The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	343498	422504	3169329	integrase,plate,tail,terminase,capsid,protease,head,portal,tRNA,holin	Burkholderia_phage(27.03%)	85	346367:346387	402255:402275
WP_012695851.1|343498_344272_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_012695852.1|344268_344640_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_143714524.1|344750_345215_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_012695854.1|345274_347605_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.2e-167
346367:346387	attL	GTCGATGGCCTTGTCCGGCAG	NA	NA	NA	NA
WP_012695855.1|347601_347913_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	35.8	1.0e-09
WP_012695856.1|348151_348358_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.0	2.6e-22
WP_143714417.1|349775_350072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051189976.1|350169_351954_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_012695860.1|352020_352695_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012695861.1|352679_353108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041825434.1|353312_355838_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	20.7	1.6e-20
WP_041825804.1|356063_357359_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	53.3	7.0e-129
WP_081433543.1|357331_357598_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_041825436.1|357590_358097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695864.1|358130_359879_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	37.3	2.8e-64
WP_012695865.1|359875_360304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695866.1|360315_360648_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_012695867.1|360658_360865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695868.1|360861_361053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695869.1|361049_361235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695870.1|361328_361613_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012695871.1|361612_362065_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	34.0	1.1e-15
WP_012695872.1|362087_362408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714418.1|362406_362991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143714419.1|363515_364004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714525.1|364092_364803_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_041825439.1|364973_365240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695876.1|365239_365431_-	YodC family protein	NA	NA	NA	NA	NA
WP_012695877.1|365840_367034_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	52.6	5.5e-96
WP_012695878.1|367015_367483_-|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	65.1	4.0e-42
WP_012695879.1|367487_370100_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	41.2	4.0e-107
WP_012695880.1|370100_370214_-|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	70.6	1.7e-07
WP_012695881.1|370222_370516_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	60.5	1.6e-20
WP_012695882.1|370530_371040_-|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	60.7	7.9e-52
WP_012695883.1|371049_372225_-|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	71.8	4.2e-157
WP_143714420.1|372279_372588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695885.1|372719_373487_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.9	4.8e-101
WP_143714421.1|373488_373647_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	60.0	6.2e-08
WP_012695887.1|373821_374382_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_012695888.1|374395_375451_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	60.8	6.0e-54
WP_012695889.1|375450_376077_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	54.6	3.1e-58
WP_041825811.1|376069_376957_-|plate	baseplate J/gp47 family protein	plate	A0A0F7LCQ9	Escherichia_phage	57.3	3.0e-83
WP_041825442.1|376980_377331_-	GPW/gp25 family protein	NA	A0A1S5NNH3	Burkholderia_phage	48.6	4.9e-21
WP_012695895.1|378500_378944_-|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	50.0	5.3e-28
WP_012695896.1|378936_379167_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012695897.1|379248_379680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695898.1|379676_380480_-	N-acetylmuramidase family protein	NA	E5E3R7	Burkholderia_phage	58.5	8.0e-75
WP_012695899.1|380467_380752_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012695901.1|381122_381329_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	59.1	1.4e-15
WP_012695902.1|381328_381796_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	45.5	6.2e-27
WP_012695903.1|381888_382581_-|terminase	terminase	terminase	K4NX86	Burkholderia_phage	50.7	1.9e-48
WP_012695904.1|382577_383606_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	59.4	5.8e-110
WP_012695905.1|383618_384440_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	60.6	2.1e-62
WP_190273287.1|384568_386314_+|terminase	terminase	terminase	E5E3S6	Burkholderia_phage	58.1	4.0e-196
WP_012695907.1|386310_387345_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	64.3	2.7e-131
WP_143714423.1|387627_387972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714424.1|388139_388595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081433544.1|388596_388932_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	44.7	2.1e-16
WP_012695908.1|388909_390016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695910.1|390626_391097_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_012695911.1|391171_391666_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	37.9	2.2e-22
