The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	602552	662714	4842908	holin,integrase,coat,terminase,tRNA,portal,protease,lysis	Salmonella_phage(66.15%)	78	617006:617046	663008:663048
WP_000912377.1|602552_603938_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
WP_000819121.1|603982_604807_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_001038574.1|604803_605241_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_001143571.1|605233_605779_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190281.1|605905_606118_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729165.1|606119_606986_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000681023.1|607532_608090_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001675699.1|608740_609433_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000754223.1|609463_612076_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000708660.1|612090_613098_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000577507.1|613107_613626_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000801273.1|613671_614304_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001258110.1|614907_615630_-	fimbria biosynthesis regulator FimY	NA	NA	NA	NA	NA
WP_000944154.1|616120_616717_-	fimbria biosynthesis transcriptional regulator FimW	NA	NA	NA	NA	NA
617006:617046	attL	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
WP_001573970.1|617063_618227_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	97.1	1.0e-219
WP_001281201.1|618456_618801_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
WP_001447403.1|618878_619178_-	hypothetical protein	NA	G9L655	Escherichia_phage	99.0	7.1e-53
WP_000002089.1|619271_619553_-	hypothetical protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	5.9e-49
WP_000208077.1|619545_620628_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.2	6.5e-80
WP_000267992.1|620624_620918_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	99.0	4.2e-50
WP_000665849.1|621302_621884_-	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	71.5	5.2e-68
WP_001214770.1|621880_622051_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_001111323.1|622061_622355_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
WP_001016182.1|622370_622919_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_000168282.1|622927_623434_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	3.8e-91
WP_000365270.1|623434_624142_-	recombinase	NA	E7C9Q0	Salmonella_phage	89.8	9.7e-125
WP_000361564.1|624335_624449_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001200016.1|624441_624582_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	2.0e-18
WP_001751411.1|624905_625205_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	99.0	3.3e-50
WP_000246164.1|625244_625445_-	antirestriction Ral family protein	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
WP_000216172.1|625523_625856_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
WP_000786969.1|626219_626429_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
WP_000248006.1|626464_627388_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
WP_000712403.1|627476_628166_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|628276_628492_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|628602_628884_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|628918_629065_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067074.1|629057_629891_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	100.0	3.8e-152
WP_001248409.1|629887_631264_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000736920.1|631337_631778_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001573980.1|631774_632647_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000679699.1|632643_632817_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_000113760.1|632783_632966_+	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
WP_000566852.1|632962_633139_+	protein ninF	NA	A0A0M4S6T3	Salmonella_phage	96.6	1.8e-27
WP_001008211.1|633394_633790_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	96.9	2.9e-70
WP_000176947.1|633786_633990_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	94.0	5.7e-30
WP_000027545.1|634059_634548_+	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_000738703.1|634927_635254_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001167374.1|635237_635675_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000979454.1|635671_636142_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	87.2	1.2e-62
WP_000877030.1|636354_636885_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	4.0e-91
WP_000807788.1|637143_637386_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001140560.1|637389_637779_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
WP_000013072.1|637778_638183_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	100.0	5.3e-67
WP_000729924.1|638186_638675_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_000417865.1|638652_640152_+|terminase	terminase large subunit	terminase	A8CGE0	Salmonella_phage	99.8	6.9e-306
WP_000774659.1|640151_642329_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.3	0.0e+00
WP_000433856.1|642342_643254_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_001196933.1|643253_644546_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.8	1.1e-243
WP_000538677.1|644586_645147_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.4e-102
WP_001166101.1|645130_645631_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
WP_001122417.1|645590_647009_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.3	3.3e-273
WP_000774923.1|647012_647714_+	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.3	8.8e-70
WP_000627695.1|647713_648169_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_000964898.1|648171_648861_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
WP_000246968.1|648871_650176_+	DNA transfer protein	NA	E7C9U5	Salmonella_phage	96.3	7.8e-213
WP_001262317.1|650175_652089_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_000889769.1|652106_652436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|652466_652832_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|652845_653025_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|653124_653376_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_000129929.1|653511_655515_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
WP_000671499.1|655573_657031_-	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.8	1.7e-240
WP_000703639.1|657020_657953_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|657949_658312_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001575778.1|659795_661448_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	38.0	1.5e-83
WP_000703618.1|661428_662355_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	96.7	1.4e-168
WP_000915523.1|662351_662714_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
663008:663048	attR	TCTAAGCCGTGGGTCGCAGGTTCGAATCCTGCAGGGCGCGC	NA	NA	NA	NA
>prophage 2
