The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	35558	169517	1884364	tRNA,protease,transposase,integrase	Bacillus_phage(20.0%)	108	103614:103632	181549:181567
WP_012472255.1|35558_36683_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	2.6e-79
WP_012472256.1|36776_37850_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_012472257.1|37867_40612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472258.1|40677_41922_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_012472259.1|42028_42568_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_083758782.1|43373_43571_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_083758867.1|43687_43807_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148204898.1|43963_44789_+|transposase	IS5-like element ISCaa2 family transposase	transposase	NA	NA	NA	NA
WP_012472262.1|44883_47175_-	sel1 repeat family protein	NA	A0A2P1EKD8	Megavirus	35.8	2.5e-12
WP_012472264.1|47623_48952_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012472265.1|48995_49622_-	DUF4290 domain-containing protein	NA	NA	NA	NA	NA
WP_012472266.1|49678_51952_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.5	1.5e-113
WP_012472267.1|52142_53936_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012472268.1|54869_58199_+	HD domain-containing protein	NA	B3FJI5	Pseudomonas_phage	37.5	4.1e-08
WP_052290779.1|58468_58714_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083758783.1|58744_58981_+	hypothetical protein	NA	F2Y2Q2	Organic_Lake_phycodnavirus	43.2	9.4e-08
WP_012472269.1|59116_60853_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_012472270.1|60943_62335_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_187146271.1|62476_63223_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_012472272.1|64243_66004_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.3e-53
WP_012472273.1|66036_66798_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_012472274.1|67132_67966_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_012472275.1|68186_69128_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_012472276.1|69153_69540_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_012472277.1|69544_69994_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_012472278.1|70419_71127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187146272.1|71129_71468_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_044282680.1|71508_72192_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012472281.1|72250_73063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472282.1|73224_73815_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_012472283.1|73928_74735_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_148204900.1|75132_75811_+|transposase	IS1-like element ISCaa4 family transposase	transposase	NA	NA	NA	NA
WP_012472285.1|76612_77632_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_012472286.1|77698_77944_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_012472287.1|77972_78467_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_012472288.1|78475_79084_+	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_012472289.1|79133_80732_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_012472290.1|80759_81632_+	ATP synthase F1 subunit gamma	NA	NA	NA	NA	NA
WP_012472291.1|83225_84704_-	ADP/ATP carrier protein	NA	NA	NA	NA	NA
WP_012472294.1|86064_86706_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_148204990.1|86883_87710_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012472296.1|87888_88737_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012472297.1|88954_90172_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044282685.1|90465_90951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472298.1|91050_91485_+	dUTP diphosphatase	NA	A0A1S5XYX0	Kurlavirus	65.5	2.2e-47
WP_148204991.1|91527_92517_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_044282687.1|92883_93528_+	DUF4292 domain-containing protein	NA	NA	NA	NA	NA
WP_012472301.1|93514_94774_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_148204901.1|95177_95645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148204992.1|96653_97480_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012472304.1|97706_98741_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_012472305.1|99024_100392_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1B1P7R7	Bacillus_phage	23.7	7.1e-07
WP_187146273.1|101888_103580_-	hypothetical protein	NA	NA	NA	NA	NA
103614:103632	attL	AATAGACCTACTGCGAAAG	NA	NA	NA	NA
WP_083758785.1|103696_104524_+|transposase	IS5-like element ISCaa6 family transposase	transposase	NA	NA	NA	NA
WP_148204902.1|104578_104791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472310.1|105016_105718_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012472311.1|106021_109009_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.7e-37
WP_187146274.1|109295_110321_+	ankyrin repeat domain-containing protein	NA	A0A068EEM9	Penguinpox_virus	34.5	3.5e-06
WP_012472313.1|110823_111273_+	hypothetical protein	NA	A0A0B5IXN2	Pandoravirus	40.5	2.3e-10
WP_148204903.1|111483_112005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472314.1|112436_112994_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	70.2	2.6e-64
WP_012472315.1|113050_113815_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_012472316.1|114439_115393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472317.1|115646_116999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472318.1|117110_117362_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_012472319.1|117462_118194_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012472320.1|118281_120702_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012472321.1|120711_121002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472322.1|121008_121293_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012472323.1|121285_122032_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	43.6	1.6e-08
WP_148204904.1|122542_125842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472325.1|126093_126405_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012472326.1|126412_126676_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012472327.1|126749_127109_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_012472329.1|128467_128656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083758868.1|129019_130531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472331.1|131516_132764_-	Glu/Leu/Phe/Val dehydrogenase	NA	S4VYP3	Pandoravirus	28.2	2.3e-36
