterobacteria_phage(33.33%)	139	1696268:1696327	1754225:1754287
WP_000113674.1|1679044_1680175_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1680152_1680401_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1680465_1682937_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|1683029_1683221_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1683217_1683406_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1683964_1684198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1684175_1684583_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1684605_1684824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1684896_1685196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1685459_1685867_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1685943_1686171_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000020556.1|1686676_1687717_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1687628_1688171_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1688357_1688939_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1688935_1689100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1689798_1690557_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1690835_1691048_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1691268_1691526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1691595_1691874_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1691875_1692922_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1692934_1693294_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1693302_1693833_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1694074_1694272_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1694422_1695481_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|1696220_1696379_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
1696268:1696327	attL	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCT	NA	NA	NA	NA
WP_000284517.1|1697247_1697463_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1697467_1697812_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1697862_1698396_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1698666_1699236_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1699235_1699382_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1699389_1699857_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1700320_1700635_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1700716_1700941_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1701327_1701873_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027185.1|1701847_1703773_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|1703769_1703976_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1703972_1705574_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1705554_1706874_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1706883_1707216_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1707271_1708297_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1708338_1708737_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1708748_1709102_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1709116_1709650_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1709646_1710042_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1710049_1710802_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1710815_1711238_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1711264_1711573_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918257.1|1711616_1714262_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000847298.1|1714258_1714588_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1714587_1715286_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|1715985_1716615_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|1716855_1719711_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|1719778_1720378_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|1720529_1721834_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|1721835_1722105_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1723131_1724457_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1726054_1726177_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1726283_1727195_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1727260_1727830_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1728795_1730334_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1730383_1730731_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1730727_1731108_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1731447_1731726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1732153_1732300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1732436_1733084_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1733267_1733858_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000113671.1|1737315_1738446_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|1738423_1738672_-	excisionase	NA	NA	NA	NA	NA
WP_000092782.1|1741272_1741461_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1741457_1741646_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|1742043_1742208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|1742211_1742430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1742589_1742745_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|1742934_1743342_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1743419_1743647_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|1743630_1744182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020570.1|1744153_1745194_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_157837342.1|1745105_1745648_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000537576.1|1745682_1746453_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_001118161.1|1746468_1746864_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1746920_1747277_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1747325_1747538_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1747573_1747945_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610377.1|1747941_1748304_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_001278450.1|1748419_1748524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1748712_1748925_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001217394.1|1749145_1749403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012779355.1|1749472_1749751_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265156.1|1749752_1750802_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_000904171.1|1750814_1751189_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|1751185_1752007_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|1752233_1752431_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483509.1|1752581_1753640_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000142977.1|1754234_1756181_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
1754225:1754287	attR	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCTTGC	NA	NA	NA	NA
WP_000143458.1|1756315_1756495_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1756535_1756781_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1756858_1757074_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001015158.1|1757077_1757635_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001092902.1|1757671_1758205_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|1758723_1758909_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|1759383_1759860_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077628.1|1759856_1761980_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102415.1|1761976_1762189_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974554.1|1762188_1763691_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|1763635_1765660_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1765747_1766074_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1766066_1766348_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|1766350_1766974_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|1766986_1767385_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1767392_1768145_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1768158_1768581_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1768607_1768916_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918238.1|1768959_1771605_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000847298.1|1771601_1771931_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302134.1|1771930_1772629_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000194802.1|1772639_1773383_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_123178851.1|1773328_1773958_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
WP_000514959.1|1774198_1777675_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_001230434.1|1777742_1778342_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_000279019.1|1778406_1779720_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001023417.1|1779721_1779991_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000692020.1|1781123_1781714_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1782091_1782262_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079499.1|1782751_1783258_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1783303_1783804_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1783889_1784069_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1784449_1785256_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1785255_1786449_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1786460_1787822_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1787822_1789418_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1789417_1790980_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1791071_1791116_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1791253_1792135_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1792131_1792752_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1792779_1794363_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1794575_1795448_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1795487_1796078_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1796074_1796833_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1797052_1798102_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2069710	2153406	5572075	portal,capsid,transposase,terminase,head,holin,tail	Stx2-converting_phage(43.82%)	96	NA	NA
