The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012526	Deinococcus deserti VCD115, complete sequence	2819842	256930	263409	2819842		Staphylococcus_phage(50.0%)	7	NA	NA
WP_012692155.1|256930_257401_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.0	6.6e-29
WP_012692156.1|257452_258673_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	5.4e-99
WP_012692157.1|258669_259329_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	4.9e-30
WP_012692158.1|259328_260435_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.6	2.0e-39
WP_012692160.1|260903_261866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012692161.1|262133_262868_-	NAD-dependent deacylase	NA	S5M4R0	Bacillus_phage	30.3	1.2e-16
WP_012692162.1|262893_263409_-	RNA 2'-phosphotransferase	NA	A0A2H4UTN1	Bodo_saltans_virus	42.4	6.3e-33
>prophage 2
NC_012526	Deinococcus deserti VCD115, complete sequence	2819842	756756	843518	2819842	tail,plate,tRNA,integrase,transposase	Tupanvirus(16.67%)	56	761158:761217	795732:795824
WP_012692609.1|756756_758706_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.3	6.8e-120
WP_012692610.1|758835_759846_-	DsbA family protein	NA	NA	NA	NA	NA
WP_012692611.1|759973_760687_+	triacylglycerol lipase	NA	NA	NA	NA	NA
761158:761217	attL	CCTTGACACGGTAGGGGTCAGGGGTTCAAATCCCCTCGAGTCTACCAACAGAACTCCCGT	NA	NA	NA	NA
WP_012692612.1|761308_762496_-|integrase	site-specific integrase	integrase	A0A2H4YHQ5	Gordonia_phage	23.7	1.5e-13
WP_012692613.1|762580_762841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049760435.1|763018_765532_-	bifunctional DNA primase/polymerase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	34.8	1.1e-50
WP_083764271.1|765528_765717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041227044.1|765827_766994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162485392.1|767403_767955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012692618.1|767981_770732_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	22.2	1.4e-22
WP_041227391.1|770731_773497_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_012692620.1|773516_776300_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_012692621.1|776296_776917_-	DUF3780 domain-containing protein	NA	NA	NA	NA	NA
WP_012692622.1|776942_780017_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_162485393.1|780409_785560_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	36.4	6.1e-51
WP_012692624.1|785556_787737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012692625.1|787773_790323_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	25.6	1.7e-46
WP_083764220.1|790473_794319_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_012692627.1|794452_795454_+|transposase	IS4-like element ISDds2 family transposase	transposase	NA	NA	NA	NA
WP_012692629.1|797240_798344_+	hypothetical protein	NA	NA	NA	NA	NA
795732:795824	attR	CCTTGACACGGTAGGGGTCAGGGGTTCAAATCCCCTCGAGTCTACCAACAGAACTCCCGTCCAGGCGGGGGTTTTTCCTTTTATGCCCAGGCG	NA	NA	NA	NA
WP_162485394.1|798451_799861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012692632.1|801438_802125_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_012692633.1|802121_802487_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_012692634.1|802483_802900_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_162485395.1|802896_804813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083764222.1|805733_808118_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	22.6	2.8e-06
WP_012692637.1|808953_809598_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_041227394.1|809688_811194_-	2-phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_012692639.1|811321_811939_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012692640.1|812024_812882_+	ROK family protein	NA	NA	NA	NA	NA
WP_012692641.1|812931_813666_+	sporulation protein	NA	NA	NA	NA	NA
WP_041227396.1|813727_814909_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012692643.1|814912_815521_-	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	37.3	1.6e-22
WP_012692645.1|815658_815877_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012692646.1|815971_816964_-	ADP-ribosylglycohydrolase	NA	A0A2K9L8G6	Tupanvirus	23.6	2.8e-05
WP_012692647.1|817030_817552_+	DUF4388 domain-containing protein	NA	NA	NA	NA	NA
WP_012692649.1|818971_819466_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012692650.1|819462_822225_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	3.9e-137
WP_012692651.1|822283_822886_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_162485396.1|823036_823351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012692652.1|823477_824611_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	39.1	1.1e-32
WP_012692653.1|824645_826313_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
WP_012692654.1|826376_826673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041227398.1|826669_827386_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_041227056.1|827719_828175_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_012692657.1|828304_828925_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012692658.1|829130_830270_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012692659.1|830961_831249_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_049760436.1|831281_831992_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_012692661.1|836509_837052_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012692662.1|837232_837652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041227402.1|837663_838086_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012692664.1|838163_839813_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	31.5	1.6e-61
WP_012692665.1|840040_840865_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_162485517.1|841011_841332_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_012692667.1|841391_843518_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