WP_012695912.1|391867_392548_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_052292528.1|392586_393456_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_012695914.1|393598_394624_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_012695916.1|396153_397293_-	porin	NA	NA	NA	NA	NA
WP_012695917.1|397437_398370_-	amidinotransferase	NA	NA	NA	NA	NA
WP_012695918.1|398528_400013_-	amino acid permease	NA	NA	NA	NA	NA
WP_012695919.1|400128_400689_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.9	1.2e-29
WP_012695920.1|400856_403430_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	35.7	2.5e-122
402255:402275	attR	GTCGATGGCCTTGTCCGGCAG	NA	NA	NA	NA
WP_012695922.1|403716_404571_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012695923.1|404619_405555_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_012695924.1|405564_407397_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_012695925.1|407464_408412_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	C0KIU7	Pseudomonas_phage	32.8	2.8e-10
WP_012695927.1|409521_410223_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_012695928.1|410290_411073_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_012695929.1|411116_411860_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_012695930.1|411873_413454_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_012695931.1|413493_414213_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_012695932.1|414229_414643_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027823798.1|414645_415059_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_143714526.1|415267_416578_-	AAA-associated domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-31
WP_012695935.1|416585_418316_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012695936.1|418429_420628_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.0e-124
WP_012695937.1|420701_421151_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012695938.1|421151_422504_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	58.3	3.3e-113
>prophage 2
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1054608	1131354	3169329	integrase,plate,tail,tRNA,transposase	uncultured_Caudovirales_phage(17.24%)	61	1045598:1045614	1061838:1061854
1045598:1045614	attL	GGCATCGTGCTGATCCT	NA	NA	NA	NA
WP_012696571.1|1054608_1055064_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012696573.1|1055434_1056715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273276.1|1056857_1057028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027823716.1|1057134_1058175_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_012696576.1|1058189_1059227_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_041825489.1|1059665_1060964_-	amino acid permease	NA	NA	NA	NA	NA
WP_012696578.1|1060984_1062481_-	amino acid permease	NA	NA	NA	NA	NA
1061838:1061854	attR	AGGATCAGCACGATGCC	NA	NA	NA	NA
WP_012696579.1|1062703_1063762_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012696580.1|1063771_1064824_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	2.4e-18
WP_012696581.1|1064820_1065864_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012696582.1|1065860_1067486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	5.3e-17
WP_041825491.1|1067607_1068951_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.2	9.7e-33
WP_012696584.1|1069372_1070398_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012696585.1|1070378_1070558_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_012696586.1|1070557_1071322_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012696587.1|1071362_1072019_+	adenylate kinase	NA	NA	NA	NA	NA
WP_190273277.1|1072374_1073475_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012696589.1|1073670_1075599_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_012696590.1|1075651_1076929_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	27.6	1.1e-06
WP_012696591.1|1076947_1078441_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_012696594.1|1081483_1082668_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012696595.1|1082885_1085699_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	2.3e-140
WP_012696597.1|1085754_1087512_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	3.6e-19
WP_012696598.1|1088020_1089415_-	Methyl-accepting chemotaxis sensory transducer precursor	NA	NA	NA	NA	NA
WP_012696602.1|1090194_1090821_+	membrane protein	NA	NA	NA	NA	NA
WP_012696604.1|1090899_1091331_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A1V0DYD3	Dinoroseobacter_phage	55.6	3.0e-36
WP_012696605.1|1091352_1091982_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_012696606.1|1091987_1092983_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_012696607.1|1092984_1093674_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	45.0	2.9e-41
WP_081433581.1|1093834_1094470_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012696609.1|1094491_1094713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052292545.1|1094718_1096059_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_034985191.1|1097507_1098173_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012696618.1|1098139_1100149_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_143714443.1|1100380_1100596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190273278.1|1100654_1108130_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_012696622.1|1108695_1109658_+	agmatinase	NA	NA	NA	NA	NA
WP_081433684.1|1109927_1110320_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_143714534.1|1110775_1111363_-|tail	tail fiber protein	tail	A0A0R8UEH9	Sinorhizobium_phage	37.5	1.7e-10
WP_012696625.1|1111549_1112119_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	40.4	1.1e-33
WP_012696627.1|1112115_1113180_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	45.6	3.3e-76