WP_000214712.1|2069710_2069914_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2069949_2071410_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2072913_2073156_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2073317_2073959_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|2074040_2074670_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2074742_2075318_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2075431_2075701_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268848.1|2075702_2077016_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001230508.1|2077080_2077680_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2082167_2082800_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2082745_2083489_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|2083499_2084198_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|2084197_2084539_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2084531_2087774_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2087825_2088035_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2088130_2088505_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2088510_2089227_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2089285_2089630_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2089626_2090073_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2090069_2090420_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|2090429_2090756_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001063023.1|2092796_2093018_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000731239.1|2093561_2093969_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_024180155.1|2093973_2094189_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2094627_2096478_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2096955_2097387_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2097837_2098551_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2098686_2098884_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2099108_2099663_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2099725_2100031_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2100043_2101093_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2101094_2101367_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2101488_2101833_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2101952_2102165_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2102398_2102956_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2102957_2103176_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2103303_2103615_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2103607_2103835_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2103831_2104113_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2104145_2104862_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2104895_2105357_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2105349_2106393_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2106461_2106887_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2106870_2107113_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2107504_2107843_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2108135_2108288_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2108299_2108938_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2108938_2109148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2109712_2109901_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2109897_2110086_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001120551.1|2112128_2112371_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|2113333_2113714_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2113710_2114058_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2114107_2115646_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2116228_2116879_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2117589_2118165_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2118278_2118548_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2118549_2119773_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2119837_2120437_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001179509.1|2124170_2124608_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|2124607_2124949_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|2124941_2128184_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|2128231_2128441_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2128536_2128911_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2128925_2129642_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2129707_2130052_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2130048_2130495_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2130491_2130842_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2130851_2131178_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|2131180_2133760_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2133705_2133927_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2133971_2135909_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2135972_2137634_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2137630_2138194_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2138485_2138851_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2138892_2139120_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2139544_2139730_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539789.1|2139987_2140104_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
WP_001056806.1|2140103_2140673_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2140943_2141477_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2141527_2141872_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2141876_2142092_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023202.1|2142531_2144382_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2144860_2145289_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2145926_2146616_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2146612_2146972_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2146984_2148034_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2148035_2148314_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2148481_2148694_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2148882_2148987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2149102_2149687_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2149743_2150139_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2150949_2151690_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2151696_2152659_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2152681_2153107_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2153103_2153406_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2468285	2520509	5572075	integrase,transposase,tail,tRNA	Enterobacteria_phage(60.0%)	59	2461509:2461524	2520799:2520814
2461509:2461524	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2468285_2470019_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2470195_2470684_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2470803_2471196_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2471195_2473274_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2473266_2474415_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2474616_2475261_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2475271_2475661_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2475675_2476725_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2476727_2477588_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2477606_2479208_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_012552838.1|2479253_2480915_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2481057_2481561_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2481581_2483546_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2483550_2484477_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2484473_2485361_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2485487_2486066_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2486068_2486419_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2487198_2487627_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2487633_2489058_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2489032_2489833_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2489999_2490986_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2491000_2492515_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2492584_2493574_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2494370_2494874_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2494953_2495205_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2495319_2495406_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2495667_2495991_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2496161_2496659_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2496695_2496935_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2497126_2498338_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2498399_2499065_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2499421_2500423_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2500428_2500776_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2500805_2501456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2501471_2501876_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2501965_2502103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2502174_2502378_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2502399_2502750_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2502760_2503039_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2503050_2503293_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2503289_2503403_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2503495_2503912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2503935_2504139_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2504135_2504402_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2504398_2504698_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2504709_2505327_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2505323_2505689_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2505695_2508518_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2508594_2509554_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2509558_2509873_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2510964_2511495_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2511538_2512111_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2512267_2512756_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2515558_2515714_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2515722_2516088_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2516142_2516655_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2516654_2517839_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2517996_2518320_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829242.1|2519296_2520509_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2520799:2520814	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2578300	2647563	5572075	portal,integrase,capsid,terminase,transposase,head,holin,tail	Escherichia_phage(36.96%)	68	2601091:2601150	2647558:2648867