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	1000021	1007334	4842908	protease,integrase	Dickeya_phage(16.67%)	7	1001272:1001286	1012265:1012279
WP_001201752.1|1000021_1001140_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	8.1e-09
WP_000125884.1|1001136_1003083_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.9	2.0e-39
1001272:1001286	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1003212_1003434_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1003757_1004078_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1004108_1006385_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1006597_1006795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1006956_1007334_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1012265:1012279	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 3
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	1078186	1138734	4842908	plate,holin,tail,terminase,protease	Salmonella_phage(48.78%)	63	NA	NA
WP_001262311.1|1078186_1079479_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_000065276.1|1079523_1079772_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1079812_1080052_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000394220.1|1081216_1084405_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	74.1	0.0e+00
WP_000917690.1|1084545_1084716_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.9e-08
WP_001009036.1|1085114_1085519_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869364.1|1085648_1085885_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1085850_1086225_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1086309_1087293_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1087295_1088045_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1088055_1088403_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1088399_1088924_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445793.1|1088923_1089397_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	4.7e-67
WP_000208074.1|1089400_1089973_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_001217670.1|1090488_1090728_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929791.1|1091062_1091665_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096559.1|1091873_1092485_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001617856.1|1092481_1092628_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047633.1|1092617_1093415_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.4e-150
WP_162096904.1|1093819_1094161_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005899.1|1094163_1094778_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	1.2e-107
WP_001050813.1|1094774_1095326_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000403520.1|1095315_1095729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118137.1|1095790_1096765_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.3	1.6e-29
WP_000179870.1|1096754_1098026_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	1.1e-83
WP_001150142.1|1098025_1099456_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	2.6e-92
WP_001084016.1|1099427_1100303_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	1.5e-55
WP_001099363.1|1100303_1101878_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	2.2e-20
WP_001574105.1|1101898_1102771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110971.1|1102788_1103820_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.2	2.5e-73
WP_000780866.1|1103884_1104370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114360.1|1104382_1104808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031617308.1|1104825_1105236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139602.1|1105219_1106158_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
WP_001018952.1|1106162_1107557_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	1.2e-70
WP_001133547.1|1107560_1107998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268742.1|1107997_1108585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729222.1|1108708_1110763_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	36.3	7.7e-21
WP_000011140.1|1110762_1111260_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.0	8.9e-24
WP_000100901.1|1111475_1111751_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	33.3	1.6e-06
WP_001271127.1|1111750_1112803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000055864.1|1112799_1113516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261467.1|1113512_1113845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281709.1|1113841_1115068_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	63.9	1.4e-147
WP_000729406.1|1115051_1115678_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583381.1|1115674_1117384_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|1117383_1117965_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001574112.1|1118442_1119411_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	3.3e-192
WP_000334547.1|1120058_1120685_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1121044_1121731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497439.1|1122001_1122193_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	93.7	1.8e-25
WP_000193790.1|1122619_1125232_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000291723.1|1125439_1126450_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001574119.1|1126615_1127158_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224079.1|1127154_1128264_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1128362_1130471_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1130483_1132391_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1132405_1133659_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1133663_1135304_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759134.1|1135300_1135864_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1136119_1136287_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1136386_1136905_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|1136973_1138734_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 4
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	1351455	1427644	4842908	holin,integrase,tail,terminase,portal,protease,lysis	Enterobacteria_phage(25.0%)	82	1352536:1352565	1400267:1400296
WP_000087638.1|1351455_1352535_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	1.5e-100
WP_024132384.1|1352509_1352788_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	36.4	1.2e-09
1352536:1352565	attL	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
WP_000743301.1|1352848_1353277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280163.1|1353375_1353561_-	DUF1187 family protein	NA	NA	NA	NA	NA
WP_001126030.1|1353607_1354438_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	2.5e-103
WP_000023732.1|1354430_1357121_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	72.8	4.0e-118