WP_012696626.1|1113179_1113530_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	61.7	1.7e-29
WP_012696629.1|1114296_1114923_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	53.5	1.5e-49
WP_012696630.1|1114912_1115998_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	43.6	1.2e-78
WP_012696631.1|1115937_1117218_-	DNA circularization N-terminal domain-containing protein	NA	A0A0M3LQ21	Mannheimia_phage	27.8	3.6e-29
WP_012696632.1|1117219_1118767_-	glycoside hydrolase family 19 protein	NA	A0A191ZC60	Erwinia_phage	43.8	5.9e-34
WP_012696633.1|1118925_1119300_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	53.3	1.2e-28
WP_012696634.1|1119381_1120803_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	49.5	7.7e-105
WP_012696635.1|1120895_1121549_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	29.3	9.9e-07
WP_012696636.1|1121795_1122038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696637.1|1122238_1122868_-	hypothetical protein	NA	A4JWP5	Burkholderia_virus	38.5	5.6e-23
WP_012696638.1|1122860_1123088_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	42.5	2.1e-09
WP_012696639.1|1123091_1123610_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	51.5	2.3e-43
WP_012696640.1|1123888_1124317_-|transposase	transposase	transposase	A0A0U5KMW8	unidentified_phage	39.2	7.9e-21
WP_012696641.1|1124367_1124979_-	DUF3164 family protein	NA	A0A2H4IYN0	uncultured_Caudovirales_phage	57.7	6.5e-61
WP_012696642.1|1125152_1125524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696643.1|1125948_1126701_-	ATP-binding protein	NA	A0A0U5DWK7	unidentified_phage	49.2	4.7e-53
WP_012696644.1|1126726_1128766_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	Q38013	Pseudomonas_phage	53.1	1.5e-189
WP_012696645.1|1128893_1129169_-	helix-turn-helix domain-containing protein	NA	A0A2P9JZG5	Alteromonadaceae_phage	57.8	1.0e-21
WP_012696646.1|1129333_1130062_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J7C3	uncultured_Caudovirales_phage	35.8	1.1e-30
WP_012696648.1|1130886_1131354_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	64.8	1.7e-40
>prophage 3
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1452637	1468093	3169329	terminase	Acinetobacter_phage(15.38%)	23	NA	NA
WP_012696969.1|1452637_1453666_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	49.4	8.4e-85
WP_012696970.1|1453674_1454244_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.5	5.1e-76
WP_081433687.1|1454308_1454551_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012696971.1|1454672_1455161_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	50.7	1.5e-39
WP_012696972.1|1455160_1455772_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.4	1.2e-62
WP_012696973.1|1455774_1456563_-	phage recombination protein Bet	NA	A0A0P0ZDB4	Stx2-converting_phage	65.4	5.3e-71
WP_012696974.1|1456603_1456789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696975.1|1456785_1457100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696976.1|1457096_1457348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696977.1|1457344_1457503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696978.1|1458325_1459027_-	LexA family transcriptional regulator	NA	A0A2H4J8I0	uncultured_Caudovirales_phage	40.1	7.8e-26
WP_081433600.1|1459025_1459328_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012696979.1|1459324_1459630_+	phage-related transcriptional regulator	NA	NA	NA	NA	NA
WP_143714451.1|1459633_1459849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143714452.1|1459878_1460739_+	helix-turn-helix domain-containing protein	NA	A0A139ZPL0	Marinitoga_camini_virus	38.2	3.8e-14
WP_012696981.1|1460735_1462112_+	replicative DNA helicase	NA	O80281	Escherichia_phage	37.1	6.2e-67
WP_012696982.1|1462108_1462537_+	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	45.4	1.2e-21
WP_012696983.1|1462533_1462806_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	62.5	3.6e-27
WP_012696984.1|1462993_1463341_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	77.2	1.1e-44
WP_012696986.1|1463821_1464499_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	53.8	1.2e-52
WP_012696989.1|1465613_1465841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012696990.1|1465969_1466128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012696991.1|1466251_1468093_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.3	4.9e-35
>prophage 4
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1475191	1490011	3169329	integrase	Pseudomonas_phage(28.57%)	22	1481530:1481545	1486586:1486601
WP_012696998.1|1475191_1476961_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	37.2	6.5e-93
WP_012696999.1|1476947_1477286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697000.1|1477288_1477507_-	transcriptional coactivator p15/PC4 family protein	NA	NA	NA	NA	NA
WP_012697001.1|1477588_1478575_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	36.5	1.0e-31
WP_012697002.1|1478587_1478890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697003.1|1478886_1479075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714453.1|1479067_1479790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697005.1|1479786_1480497_-	phage antirepressor N-terminal domain-containing protein	NA	Q0H8C7	Salmonella_phage	36.5	2.4e-22
WP_012697006.1|1480493_1480904_-	Rha family transcriptional regulator	NA	A0A0S2SYC0	Pseudomonas_phage	33.3	3.6e-07
WP_012697007.1|1480900_1481242_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012697008.1|1481238_1481472_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
1481530:1481545	attL	GGATACGCGCACGGCT	NA	NA	NA	NA
WP_012697009.1|1481848_1483099_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	35.3	1.3e-55