WP_001023407.1|2578300_2578570_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|2578571_2579885_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230514.1|2579949_2580549_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000514966.1|2580616_2584096_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_097454001.1|2584336_2584966_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_000194801.1|2584911_2585655_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2585665_2586364_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|2586363_2586693_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000082463.1|2586689_2589269_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2589249_2589663_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2589689_2590121_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2590134_2590875_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2590856_2591123_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2591180_2591528_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2591564_2593070_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2593059_2594652_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2594648_2594855_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2596739_2597249_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2597643_2597868_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2597949_2598264_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2598790_2598976_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2599203_2599335_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2599347_2599530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2599685_2600219_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2600269_2600614_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2600618_2600834_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
2601091:2601150	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|2601144_2602357_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2602439_2604290_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2604767_2605196_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2605829_2606519_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2606515_2606875_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2606887_2607937_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2607938_2608217_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2608384_2608597_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2608783_2608888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2608997_2609561_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2609687_2609999_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2609995_2610148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2610180_2610537_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2610533_2610758_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2610779_2611478_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2611512_2612055_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2611966_2613004_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2613072_2613498_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2613494_2613722_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2613819_2614464_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2614738_2614891_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2615371_2615560_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2615556_2615745_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2615840_2618312_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2618370_2618574_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|2618573_2619653_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_001302302.1|2619844_2620642_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_134793145.1|2621131_2629114_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480501.1|2629375_2630428_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2630741_2632058_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2632159_2633614_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2633956_2634673_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2635298_2636942_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2637059_2638010_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2638111_2639029_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2639485_2640421_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2640482_2641562_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2641573_2642317_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001171540.1|2643219_2643600_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2643596_2643944_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2643993_2645532_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_162829202.1|2646349_2647563_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
2647558:2648867	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
>prophage 10
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2661510	2719919	5572075	protease,portal,lysis,integrase,capsid,terminase,transposase,head,holin,tail	Stx2-converting_phage(50.0%)	78	2675229:2675244	2722982:2722997
WP_001303036.1|2661510_2662677_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2664000_2664651_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|2664874_2665750_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001023455.1|2665890_2666160_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268958.1|2666161_2667475_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.5	2.4e-84
WP_001230514.1|2667539_2668139_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000514828.1|2668206_2671686_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_122994717.1|2671924_2672557_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|2672502_2673240_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|2673294_2674218_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|2674288_2674462_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2674569_2674890_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
2675229:2675244	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_000807954.1|2675632_2675974_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212920.1|2675966_2679209_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|2679260_2679470_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2679565_2679940_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2679945_2680662_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2680720_2681065_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2681061_2681508_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2681504_2681855_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2681864_2682191_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001301679.1|2682270_2684772_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063099.1|2684717_2684939_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2684983_2686921_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|2686984_2688646_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2688642_2689206_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2689497_2689863_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2689904_2690132_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|2690594_2690852_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2690848_2691346_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2691548_2691986_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2691982_2692480_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2692479_2692695_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2692771_2693044_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2693084_2693264_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143110.1|2693400_2695338_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2695581_2695905_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2696201_2696471_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2696482_2697442_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2698091_2698580_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2698570_2699242_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2699238_2699844_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2699843_2700566_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2700640_2701321_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2701576_2702335_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2702609_2702792_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2702788_2703316_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2703312_2703759_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2703715_2703952_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2703962_2704178_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2704310_2704589_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2704659_2706036_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2706032_2706854_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2706840_2707002_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2707034_2707331_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2707472_2707688_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2707763_2708459_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2708960_2709482_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2710050_2710233_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2710210_2710483_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2710541_2710793_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2710975_2711344_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2711416_2711581_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2711549_2711693_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2711767_2712064_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|2712069_2712855_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_162829202.1|2713149_2714363_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682306.1|2714841_2715024_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|2714996_2715188_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000188870.1|2715264_2715480_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2715578_2715800_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2715796_2716744_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|2716745_2716922_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2717255_2717612_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|2717608_2717959_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2718146_2718491_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2718568_2718760_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2718740_2719919_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2722982:2722997	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 11
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2803143	2841210	5572075	plate,portal,lysis,integrase,capsid,terminase,tRNA,head,holin,tail	Escherichia_phage(62.22%)	50	2807443:2807470	2839403:2839430