WP_012472332.1|132817_134587_-	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	24.5	1.3e-21
WP_187146275.1|134651_135668_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_044282698.1|135744_136377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472337.1|138187_139276_-	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_012472338.1|139578_141204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472339.1|141349_141802_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_083758787.1|142253_144674_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472342.1|144986_145292_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_012472343.1|145297_147427_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.6	1.4e-54
WP_012472344.1|147429_147897_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_012472345.1|147925_148333_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_012472346.1|148684_149509_-|transposase	IS982-like element ISCaa5 family transposase	transposase	NA	NA	NA	NA
WP_012472347.1|150050_150329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012472348.1|150397_150994_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.9	8.1e-24
WP_012472349.1|151357_151711_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472350.1|152647_153001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472346.1|153100_153925_+|transposase	IS982-like element ISCaa5 family transposase	transposase	NA	NA	NA	NA
WP_012472351.1|153921_156114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472352.1|156651_157410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472353.1|157793_158519_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_012472354.1|158678_159914_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_012472355.1|159928_162655_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	4.0e-25
WP_012472356.1|162789_163008_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.0	2.3e-13
WP_012472357.1|163218_163413_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012472358.1|163657_164536_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.3	9.5e-21
WP_012472359.1|164786_165308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204907.1|165975_166224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472361.1|166351_166495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083758788.1|166537_166699_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_187146276.1|166701_167640_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472362.1|167768_169517_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
181549:181567	attR	CTTTCGCAGTAGGTCTATT	NA	NA	NA	NA
>prophage 2
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	348280	437679	1884364	tRNA,protease,transposase,integrase	uncultured_virus(14.29%)	50	383996:384055	446739:447470
WP_148204912.1|348280_348960_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012472503.1|349584_350679_-	signal peptidase I	NA	NA	NA	NA	NA
WP_012472504.1|350834_351557_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012472505.1|351528_352254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472506.1|352257_353148_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	37.7	7.4e-13
WP_012472507.1|353159_353948_-	ParA family protein	NA	H7BUL8	unidentified_phage	29.6	1.4e-18
WP_012472508.1|354467_356102_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	66.1	6.0e-194
WP_012472509.1|356164_356443_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	61.3	1.7e-24
WP_012472510.1|357894_359982_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012472512.1|360383_362342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146279.1|363327_365073_+	glycoside hydrolase family protein	NA	A0A1J0MH64	Acinetobacter_phage	41.1	3.2e-20
WP_044282730.1|365113_365593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146280.1|366083_366230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472516.1|366245_367772_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012472517.1|368139_369486_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472519.1|369839_370790_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_012472520.1|371609_372554_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012472521.1|372556_375367_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.3	8.2e-66
WP_012472522.1|375544_377923_-	transketolase	NA	NA	NA	NA	NA
WP_012472523.1|378240_379716_+|protease	serine protease	protease	NA	NA	NA	NA
WP_083758797.1|380363_380858_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012472524.1|380973_382443_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_012472525.1|382983_383769_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
383996:384055	attL	GGTATTGTTAAATTAAGATAGGCAGCTGATTATTTAGCTTGGCCATTAGCAGGTTGAGCG	NA	NA	NA	NA
WP_148204900.1|384002_384682_-|transposase	IS1-like element ISCaa4 family transposase	transposase	NA	NA	NA	NA
WP_012472526.1|384811_386323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472527.1|386567_388457_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.3	1.2e-49
WP_012472529.1|390339_391635_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.5	1.0e-79
WP_187146281.1|392864_393320_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044282734.1|393566_393884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472530.1|393983_401225_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472531.1|401399_403961_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_012472532.1|404360_404681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204913.1|405618_405915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204914.1|406049_406457_+|transposase	transposase	transposase	A0A160DCU2	Gordonia_phage	33.9	1.5e-08
WP_012472534.1|406895_408779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052290786.1|409016_409241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472538.1|411172_413008_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	3.0e-53