WP_012697010.1|1483273_1484092_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	51.7	4.5e-73
WP_012697011.1|1484156_1484603_+	GNAT family N-acetyltransferase	NA	A0A2I7RY08	Vibrio_phage	30.3	5.0e-10
WP_012697012.1|1484605_1484917_+	hypothetical protein	NA	Q775C2	Bordetella_phage	73.7	1.8e-06
WP_012697013.1|1484918_1486586_+	hypothetical protein	NA	T1S9Z7	Salmonella_phage	44.4	1.6e-130
WP_012697014.1|1486627_1486951_+	hypothetical protein	NA	Q775C5	Bordetella_phage	56.9	1.2e-26
1486586:1486601	attR	AGCCGTGCGCGTATCC	NA	NA	NA	NA
WP_027824360.1|1486943_1487579_+	hypothetical protein	NA	Q775C6	Bordetella_phage	53.3	1.1e-34
WP_012697016.1|1487597_1488608_+	hypothetical protein	NA	Q6J1R9	Burkholderia_virus	71.0	2.2e-138
WP_012697017.1|1488622_1489084_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	37.5	2.9e-13
WP_012697018.1|1489096_1489339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697019.1|1489405_1490011_+	hypothetical protein	NA	Q775D0	Bordetella_phage	53.2	8.5e-53
>prophage 5
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1513606	1613925	3169329	integrase,plate,tail,capsid,lysis,terminase,head,portal,tRNA	Burkholderia_phage(14.29%)	104	1543436:1543452	1618687:1618703
WP_012697040.1|1513606_1514782_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	42.7	4.6e-87
WP_155826641.1|1515563_1515761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697042.1|1516287_1516887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143714459.1|1517374_1517623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027823985.1|1517863_1517968_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012697046.1|1517964_1519668_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_012697047.1|1519683_1521744_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.3	3.6e-26
WP_012697048.1|1521756_1522413_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_012697049.1|1522442_1525076_+	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	26.0	2.7e-10
WP_012697050.1|1525072_1525774_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_143714460.1|1526869_1527268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697052.1|1527885_1528506_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	43.1	3.7e-19
WP_012697053.1|1528603_1529746_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_012697054.1|1529742_1530450_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.5	4.8e-07
WP_012697055.1|1530454_1531225_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.6	4.9e-13
WP_012697056.1|1531221_1532082_-	alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ	NA	NA	NA	NA	NA
WP_012697057.1|1532078_1533167_-	carbon-phosphorus lyase complex subunit PhnI	NA	NA	NA	NA	NA
WP_051189999.1|1533170_1533752_-	phosphonate C-P lyase system protein PhnH	NA	NA	NA	NA	NA
WP_012697059.1|1533748_1534195_-	phosphonate C-P lyase system protein PhnG	NA	NA	NA	NA	NA
WP_012697060.1|1534335_1535064_+	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_012697061.1|1535063_1536296_+	phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN	NA	NA	NA	NA	NA
WP_012697062.1|1536386_1537400_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169447568.1|1537357_1538560_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	2.8e-31
WP_143714541.1|1538574_1540245_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_034985483.1|1540934_1543775_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	43.1	1.6e-146
1543436:1543452	attL	GCTGCGCAAGCTGCTGT	NA	NA	NA	NA
WP_012697071.1|1544175_1545483_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.4	4.4e-22
WP_012697072.1|1545706_1546018_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_027823975.1|1546354_1546711_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_012697074.1|1546865_1548692_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012697075.1|1548748_1549480_+	DsbC family protein	NA	NA	NA	NA	NA
WP_012697076.1|1550111_1551470_-	MFS transporter	NA	NA	NA	NA	NA
WP_012697077.1|1551624_1554450_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	2.7e-303
WP_012697078.1|1554455_1554884_+	VOC family protein	NA	NA	NA	NA	NA
WP_034985533.1|1555070_1555721_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012697080.1|1555935_1557372_+	transporter	NA	NA	NA	NA	NA
WP_012697081.1|1557504_1559880_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012697082.1|1559957_1561160_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_012697084.1|1561440_1561890_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012697085.1|1561897_1562917_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_012697086.1|1563110_1564349_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012697087.1|1564623_1565283_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012697088.1|1565364_1566153_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012697090.1|1566441_1568034_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_190273285.1|1568006_1568366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697094.1|1569792_1570215_-	hypothetical protein	NA	S5MDN5	Escherichia_phage	37.0	1.2e-13
WP_041825563.1|1570969_1571566_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_012697096.1|1571576_1572365_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012697097.1|1572427_1572604_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_012697098.1|1572760_1573243_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012697099.1|1573239_1573704_-	lysozyme	NA	A0A0A8KXN5	Burkholderia_phage	48.1	3.0e-26
WP_012697100.1|1573685_1573931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190273286.1|1574489_1575722_-|tail	tail fiber protein	tail	A0A0B5A509	Achromobacter_phage	35.4	2.1e-34