WP_000675144.1|2803143_2804547_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2804543_2805266_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2805456_2805789_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2805936_2807298_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2807443:2807470	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2807571_2807790_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2807871_2809035_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2809034_2809514_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2809528_2811976_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2811968_2812088_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2812120_2812396_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2812452_2812971_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|2812983_2814174_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|2814233_2814827_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_000983068.1|2814854_2815388_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_001057694.1|2815387_2815990_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|2815961_2816405_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_000217043.1|2816425_2817625_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001285352.1|2817621_2818233_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2818225_2819134_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2819138_2819486_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2819482_2820118_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2820184_2820637_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2820629_2821097_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2821059_2821233_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2821204_2821630_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2821617_2822043_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2822057_2822555_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2822554_2822836_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2822839_2823043_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2823042_2823552_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2823651_2824395_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2824398_2825472_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2825530_2826385_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2826558_2828331_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2828330_2829365_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844438.1|2829682_2831650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2831649_2832102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2832148_2833372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2833461_2835744_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2835733_2836009_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2836005_2836230_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2836232_2836532_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2836531_2836756_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2836819_2837320_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2837316_2837487_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2837497_2837773_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2837894_2838194_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2838309_2839323_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2839587_2839905_-	hypothetical protein	NA	NA	NA	NA	NA
2839403:2839430	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2840310_2841210_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 12
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	2866840	2987642	5572075	protease,portal,integrase,terminase,transposase,tRNA,holin,tail	Enterobacteria_phage(44.44%)	140	2891403:2891423	2985148:2985168
WP_001301615.1|2866840_2868874_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2875831_2879461_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2879522_2879840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2881080_2882169_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2882179_2883709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528952.1|2883727_2884459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301655.1|2884451_2885588_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2885584_2887588_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2887712_2888174_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2888215_2888686_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2888732_2889452_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2889448_2891134_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2891403:2891423	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2891648_2891897_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2892264_2892534_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268872.1|2892535_2893849_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|2893913_2894513_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000514989.1|2894580_2898054_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_072147834.1|2898294_2898924_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2898869_2899613_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2899623_2900322_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2900321_2900651_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2900647_2903293_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|2903336_2903645_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2903671_2904094_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2904107_2904860_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2904867_2905266_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2905278_2905902_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2905904_2906186_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2906178_2906505_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2906592_2908617_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000102414.1|2910062_2910275_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2910271_2912395_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2912391_2912868_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2913385_2913571_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2913798_2913945_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2913944_2914514_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2914784_2915318_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2915322_2915538_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2915615_2915861_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2915901_2916081_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142976.1|2916217_2918164_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.8	0.0e+00
WP_000483509.1|2918758_2919817_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|2919967_2920165_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2920391_2921213_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2921209_2921584_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265156.1|2921596_2922646_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_012779355.1|2922647_2922926_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001217394.1|2922995_2923253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2923473_2923686_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2923874_2923979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610377.1|2924094_2924457_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
WP_000137941.1|2924453_2924825_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2924860_2925073_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2925121_2925478_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2925534_2925930_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000537576.1|2925945_2926716_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
WP_157837342.1|2926750_2927293_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020570.1|2927204_2928245_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|2928216_2928768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2928751_2928979_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2929056_2929464_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|2929653_2929809_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|2929968_2930187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|2930190_2930355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2930752_2930941_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2930937_2931126_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102170.1|2931218_2933663_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.2	3.2e-175
WP_000113189.1|2933727_2933976_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|2933953_2935084_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000251936.1|2935559_2935730_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000692020.1|2936107_2936698_-	protein kinase	NA	NA	NA	NA	NA
WP_001023417.1|2937830_2938100_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279019.1|2938101_2939415_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001230434.1|2939479_2940079_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_000514959.1|2940146_2943623_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_123178851.1|2943863_2944493_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
WP_000194802.1|2944438_2945182_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001302134.1|2945192_2945891_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000847298.1|2945890_2946220_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918238.1|2946216_2948862_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000532073.1|2948905_2949214_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2949240_2949663_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2949676_2950429_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2950436_2950835_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|2950847_2951471_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|2951473_2951755_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2951747_2952074_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2952161_2954186_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974554.1|2954130_2955633_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_000102415.1|2955632_2955845_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077628.1|2955841_2957965_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000373407.1|2957961_2958438_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2958912_2959098_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2959616_2960150_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|2960186_2960744_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001072901.1|2960747_2960963_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2961040_2961286_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2961326_2961506_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142934.1|2961640_2963587_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_001356551.1|2964390_2964543_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2964794_2965229_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2965314_2965455_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2965451_2965814_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2965810_2966101_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2966093_2966264_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2966263_2966719_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2966715_2966817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2966933_2967731_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2967740_2968292_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2968756_2970283_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|2970340_2970448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2970539_2970872_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2970939_2971242_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_162829202.1|2971730_2972943_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000147876.1|2973249_2974269_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|2974265_2974805_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2974874_2975105_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2975209_2975899_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2975979_2977041_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2977018_2977396_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2977876_2978083_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2978158_2978455_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2978460_2979246_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2979242_2979920_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2979919_2980102_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2980074_2980266_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2980342_2980558_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2980656_2980878_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2980874_2981822_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2981823_2982000_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2982333_2982690_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2982686_2983049_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2983136_2983379_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2983382_2983517_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2983535_2983790_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2983823_2985110_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2985130_2985832_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2985148:2985168	