The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	560563	571012	3449685	integrase	Clostridium_phage(50.0%)	9	569329:569343	575160:575174
WP_012741521.1|560563_563146_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.6	8.0e-100
WP_012741522.1|563167_564334_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_022292793.1|564464_564737_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	47.5	1.2e-14
WP_041253857.1|564950_565538_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_012741526.1|565818_567393_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.9	1.8e-25
WP_041253859.1|567419_569090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012741528.1|569103_569547_-	helix-turn-helix transcriptional regulator	NA	B3GVX0	Streptococcus_phage	43.6	9.7e-06
569329:569343	attL	CATGACACTAACATA	NA	NA	NA	NA
WP_003019365.1|569723_569912_+	hypothetical protein	NA	A0A0A8WI91	Clostridium_phage	47.1	2.6e-05
WP_012741529.1|569926_571012_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	48.2	3.6e-86
575160:575174	attR	TATGTTAGTGTCATG	NA	NA	NA	NA
>prophage 2
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	1143923	1186076	3449685	terminase,tail,capsid,integrase,portal,tRNA	Streptococcus_phage(16.67%)	52	1176031:1176045	1192711:1192725
WP_012742105.1|1143923_1144862_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_012742107.1|1145295_1146144_+	thymidylate synthase	NA	A0A0H3V0R8	Geobacillus_virus	45.0	1.1e-61
WP_012742108.1|1146227_1146719_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	44.2	8.7e-24
WP_012742109.1|1146750_1148472_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	34.1	9.8e-62
WP_041254511.1|1148499_1148997_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_012742112.1|1149348_1149855_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012742114.1|1151224_1152715_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	33.6	2.8e-49
WP_012742115.1|1152877_1153936_-	Abi family protein	NA	A0A1S5S8T0	Streptococcus_phage	25.6	1.4e-13
WP_012742116.1|1154322_1154973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742117.1|1154984_1155626_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	37.1	8.7e-32
WP_041254516.1|1155817_1155970_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012742119.1|1156012_1156282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167527323.1|1156415_1156571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742122.1|1156688_1156886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742123.1|1156880_1157423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742124.1|1157540_1157774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742126.1|1158210_1158537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742127.1|1158626_1159484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742128.1|1159470_1159926_+	ribonuclease H	NA	NA	NA	NA	NA
WP_167527324.1|1159861_1161403_+	ParB N-terminal domain-containing protein	NA	A0A2K9V477	Faecalibacterium_phage	29.1	1.7e-44
WP_012742130.1|1161411_1161642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742131.1|1161642_1161999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742132.1|1161991_1162306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742133.1|1162296_1162890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742137.1|1163422_1163605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742139.1|1163850_1164483_+	DUF4417 domain-containing protein	NA	H7BVQ9	unidentified_phage	56.2	1.1e-66
WP_148207826.1|1164482_1164758_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_012742141.1|1164770_1165319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742142.1|1165348_1166200_+|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	33.2	8.3e-22
WP_167527325.1|1166174_1167506_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1J1J8Z1	Escherichia_phage	35.3	5.8e-70
WP_012742144.1|1167517_1168900_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_012742145.1|1168910_1170485_+|capsid	phage minor capsid protein	capsid	F6K8Q8	Clostridium_phage	32.1	1.8e-46
WP_012742146.1|1170474_1170693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167527326.1|1170751_1170907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742148.1|1171003_1171156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742149.1|1171332_1171926_+	phage scaffolding protein	NA	NA	NA	NA	NA
WP_012742150.1|1171938_1172934_+	hypothetical protein	NA	A0A1J0MC78	Streptomyces_phage	40.4	2.2e-53