WP_000799627.1|1357261_1357597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1357672_1357879_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|1357882_1358158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071591195.1|1358419_1358734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|1359175_1359574_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033912.1|1359672_1359927_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574210.1|1359913_1360408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729536.1|1360454_1361453_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.1e-121
WP_158000546.1|1361364_1361907_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	75.5	4.1e-67
WP_000089417.1|1361919_1362315_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_000529512.1|1362601_1363732_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001237395.1|1364128_1366108_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1366796_1367045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1367108_1367708_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1367704_1367932_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097219.1|1368061_1368709_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	52.7	2.1e-57
WP_001574213.1|1368805_1369330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1369703_1370153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1370513_1371200_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1371475_1371805_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1371788_1372241_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1372258_1372738_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1372945_1373479_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1373435_1375574_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1375570_1375777_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009211.1|1375773_1377321_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	7.0e-176
WP_010989008.1|1377244_1379326_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1379416_1379740_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1379732_1380032_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1380012_1380579_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1380575_1380977_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132757.1|1380988_1381738_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	4.8e-90
WP_000478858.1|1381783_1382182_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1382178_1382508_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077906652.1|1382587_1385575_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	2.8e-266
WP_000978295.1|1385571_1385904_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000725268.1|1386002_1386500_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.9	1.4e-16
WP_000877926.1|1386616_1387150_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1387239_1387935_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606352.1|1387944_1388676_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.0e-113
WP_001576012.1|1388579_1389284_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_148206097.1|1391844_1392708_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_000178848.1|1392746_1392989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574223.1|1393042_1395460_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	62.8	4.7e-86
WP_000143180.1|1395459_1396029_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
WP_000161701.1|1396230_1396953_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|1397432_1398233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087644.1|1399186_1400266_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.1e-98
WP_012535725.1|1400262_1401210_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.2e-53
1400267:1400296	attR	TGATCAACTTCTCCAGCAATGCACTCGGTT	NA	NA	NA	NA
WP_001013468.1|1401399_1401687_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.9	1.6e-38
WP_000055326.1|1401683_1402217_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
WP_000789530.1|1402473_1402641_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001034751.1|1402705_1402897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049796172.1|1403369_1403795_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	93.0	1.7e-55
WP_001751604.1|1404350_1404551_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001574229.1|1405118_1405244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520350.1|1405757_1405904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848073.1|1406391_1407006_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|1407015_1407174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617922.1|1411349_1411490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|1411655_1411925_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_000354407.1|1412294_1412714_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030946.1|1413086_1413563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752424.1|1413944_1414286_-	DUF1398 family protein	NA	NA	NA	NA	NA
WP_000182072.1|1414969_1415692_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|1415976_1416141_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|1416364_1417015_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|1417033_1417225_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|1417335_1417572_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|1417689_1419129_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001574233.1|1419206_1421840_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|1421808_1423092_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|1423220_1423718_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|1423815_1424502_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|1424521_1426570_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|1426762_1427644_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	2143448	2195582	4842908	plate,capsid,holin,integrase,head,tail,terminase,transposase,portal	Salmonella_phage(83.64%)	64	2171349:2171363	2191669:2191683
WP_001028173.1|2143448_2144471_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
WP_001176778.1|2144932_2145751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2147093_2147315_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2147527_2148535_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2148819_2149419_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|2149388_2150951_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2150937_2151525_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785580.1|2151527_2152607_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_000605050.1|2152599_2153013_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2153017_2153551_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001675739.1|2153543_2154608_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	95.1	4.2e-188
WP_000863818.1|2154604_2155945_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785386.1|2155978_2157907_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
WP_000588852.1|2157991_2158318_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2158314_2158671_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007990.1|2158670_2160167_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.6	3.0e-277