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2985891_2985999_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2985979_2986711_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2986715_2987642_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	3202628	3301441	5572075	protease,portal,lysis,integrase,capsid,transposase,terminase,tRNA,holin,tail	Escherichia_phage(44.21%)	122	3224208:3224224	3298430:3298446
WP_001283590.1|3202628_3203441_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3203440_3204454_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3204519_3205656_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|3205754_3206750_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3206746_3207925_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3208199_3209420_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3209578_3211585_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3211705_3211984_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3212017_3212566_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3212565_3213375_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|3213374_3214199_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3214202_3215288_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3215322_3216255_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3216420_3216972_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3217142_3217985_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3217986_3218508_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|3218740_3218914_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3218910_3219381_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3219377_3219878_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3219888_3220647_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3220669_3223309_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3223390_3223954_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3224208:3224224	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3224599_3225085_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3225287_3227432_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3227431_3228742_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3228921_3229206_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3229577_3230918_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3231282_3232314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3232708_3233464_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3233757_3234690_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331680.1|3234911_3243287_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000012445.1|3243355_3244621_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|3244631_3244925_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|3244934_3245381_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|3245383_3246040_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|3246134_3246536_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3246592_3246733_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3246963_3247698_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3247788_3248406_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3248411_3248690_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3248704_3249973_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|3249969_3251595_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|3251889_3252078_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3252216_3252486_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001301432.1|3252487_3254425_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|3254421_3255072_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3255071_3255635_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3255618_3256080_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3256129_3256519_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3256574_3257789_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|3257812_3258229_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_162829202.1|3258359_3259572_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000787025.1|3260290_3262435_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|3262434_3264141_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3264121_3264928_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|3265336_3265630_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3265661_3266126_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3266133_3266283_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3266282_3266852_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3267125_3267659_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3267663_3267879_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3267955_3268228_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3268268_3268448_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3268582_3270520_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3271006_3271276_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3271287_3272247_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|3272627_3272780_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_001204880.1|3273028_3273463_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3273455_3273650_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3273646_3274252_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|3274251_3274974_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|3274966_3275176_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3275135_3275537_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3275611_3276286_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3276542_3276737_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|3276733_3277261_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|3277257_3277860_-	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3277852_3278269_-	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3278442_3278658_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|3278790_3279069_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3279139_3279430_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|3279426_3280128_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|3280124_3281063_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|3281095_3281392_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3281530_3281758_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3281836_3282544_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3282604_3282946_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|3283013_3283475_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|3283468_3284515_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745484.1|3284517_3284682_+	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000198444.1|3285170_3285554_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3285612_3286083_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065487.1|3286233_3286602_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_001198861.1|3286674_3286839_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|3286807_3286972_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|3287026_3287323_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3287328_3288114_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3288110_3288791_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3288787_3288970_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3288942_3289134_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|3289210_3289426_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000774248.1|3289524_3289746_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|3289742_3290690_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_001301469.1|3290691_3291198_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|3291157_3291373_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|3291374_3291593_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3291594_3291882_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206751.1|3291885_3292503_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|3292502_3292787_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|3293142_3293766_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3293808_3293976_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000268107.1|3293975_3294206_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000163444.1|3294202_3294829_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3294788_3295001_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3295036_3295414_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3295492_3295675_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3295658_3296828_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3297259_3298417_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3298591_3299728_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3298430:3298446	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3299737_3300418_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3300404_3300872_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3300871_3301441_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 14
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	3579012	3593801	5572075	holin,transposase,tail	Enterobacteria_phage(35.71%)	18	NA	NA