WP_012742151.1|1172952_1173288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742152.1|1173287_1173719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049757226.1|1173718_1174087_+	hypothetical protein	NA	A0A2K9V3E3	Faecalibacterium_phage	33.3	8.0e-06
WP_041253968.1|1174061_1174508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742155.1|1174512_1175001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742156.1|1175018_1175417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742157.1|1175409_1175973_+	hypothetical protein	NA	A0A1S5SAD5	Streptococcus_phage	33.3	1.4e-09
WP_012742158.1|1176019_1178470_+	hypothetical protein	NA	A0A1S5S8Z7	Streptococcus_phage	53.3	2.8e-62
1176031:1176045	attL	AAAATTAATAATTAA	NA	NA	NA	NA
WP_012742159.1|1178479_1179202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742160.1|1179198_1181241_+|tail	phage tail protein	tail	H7BV46	unidentified_phage	36.2	6.8e-86
WP_012742161.1|1181244_1182843_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012742162.1|1183287_1184004_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4J709	uncultured_Caudovirales_phage	27.8	1.8e-14
WP_012742163.1|1184287_1184569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742164.1|1184725_1184869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742165.1|1185080_1186076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.8	4.4e-22
1192711:1192725	attR	AAAATTAATAATTAA	NA	NA	NA	NA
>prophage 3
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	1929483	1939707	3449685		Faecalibacterium_phage(25.0%)	19	NA	NA
WP_012742882.1|1929483_1929906_-	single-stranded DNA-binding protein	NA	A0A2H4J8K2	uncultured_Caudovirales_phage	63.7	1.1e-30
WP_012742883.1|1929902_1930250_-	hypothetical protein	NA	G9BWA1	Planktothrix_phage	82.4	2.5e-09
WP_012742884.1|1930256_1930919_-	radical SAM protein	NA	S4U737	Listeria_phage	37.4	1.1e-32
WP_012742885.1|1930930_1931416_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	44.0	3.1e-13
WP_012742886.1|1931408_1932458_-	phosphoadenosine phosphosulfate reductase family protein	NA	F8UBB2	Clostridium_phage	35.7	6.4e-48
WP_012742887.1|1932472_1932952_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V2U7	Faecalibacterium_phage	53.8	6.1e-38
WP_012742888.1|1932953_1934306_-	ParB/RepB/Spo0J family partition protein	NA	A0A2K9V477	Faecalibacterium_phage	37.8	8.8e-42
WP_012742889.1|1934399_1934654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742890.1|1934659_1935355_-	hypothetical protein	NA	Q9ZX04	Mycobacterium_phage	31.8	2.0e-05
WP_012742891.1|1935344_1935578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118096249.1|1935765_1935996_-	alanine racemase	NA	A0A2K9V2W2	Faecalibacterium_phage	46.6	6.3e-09
WP_012742894.1|1935992_1936916_-	hypothetical protein	NA	H7BV66	unidentified_phage	51.8	2.4e-75
WP_012742895.1|1936915_1937245_-	DUF4313 domain-containing protein	NA	NA	NA	NA	NA
WP_012742896.1|1937246_1937681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742897.1|1937694_1937973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742898.1|1938054_1938333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742899.1|1938435_1938645_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_012742900.1|1938645_1939452_-	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	37.3	8.7e-29
WP_012742901.1|1939452_1939707_-	hypothetical protein	NA	A0A2H4JB60	uncultured_Caudovirales_phage	52.0	1.2e-13
>prophage 4
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	1950659	2000012	3449685	tail,terminase,integrase,plate	Faecalibacterium_phage(34.62%)	60	1956929:1956946	2003255:2003272
WP_148207831.1|1950659_1952315_-	hypothetical protein	NA	H7BV43	unidentified_phage	65.2	1.8e-145
WP_012742924.1|1952356_1952584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742925.1|1952603_1952999_-|tail	phage tail protein	tail	B6SBU8	Clostridium_virus	54.0	4.1e-32
WP_012742926.1|1952995_1954267_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_012742927.1|1954278_1955397_-|plate	baseplate J/gp47 family protein	plate	A0A0N7ACK1	Bacillus_phage	29.6	2.7e-36
WP_012742928.1|1955411_1955849_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	35.7	5.6e-06
WP_012742929.1|1955863_1956220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742930.1|1956235_1957477_-	hypothetical protein	NA	A0A0N6W8H4	Bacillus_phage	29.3	7.6e-16
1956929:1956946	attL	CTGCACAAAGCACTGCTC	NA	NA	NA	NA
WP_012742931.1|1957487_1958171_-	LysM peptidoglycan-binding domain-containing protein	NA	B6SBU2	Clostridium_virus	29.1	2.2e-09
WP_049757234.1|1958174_1962863_-|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	55.3	9.1e-78