WP_012697103.1|1575839_1576346_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_012697104.1|1576354_1577506_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	31.5	2.1e-12
WP_012697105.1|1577502_1578093_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	41.0	3.5e-27
WP_012697106.1|1578089_1579175_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	40.3	8.9e-61
WP_012697107.1|1579158_1579533_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_012697108.1|1579519_1580617_-	regulatory protein	NA	A4JWL3	Burkholderia_virus	42.6	3.6e-70
WP_012697109.1|1580604_1580823_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	50.0	6.8e-13
WP_012697110.1|1580826_1581372_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012697111.1|1581381_1583490_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	31.6	1.4e-46
WP_143714461.1|1583908_1584808_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_012697114.1|1585050_1585695_-	KilA-N domain-containing protein	NA	A0A0H5ARR4	Pseudomonas_phage	46.0	1.4e-26
WP_012697115.1|1585989_1586256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697117.1|1586259_1586775_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	39.3	8.9e-27
WP_012697118.1|1586771_1588211_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	55.3	4.2e-143
WP_012697119.1|1588214_1588391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697120.1|1588393_1588846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697121.1|1588781_1589219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697122.1|1589202_1589403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697123.1|1589415_1590435_-|capsid	major capsid protein	capsid	A0A067ZI79	Vibrio_phage	29.9	1.2e-38
WP_012697124.1|1590444_1590807_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012697125.1|1590816_1592082_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.4	1.5e-54
WP_012697128.1|1592547_1593657_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012697129.1|1593813_1594380_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	31.3	1.1e-14
WP_012697130.1|1594372_1595908_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.6	2.1e-84
WP_012697131.1|1595919_1596150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714462.1|1596153_1598127_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	44.4	7.8e-148
WP_012697133.1|1598095_1598611_-|terminase	terminase small subunit	terminase	A0A2D1GMW4	Marinobacter_phage	43.7	3.9e-14
WP_143714463.1|1598654_1598969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697135.1|1599066_1599801_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	36.7	2.0e-27
WP_143714464.1|1599891_1600278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697137.1|1600515_1600905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041825574.1|1600926_1601964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041825575.1|1601963_1602305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697138.1|1602304_1602910_-	Bro-N domain-containing protein	NA	A0A0R6PGW1	Moraxella_phage	45.8	1.8e-26
WP_081433606.1|1604095_1604458_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_012697141.1|1604468_1604669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697142.1|1604680_1604857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697143.1|1604849_1605359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081433607.1|1605377_1605797_-	phage regulatory CII family protein	NA	A0A2H4J3D5	uncultured_Caudovirales_phage	57.7	1.2e-13
WP_034984986.1|1605903_1606116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697145.1|1606170_1606557_+	helix-turn-helix transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	40.6	3.8e-06
WP_041825580.1|1606848_1607187_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041825582.1|1607380_1607719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273236.1|1608080_1608365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697150.1|1608375_1609122_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_012697151.1|1609118_1609868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697152.1|1609864_1610503_+	3'-5' exoribonuclease	NA	A0A2I7R065	Vibrio_phage	31.3	6.9e-21
WP_012697153.1|1610499_1610682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697154.1|1610671_1611115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697155.1|1611111_1611366_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	42.0	1.2e-11
WP_012697156.1|1611360_1612785_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	44.3	4.4e-84
WP_143714542.1|1612926_1613925_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1618687:1618703	attR	GCTGCGCAAGCTGCTGT	NA	NA	NA	NA
>prophage 6
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1659643	1693161	3169329	integrase,tail,capsid,terminase,protease,head,portal	Burkholderia_phage(36.84%)	42	1657134:1657148	1667393:1667407
1657134:1657148	attL	CTGCCGGGTCAGGCG	NA	NA	NA	NA
WP_012697208.1|1659643_1661002_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.2	1.8e-74
WP_012697209.1|1661781_1663197_+	replicative DNA helicase	NA	O80281	Escherichia_phage	54.8	1.5e-129
WP_012697210.1|1663213_1663534_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_041825598.1|1663538_1664153_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012697213.1|1665578_1666205_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012697214.1|1666270_1666780_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_012697215.1|1666828_1668295_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
1667393:1667407	attR	CGCCTGACCCGGCAG	NA	NA	NA	NA
WP_081433611.1|1668774_1669416_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	42.0	1.2e-44