WP_000497739.1|2160156_2160321_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779217.1|2160324_2160885_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	99.5	8.8e-105
WP_001135697.1|2160881_2161394_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702409.1|2161365_2161770_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
WP_000927378.1|2161766_2162090_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2162092_2162293_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2162343_2163549_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000466259.1|2164191_2165433_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.5	1.7e-241
WP_000605609.1|2165432_2165615_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088185.1|2165626_2167360_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000929191.1|2167356_2167851_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135209.1|2167977_2168328_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	8.0e-64
WP_033868734.1|2168455_2168890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574547.1|2169415_2169808_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	92.3	1.6e-57
WP_001148532.1|2169791_2170268_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.8	1.7e-85
WP_162138162.1|2170271_2170613_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.2	1.2e-51
WP_024132393.1|2170750_2170993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047086.1|2171281_2172034_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	2.4e-134
2171349:2171363	attL	TTATCAATGACATCT	NA	NA	NA	NA
WP_024132394.1|2172047_2173037_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	3.0e-188
WP_001061462.1|2173044_2173905_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.7e-161
WP_000779148.1|2173921_2174311_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_000200163.1|2174319_2175201_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	1.1e-170
WP_000054229.1|2175197_2175671_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	93.8	6.6e-53
WP_000096530.1|2175667_2176642_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	98.1	1.2e-165
WP_000620702.1|2176638_2176863_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087400.1|2176859_2178002_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	87.9	4.3e-183
WP_000509727.1|2177998_2178553_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
WP_001191666.1|2178581_2178806_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2178903_2179599_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_024132396.1|2179803_2179989_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001574551.1|2179916_2180168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752499.1|2180148_2180445_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	98.0	1.1e-50
WP_000997190.1|2181144_2181516_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080407.1|2181573_2182401_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	97.8	7.1e-151
WP_000008351.1|2182537_2183077_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_001017850.1|2183147_2183885_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	86.3	1.8e-52
WP_000082797.1|2183884_2184358_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.3	5.0e-69
WP_000208093.1|2184361_2185111_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.1e-46
WP_001061368.1|2185107_2185677_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	91.5	3.4e-104
WP_001527041.1|2185716_2185944_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532846.1|2185945_2186935_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	99.7	4.3e-195
WP_000598920.1|2187226_2188024_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001675745.1|2188379_2189654_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	8.2e-74
WP_000042271.1|2189725_2189977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|2190455_2190953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072672.1|2191314_2191878_-	hypothetical protein	NA	NA	NA	NA	NA
2191669:2191683	attR	AGATGTCATTGATAA	NA	NA	NA	NA
WP_000028416.1|2192288_2193170_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_001127942.1|2193743_2195582_-|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
>prophage 6
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	2302577	2313084	4842908		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2302577_2303891_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565910.1|2303917_2304997_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2305001_2305775_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018217.1|2305790_2306765_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2306770_2307322_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857534.1|2307322_2308201_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	4.6e-108
WP_001023658.1|2308248_2309148_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2309147_2310233_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2310609_2311503_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144951.1|2311680_2313084_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	2380282	2389453	4842908	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2380282_2382316_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703135.1|2382556_2383015_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.2	7.1e-52
WP_001197951.1|2383186_2383717_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950411.1|2383773_2384241_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
WP_000598637.1|2384287_2385007_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272846.1|2385003_2386689_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_001240419.1|2386911_2387643_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	2.2e-100
WP_001261696.1|2387702_2387810_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2387790_2388522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2388505_2389453_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	2625971	2632010	4842908		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2625971_2626913_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2628155_2628545_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2628513_2628768_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400618.1|2628785_2630708_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	76.9	8.1e-299
WP_105789228.1|2631697_2631841_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108594046.1|2631779_2632010_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	5.4e-08
>prophage 9
NC_011205	Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853, complete sequence	4842908	2861084	2959989	4842908	plate,capsid,integrase,head,tail,terminase,transposase,tRNA,portal,lysis	Salmonella_phage(70.0%)	92	2931269:2931287	2975596:2975614