WP_012742934.1|1963016_1963586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742935.1|1963665_1964130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742936.1|1964146_1965550_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	NA	NA	NA	NA
WP_012742937.1|1965552_1965792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742938.1|1965803_1966685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742939.1|1966681_1966984_-	DUF5026 domain-containing protein	NA	NA	NA	NA	NA
WP_118389617.1|1966997_1967450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742941.1|1967452_1967809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742942.1|1967805_1968216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742943.1|1968215_1968815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742944.1|1968826_1969852_-	hypothetical protein	NA	A0A1B0XTJ8	Freshwater_phage	27.5	1.9e-28
WP_012742945.1|1969870_1970302_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_012742946.1|1970319_1971576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742947.1|1971605_1971818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742948.1|1971903_1972383_-	hypothetical protein	NA	A0A0K1LML5	Caulobacter_phage	27.9	3.0e-05
WP_012742949.1|1972387_1973344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742951.1|1974754_1976203_-|terminase	phage terminase large subunit	terminase	D4N436	Pseudomonas_phage	34.4	9.4e-74
WP_012742952.1|1976202_1976664_-	hypothetical protein	NA	A0A2K9V3J2	Faecalibacterium_phage	46.3	1.8e-26
WP_012742953.1|1976671_1977595_-	ParB N-terminal domain-containing protein	NA	A0A2K9V3J4	Faecalibacterium_phage	60.8	2.0e-98
WP_012742954.1|1977543_1978962_-	hypothetical protein	NA	A0A2K9V3N2	Faecalibacterium_phage	57.4	1.0e-157
WP_012742955.1|1979235_1979751_-	hypothetical protein	NA	A0A2K9V3G3	Faecalibacterium_phage	46.7	3.6e-20
WP_012742956.1|1980030_1980627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254095.1|1980716_1980974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254097.1|1981020_1981227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742959.1|1981278_1981584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742960.1|1981589_1981814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254607.1|1981823_1982126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742962.1|1982137_1982806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742963.1|1982805_1983930_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	27.5	5.5e-05
WP_041254609.1|1983940_1984378_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2K9V3I2	Faecalibacterium_phage	51.4	9.2e-33
WP_012742965.1|1984400_1984670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742966.1|1984674_1985529_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	46.3	6.8e-64
WP_012742967.1|1985531_1986311_-	phage replisome organizer N-terminal domain-containing protein	NA	C9WB95	Streptococcus_virus	64.6	7.8e-43
WP_012742968.1|1986330_1987128_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H7BV60	unidentified_phage	63.6	2.6e-94
WP_012742969.1|1987139_1988048_-	recombinase RecT	NA	A0A0A7RUP3	Clostridium_phage	39.5	7.5e-45
WP_041254099.1|1988049_1988280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742971.1|1988258_1988513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049757235.1|1988448_1988748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742973.1|1988762_1989329_-	cell wall hydrolase	NA	A0A0K2FM09	Brevibacillus_phage	29.0	9.2e-09
WP_012742974.1|1989401_1989896_-	helix-turn-helix domain-containing protein	NA	A0A2K9V3J3	Faecalibacterium_phage	50.6	6.3e-38
WP_012742975.1|1989924_1990341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012742976.1|1990582_1990948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012742978.1|1990989_1991283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012742979.1|1991272_1991599_+	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	40.9	6.4e-07
WP_012742980.1|1991576_1992152_+	hypothetical protein	NA	A0A2K9V3H4	Faecalibacterium_phage	41.8	1.5e-30
WP_012742981.1|1992138_1993269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9V349	Faecalibacterium_phage	40.3	1.0e-75
WP_012742982.1|1993497_1994508_-	GGGtGRT protein	NA	NA	NA	NA	NA
WP_012742983.1|1994526_1995228_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_012742984.1|1995350_1996025_-	UDP-N-acetylglucosamine pyrophosphorylase	NA	NA	NA	NA	NA
WP_012742985.1|1996190_2000012_-	topoisomerase C-terminal repeat-containing protein	NA	A0A2K9L1Q2	Tupanvirus	23.7	8.4e-21
2003255:2003272	attR	CTGCACAAAGCACTGCTC	NA	NA	NA	NA
>prophage 5