WP_000162574.1|3579012_3579495_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3580340_3580589_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3581090_3581681_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3581863_3582514_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3582592_3583651_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3583780_3584203_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3584363_3584633_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3584850_3586063_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3586564_3586912_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3586908_3587289_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000731241.1|3587645_3587990_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3587994_3588210_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3588359_3590213_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3590658_3590826_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3590911_3591655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3591907_3592531_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3592527_3593193_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3593189_3593801_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 15
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	5179419	5194084	5572075	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5180700:5180715	5198229:5198244
WP_000956557.1|5179419_5179953_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5180149_5180323_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5180370_5180652_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5180700:5180715	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5180996_5181194_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5181529_5181814_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5181810_5182161_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5182151_5182688_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5184009_5184609_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5184673_5185987_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5185988_5186258_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5186369_5186942_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5187014_5187644_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5187725_5188367_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5188527_5188776_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5188837_5189935_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|5190023_5191061_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5191194_5191437_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5191602_5192586_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5192668_5194084_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5198229:5198244	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 16
NC_011353	Escherichia coli O157:H7 str. EC4115, complete sequence	5572075	5330963	5389974	5572075	protease,transposase	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|5330963_5332223_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5332225_5333230_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5333311_5333509_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5333612_5334911_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177633.1|5335115_5335541_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5335579_5338021_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5338201_5338933_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5339059_5339461_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5339479_5340178_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5340228_5340888_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5340905_5341304_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5341313_5341952_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5341954_5343118_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5343201_5344827_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5344943_5345219_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254630.1|5345367_5345697_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5345878_5346628_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5346624_5347380_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5347487_5348552_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|5348906_5350304_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5350319_5350625_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5350634_5351099_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5351112_5351763_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|5351772_5352627_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5352626_5353313_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5353441_5353717_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5354043_5354439_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5354445_5354760_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5354764_5354992_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5355033_5355483_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5355553_5356348_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5356970_5357402_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5357409_5358618_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5358752_5359391_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5359608_5360229_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5360537_5361950_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5361994_5362657_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5362764_5363730_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5363837_5364698_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5364786_5365167_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5365284_5367228_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5367417_5368158_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|5368369_5369308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5369370_5369925_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5370249_5370456_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5370534_5371878_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5372200_5372839_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5373044_5374778_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5374774_5378554_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5378556_5378898_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5379109_5379361_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5379354_5379705_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5379784_5380315_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5380624_5381581_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|5383236_5384259_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5384245_5385241_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5385273_5386272_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5386447_5387821_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5387976_5388528_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5388621_5389974_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NC_011350	Escherichia coli O157:H7 str. EC4115 plasmid pO157, complete sequence	94644	8416	77881	94644	integrase,transposase,protease	Macacine_betaherpesvirus(26.32%)	60	626:640	23311:23325
626:640	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001066920.1|8416_9157_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|9441_10419_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|10826_11027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|11023_11644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|11640_12324_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|12782_13001_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_162829348.1|13054_14268_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_027868286.1|14321_14621_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|14621_15428_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829240.1|16150_17364_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
WP_000852148.1|17439_18195_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|18782_19949_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|19948_20920_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|21614_22517_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|22520_22826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|22902_23586_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
23311:23325	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001104869.1|23586_23808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|23701_24256_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001005037.1|24301_25078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010891293.1|25618_25921_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|25967_26390_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|26386_26578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032245379.1|26547_27057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|27573_27804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|27855_29217_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|29263_29827_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001496595.1|29912_30380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|30449_30656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|30681_31134_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|31190_31424_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|31489_33448_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|33502_33937_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|33933_34695_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|34926_35085_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|37307_37739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|39532_49042_+	toxin B	NA	NA	NA	NA	NA
WP_000205762.1|51300_52047_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|52105_52966_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|53068_53629_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|53761_53974_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233856.1|54218_54680_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
WP_001302200.1|54725_54935_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|54972_55311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|55550_55805_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|56040_56115_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|56107_56965_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|57877_58162_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|58161_58437_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|58531_58738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|60078_60264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|60440_62651_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|62694_63084_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|64309_68212_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|70390_71212_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|71211_72318_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|72407_74129_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|74202_75201_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|75568_75949_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|75945_76293_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|76342_77881_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