WP_000083339.1|2861084_2861822_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2861951_2863286_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675461.1|2863303_2864203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188415.1|2864305_2864893_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627809.1|2864954_2865338_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	71.8	6.1e-33
WP_000179978.1|2865656_2866346_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2866461_2867499_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2867702_2868122_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000609323.1|2868194_2868875_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082638.1|2868928_2871589_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2871703_2873059_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264467.1|2873103_2873427_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2873423_2874725_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985653.1|2874828_2875284_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2881063_2883637_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|2883766_2884498_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2884494_2885475_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2885606_2886344_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2886615_2886954_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2887057_2887105_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200076.1|2887204_2888365_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2888325_2889234_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2889291_2890413_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2890422_2891493_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2891932_2892451_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030986.1|2892443_2893664_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2893821_2894169_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2894209_2894977_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2895021_2895570_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2895588_2895837_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2896089_2897451_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2897616_2898408_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_148206098.1|2898427_2899714_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001287926.1|2899834_2900440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2900474_2901065_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2901188_2902067_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880975.1|2902152_2903814_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2903962_2904301_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2904466_2904757_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2904746_2905223_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2905372_2905855_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237698.1|2906469_2917689_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533843.1|2917753_2919163_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001675489.1|2919159_2919690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001675939.1|2919721_2921335_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.6e-19
WP_012543392.1|2921342_2922506_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|2923057_2923276_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001102266.1|2923344_2924445_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
WP_000980409.1|2924441_2924927_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001282767.1|2924923_2927731_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
WP_000763317.1|2927723_2927843_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|2927857_2928160_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_001207653.1|2928214_2928730_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046103.1|2928739_2929912_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
WP_000680167.1|2930042_2930570_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_001274650.1|2930572_2932258_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.6	3.5e-128
2931269:2931287	attL	AAACAATACGTTATTGCCA	NA	NA	NA	NA
WP_001086804.1|2932254_2932860_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268273.1|2932852_2933761_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.0	7.2e-157
WP_000177484.1|2933747_2934107_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
WP_000993756.1|2934103_2934682_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.8e-92
WP_000192047.1|2934777_2935644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829151.1|2935670_2936117_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	3.1e-60
WP_001039937.1|2936109_2936541_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_001574811.1|2936636_2937065_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	1.3e-47
WP_000727849.1|2937061_2937439_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
WP_001069909.1|2937440_2937953_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|2937933_2938149_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2938152_2938356_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|2938355_2938820_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059191.1|2938915_2939566_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742505.1|2939569_2940628_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
WP_000216232.1|2940644_2941478_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	5.9e-121
WP_001574814.1|2941620_2943387_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_000520369.1|2943386_2944418_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	5.9e-171
WP_000389025.1|2944414_2945194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133007.1|2945198_2946359_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000190536.1|2946779_2947658_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	4.0e-51
WP_000790439.1|2947768_2948068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154444.1|2948136_2948325_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000017506.1|2948480_2950877_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_000104186.1|2950873_2951731_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	99.6	1.5e-164
WP_000785509.1|2951727_2951955_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|2951954_2952188_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|2952255_2952597_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|2952816_2953275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|2953222_2953456_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000102104.1|2954009_2954249_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052559.1|2954365_2954998_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
WP_001574821.1|2955001_2956027_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.1	9.2e-201
WP_001142974.1|2956286_2956880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2957278_2958082_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2958877_2959989_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2975596:2975614	attR	AAACAATACGTTATTGCCA	NA	NA	NA	NA