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	2980306	2986731	3449685		Staphylococcus_phage(66.67%)	7	NA	NA
WP_012743879.1|2980306_2981020_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.4	1.5e-32
WP_041254261.1|2981046_2981820_-	capsular biosynthesis protein	NA	A0A1X9I5E1	Streptococcus_phage	30.5	2.2e-21
WP_049757242.1|2981844_2982546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012743884.1|2983028_2983493_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.7	6.5e-45
WP_012743885.1|2983523_2984720_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.3	1.1e-109
WP_012743886.1|2984826_2985546_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.7	8.3e-39
WP_041254265.1|2985564_2986731_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.6	4.3e-45
>prophage 6
NC_012781	[Eubacterium] rectale ATCC 33656, complete sequence	3449685	3144684	3191797	3449685	integrase,transposase	Clostridium_phage(30.0%)	41	3174174:3174197	3195405:3195428
WP_012744067.1|3144684_3145863_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	30.4	2.0e-29
WP_012744068.1|3145907_3146147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744070.1|3147183_3147543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744072.1|3149739_3149913_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_041254287.1|3150203_3151379_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012744078.1|3152110_3152296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744079.1|3152288_3152798_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012744082.1|3153461_3153704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744083.1|3153996_3154284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012741734.1|3156114_3156414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744085.1|3156439_3156883_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_012741732.1|3156884_3157211_-	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	39.7	9.0e-09
WP_012744088.1|3158050_3158458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744089.1|3158622_3159921_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_022293545.1|3160028_3161615_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_012744091.1|3161743_3162634_-	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	48.2	7.3e-77
WP_012744092.1|3162645_3163776_-	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	45.4	2.4e-93
WP_022293547.1|3163747_3164899_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_012744094.1|3164912_3166208_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012744095.1|3166259_3167117_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.1	2.1e-17
WP_012744096.1|3167132_3168584_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012744097.1|3168717_3169212_-	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_012744098.1|3169208_3169499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012744101.1|3169912_3171238_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012744102.1|3171442_3171838_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012744103.1|3172103_3172952_-	DegV family protein	NA	NA	NA	NA	NA
3174174:3174197	attL	TTATTAATACACATAAAGGTACAT	NA	NA	NA	NA
WP_012744107.1|3174476_3176168_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012744109.1|3176731_3177175_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012744113.1|3178451_3179018_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012744114.1|3179180_3179897_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012744115.1|3179889_3180969_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	37.1	4.7e-70
WP_012740995.1|3181359_3182208_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	28.6	4.4e-23
WP_012740994.1|3182200_3183352_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012744117.1|3183758_3185057_-|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.2	4.8e-45
WP_005604344.1|3185141_3185762_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTR3	Clostridium_phage	36.5	6.1e-06
WP_005604346.1|3185937_3186168_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005604349.1|3188131_3188818_-	SdpI family protein	NA	NA	NA	NA	NA
WP_005604351.1|3188814_3189084_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005604353.1|3189341_3189581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008400128.1|3189876_3190653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012742056.1|3190948_3191797_+|integrase	site-specific integrase	integrase	A0A090EUH1	Clostridium_phage	24.4	4.1e-05
3195405:3195428	attR	TTATTAATACACATAAAGGTACAT	NA	NA	NA	NA