WP_041825600.1|1669524_1669968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081433612.1|1670056_1670299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143714467.1|1670414_1671116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697219.1|1671243_1672011_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.3	4.5e-99
WP_143714468.1|1672012_1672165_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	64.1	3.2e-09
WP_143714546.1|1672357_1672696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697222.1|1672797_1673262_-	lysozyme	NA	A0A0A8KXN5	Burkholderia_phage	50.4	3.6e-27
WP_012697223.1|1673243_1673453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697224.1|1673452_1673977_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_143714469.1|1673978_1674632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714470.1|1674643_1676164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697227.1|1676054_1678538_-	hypothetical protein	NA	A5A3R1	Burkholderia_phage	28.5	6.4e-22
WP_012697228.1|1678519_1678912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697229.1|1678911_1679388_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_143714547.1|1679427_1679778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697231.1|1679777_1682558_-|tail	phage tail tape measure protein	tail	A0A1V0E8B0	Vibrio_phage	30.0	2.7e-85
WP_012697232.1|1682624_1682912_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.9e-18
WP_012697233.1|1682898_1683144_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_052292567.1|1683279_1683585_-	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	48.6	1.1e-11
WP_012697235.1|1683590_1683902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697236.1|1683916_1684567_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	51.6	9.1e-53
WP_012697237.1|1684627_1684981_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012697238.1|1684967_1685513_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012697239.1|1685509_1685815_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	44.2	4.6e-07
WP_012697241.1|1685811_1686111_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	38.5	1.9e-05
WP_012697240.1|1686122_1686359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697242.1|1686404_1687646_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	52.6	4.5e-101
WP_012697243.1|1687711_1688470_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	54.1	2.1e-53
WP_012697244.1|1688435_1689734_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.9	1.4e-68
WP_190273237.1|1689730_1691389_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	73.7	3.6e-239
WP_143714471.1|1691385_1691565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697247.1|1692081_1692282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143714548.1|1692278_1692596_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.9	9.3e-27
WP_012697249.1|1692651_1693161_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	42.2	2.6e-15
>prophage 7
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1700544	1712643	3169329	integrase	Pseudomonas_phage(80.0%)	16	1707517:1707531	1718514:1718528
WP_012697255.1|1700544_1700982_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	61.2	8.6e-39
WP_012697256.1|1701071_1701572_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	38.1	4.9e-22
WP_143714472.1|1701737_1702514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697258.1|1702518_1703463_-	YdaU family protein	NA	A0A0R6PKK6	Moraxella_phage	47.1	2.5e-19
WP_012697259.1|1703469_1703925_-	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_081433614.1|1703927_1704194_-	helix-turn-helix domain-containing protein	NA	A0A0H5AUC6	Pseudomonas_phage	68.8	8.1e-16
WP_041825610.1|1704300_1704957_+	helix-turn-helix domain-containing protein	NA	Q94MM0	Bordetella_phage	45.3	6.0e-44
WP_041825612.1|1705184_1705502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697261.1|1705498_1706314_+	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	46.9	2.6e-57
WP_012697262.1|1706331_1707267_+	hypothetical protein	NA	H2BD49	Pseudomonas_phage	49.8	4.6e-66
WP_143714473.1|1707278_1707479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697264.1|1707491_1707908_+	hypothetical protein	NA	NA	NA	NA	NA
1707517:1707531	attL	CGCTGCTGCGCGCCA	NA	NA	NA	NA
WP_012697265.1|1707926_1708799_+	H-NS histone family protein	NA	J7I0T4	Pseudomonas_phage	40.0	7.7e-23
WP_012697266.1|1708850_1709192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012697268.1|1709454_1711287_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	40.6	7.4e-92
WP_012697269.1|1711626_1712643_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	53.7	2.7e-83
1718514:1718528	attR	CGCTGCTGCGCGCCA	NA	NA	NA	NA
>prophage 8
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	1888702	1908188	3169329	integrase,lysis,transposase	Mannheimia_phage(27.27%)	28	1886888:1886902	1914384:1914398
1886888:1886902	attL	GAAAACCCGGCCCTG	NA	NA	NA	NA
WP_012697456.1|1888702_1889737_-	hypothetical protein	NA	A0A0M3LRW6	Mannheimia_phage	47.2	1.5e-09
WP_012697457.1|1889733_1890312_-	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	35.9	9.0e-20
WP_012697459.1|1891311_1891665_-	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	53.0	1.2e-27
WP_012697460.1|1891755_1892031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027824307.1|1892027_1892240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697461.1|1892187_1892913_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	36.9	1.8e-17
WP_012697462.1|1892909_1893065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034986059.1|1893433_1893736_-	helix-turn-helix domain-containing protein	NA	F6MII4	Haemophilus_phage	62.7	3.7e-17
WP_012697464.1|1893876_1894665_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	40.8	4.2e-28
WP_012697465.1|1895131_1895965_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	61.1	1.0e-32
WP_143714477.1|1896191_1896932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697467.1|1896939_1897638_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012697469.1|1897981_1898200_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143714478.1|1898477_1899050_+	YceI family protein	NA	NA	NA	NA	NA
WP_012697472.1|1899280_1899766_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012697474.1|1900209_1900431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697475.1|1900430_1900955_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_143714479.1|1901255_1902350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697477.1|1902355_1902562_-	hypothetical protein	NA	Q775D5	Bordetella_phage	50.0	1.6e-11
WP_041825636.1|1902620_1902926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051190079.1|1903112_1903415_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	71.4	1.2e-34
WP_012697480.1|1903393_1904245_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	33.3	3.1e-16
WP_012697481.1|1904466_1904799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697482.1|1905575_1905791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190273241.1|1906205_1906571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081433620.1|1906857_1907160_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143714482.1|1907199_1907661_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_190273242.1|1907654_1908188_+|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	42.3	1.0e-17
1914384:1914398	attR	GAAAACCCGGCCCTG	NA	NA	NA	NA
>prophage 9
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	2393626	2487007	3169329	plate,capsid,terminase,tail,head,portal,tRNA,holin,coat	Burkholderia_phage(34.29%)	88	NA	NA
WP_051190044.1|2393626_2394175_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	32.9	6.4e-07
WP_012697983.1|2394128_2394617_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_143714564.1|2394616_2395270_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_012697985.1|2395313_2395730_+	DUF2721 domain-containing protein	NA	NA	NA	NA	NA
WP_012697987.1|2396203_2397304_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.9	1.6e-81
WP_012697988.1|2397361_2398003_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_162142362.1|2398771_2398987_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012697990.1|2398989_2399550_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012697991.1|2399670_2400963_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_027824216.1|2400896_2401421_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_012697992.1|2401396_2401909_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012697993.1|2401959_2402370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012697994.1|2402366_2403848_-	DNA-directed DNA polymerase III	NA	NA	NA	NA	NA
WP_012697995.1|2404012_2404573_-	phasin family protein	NA	NA	NA	NA	NA
WP_012697996.1|2404821_2405505_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_012697997.1|2405568_2406378_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_012697998.1|2406381_2406651_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_012697999.1|2406647_2407607_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.8	4.0e-12
WP_012698000.1|2407793_2408114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012698001.1|2408192_2409617_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012698002.1|2409613_2410636_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_012698003.1|2410681_2410927_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_012698004.1|2411024_2411735_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_051190043.1|2411836_2412829_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012698006.1|2412958_2414389_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_143714565.1|2414683_2416075_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_012698009.1|2423506_2425027_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012698010.1|2425159_2425606_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012698012.1|2425740_2426487_-	NAD-dependent protein deacetylase	NA	A0A220NU33	Escherichia_phage	27.3	4.8e-05
WP_012698013.1|2426571_2427921_-	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041825696.1|2428143_2429514_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	1.7e-48
WP_012698015.1|2429627_2430551_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_012698016.1|2430683_2431937_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012698017.1|2431955_2432195_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_012698018.1|2432201_2432957_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_051190102.1|2433943_2434849_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012698021.1|2435058_2435865_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_052292634.1|2435867_2436725_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_012698023.1|2436816_2438094_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	27.3	4.8e-13
WP_012698025.1|2440820_2441483_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_012698026.1|2441619_2442900_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.5	1.1e-99
WP_012698027.1|2442994_2443456_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012698028.1|2443452_2444385_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012698029.1|2444537_2444996_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_012698030.1|2445157_2446537_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012698032.1|2447008_2448841_-	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
WP_012698033.1|2448837_2449722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012698034.1|2449718_2450606_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012698035.1|2450796_2453124_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.0	1.8e-74
WP_012698036.1|2453616_2453970_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_143714566.1|2454084_2455953_-	radical SAM protein	NA	NA	NA	NA	NA
WP_012698040.1|2456539_2457154_-	lysophospholipase	NA	NA	NA	NA	NA
WP_012698041.1|2457503_2458391_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012698042.1|2458640_2460098_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_190273298.1|2460060_2460348_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_027824283.1|2461397_2462741_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_012698046.1|2462790_2463825_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	64.3	4.6e-131
WP_190273295.1|2463821_2465567_-|terminase	terminase	terminase	E5E3S6	Burkholderia_phage	58.1	8.9e-196
WP_012695905.1|2465695_2466517_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	60.6	2.1e-62
WP_081433645.1|2466529_2467087_+|capsid	P2 family phage major capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	59.4	2.3e-44
WP_012695905.1|2468395_2469217_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	60.6	2.1e-62
WP_012695904.1|2469229_2470258_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	59.4	5.8e-110
WP_012695903.1|2470254_2470947_+|terminase	terminase	terminase	K4NX86	Burkholderia_phage	50.7	1.9e-48
WP_012695902.1|2471039_2471507_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	45.5	6.2e-27
WP_012695901.1|2471506_2471713_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	59.1	1.4e-15
WP_012698049.1|2471719_2472088_+|holin	phage holin family protein	holin	E5E3R9	Burkholderia_phage	50.4	7.5e-20
WP_012695899.1|2472084_2472369_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012695898.1|2472356_2473160_+	N-acetylmuramidase family protein	NA	E5E3R7	Burkholderia_phage	58.5	8.0e-75
WP_012695897.1|2473156_2473588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695896.1|2473669_2473900_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012695895.1|2473892_2474336_+|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	50.0	5.3e-28
WP_012698050.1|2474332_2474773_+	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	49.3	4.2e-25
WP_012698051.1|2474841_2475507_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	42.9	5.9e-39
WP_041825442.1|2475503_2475854_+	GPW/gp25 family protein	NA	A0A1S5NNH3	Burkholderia_phage	48.6	4.9e-21
WP_041825811.1|2475877_2476765_+|plate	baseplate J/gp47 family protein	plate	A0A0F7LCQ9	Escherichia_phage	57.3	3.0e-83
WP_012698052.1|2476757_2477384_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	54.6	3.1e-58
WP_012695888.1|2477383_2478439_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	60.8	6.0e-54
WP_012695887.1|2478452_2479013_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_143714421.1|2479187_2479346_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	60.0	6.2e-08
WP_012695885.1|2479347_2480115_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.9	4.8e-101
WP_143714493.1|2480246_2480498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695883.1|2480610_2481786_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	71.8	4.2e-157
WP_012695882.1|2481795_2482305_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	60.7	7.9e-52
WP_012695881.1|2482319_2482613_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	60.5	1.6e-20
WP_012695880.1|2482621_2482735_+|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	70.6	1.7e-07
WP_012698054.1|2482735_2485351_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	41.2	6.8e-107
WP_012698055.1|2485355_2485823_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	65.1	4.0e-42
WP_012698056.1|2485804_2487007_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	52.4	2.9e-97
>prophage 10
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	2690175	2701230	3169329		Staphylococcus_phage(14.29%)	10	NA	NA
WP_143714568.1|2690175_2691507_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	7.7e-14
WP_081433658.1|2691583_2692393_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_143714569.1|2692389_2693106_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_012698242.1|2693108_2694167_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	26.0	1.8e-21
WP_012698243.1|2694180_2695113_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	24.2	3.1e-14
WP_012698244.1|2695127_2696063_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	32.0	5.2e-17
WP_012698245.1|2696106_2697186_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	34.0	5.7e-52
WP_190273296.1|2697182_2698274_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	30.5	2.2e-27
WP_012698248.1|2698858_2699917_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_041826103.1|2699934_2701230_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	25.7	9.1e-12
>prophage 11
NC_012559	Laribacter hongkongensis HLHK9, complete sequence	3169329	2908641	2915373	3169329		Escherichia_phage(33.33%)	6	NA	NA
WP_012698435.1|2908641_2909190_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.1	1.5e-45
WP_012698436.1|2909245_2910115_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.1	6.2e-97
WP_190273258.1|2910127_2911009_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	32.6	7.5e-26
WP_012698438.1|2911008_2912076_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.1	1.3e-85
WP_012698439.1|2912084_2913914_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A0A1J0F994	Only_Syngen_Nebraska_virus	43.9	3.9e-133
WP_012698440.1|2914008_2915373_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.4	3.6e-27