WP_012472539.1|413073_414201_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_012472540.1|414317_415592_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_012472541.1|416212_419548_+	HD domain-containing protein	NA	A0A291L9W9	Bordetella_phage	37.7	6.8e-11
WP_012472542.1|419636_420323_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_083758801.1|420414_420807_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_012472544.1|421059_421971_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	28.6	1.1e-24
WP_012472545.1|422156_423185_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_187146282.1|423566_424226_-	TIGR02453 family protein	NA	NA	NA	NA	NA
WP_012472547.1|424353_425844_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.3	3.1e-48
WP_012472548.1|427183_433699_-	ankyrin repeat domain-containing protein	NA	A0A1J0FA54	Only_Syngen_Nebraska_virus	24.8	3.0e-10
WP_012472549.1|433940_434516_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012472550.1|435429_436653_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012472346.1|436854_437679_+|transposase	IS982-like element ISCaa5 family transposase	transposase	NA	NA	NA	NA
446739:447470	attR	CGCTCAACCTGCTAATGGCCAAGCTAAATAATCAGCTGCCTATCTTAATTTAACAATACCAAGTAATAAATTCTAGTTGCTTGTTCATGCTGGCATGTTAATGAGAGTTTGATTCTGCTAGCATGGGTTTATGATATACTATTTTAGTTTTTATCTTCTCTACTACTTAGTAATTTTTCTATGACTTGTCTTAAGCTTACATTTGGGCATAACCTTTTGGGGTTTACAGGCTCTCTGCAGTTTGGGCAACTTTTTTGTGTATTTAGCCATTTTAGTAATTCCTGATGGCTAAAACTGTGTCCACATGGCGTAACAACAGGGTCTAAGAATAGTTCTTGTGTTAGTGGACAGATTAAATGATCTGGATAATCTATTTTATGTAATGAAGCTATATAGTTAGGGCCTTGATCTAAAATAGATTGGTAATGTTGGTAATATTCTTTAAATTTTTCTATTTCATTAACTTCATTGCTGGTTATGCCATGTGCAATTAGATTATAAATAGCAGCTATCGTAGTTCCTCTTTCAGTCAAATATTTTTCTGCTTCTTGCCTTATCTTCTCTTGCTTATCCTTTTGCGCTATTGCTTTTTGATTTTCACGTTGTATTCTGCCAAGATTTACCTCTAGGGATTTTCTCTTATCCTCAAGTTGTTTCTTTTGTTTTTGTATATTAGACTTATAAGTTTCCAATAATTTTAGTGTTATATCACGAGAACTCTCTAAATCCATT	NA	NA	NA	NA
>prophage 3
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	511495	577253	1884364	tRNA,protease,transposase	Acinetobacter_phage(20.0%)	32	NA	NA
WP_012472615.1|511495_514822_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	33.1	1.8e-168
WP_012472616.1|515430_516096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148204919.1|516594_517274_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012472618.1|518183_518708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472619.1|519035_519311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472620.1|519429_520410_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012472621.1|520538_520946_+	VOC family protein	NA	NA	NA	NA	NA
WP_012472622.1|521132_522695_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	25.9	1.3e-07
WP_012472623.1|522922_523432_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012472624.1|523721_525902_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_012472625.1|526009_526414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472626.1|526439_527267_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_012472627.1|527485_530866_+	HD domain-containing protein	NA	A0A1X9SH80	Bradyrhizobium_phage	32.5	2.9e-09
WP_012472628.1|531041_533162_+	ComEC family competence protein	NA	NA	NA	NA	NA
WP_012472629.1|533738_536954_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_148204920.1|538127_542390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472631.1|542661_545571_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_012472632.1|545920_549145_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012472634.1|549537_550878_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.6	3.3e-65
WP_052290793.1|550987_551596_+	WbqC family protein	NA	NA	NA	NA	NA
WP_012472636.1|551652_553374_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	45.6	1.5e-65
WP_012472631.1|554952_557862_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_012472632.1|558211_561436_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012472634.1|561828_563169_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.6	3.3e-65
WP_052290793.1|563278_563887_+	WbqC family protein	NA	NA	NA	NA	NA
WP_012472638.1|563943_566472_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	7.2e-122
WP_052290821.1|567008_567644_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012472640.1|567816_569997_+	hypothetical protein	NA	R4TVC0	Phaeocystis_globosa_virus	31.7	6.2e-13
WP_012472641.1|570286_571795_+	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
WP_012472642.1|571893_573210_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012472643.1|573336_575820_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	38.2	2.1e-142
WP_012472644.1|575861_577253_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.7	1.3e-40
>prophage 4
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	585002	683030	1884364	tRNA,transposase	Tupanvirus(12.5%)	55	NA	NA
WP_012472648.1|585002_586028_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	7.2e-28
WP_012472649.1|586274_586820_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_012472651.1|587928_589809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472652.1|590161_591862_+	DNA polymerase/3'-5' exonuclease PolX	NA	NA	NA	NA	NA
WP_012472653.1|591867_592758_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_012472654.1|593212_595111_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.0	6.4e-139
WP_012472655.1|595571_596162_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_012472656.1|598124_598868_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012472657.1|598864_599536_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012472658.1|599667_600375_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.1	5.8e-77
WP_148204921.1|600817_601497_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012472660.1|601582_602686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472661.1|602846_604496_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_012472662.1|604709_605672_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012472663.1|606031_606292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472370.1|607052_608084_+|transposase	IS110-like element ISCaa7 family transposase	transposase	M1NSC9	Streptococcus_phage	27.3	5.0e-05
WP_012472666.1|609651_614097_+	sel1 repeat family protein	NA	A0A076YJ70	Mesorhizobium_phage	28.1	4.2e-16
WP_012472667.1|614183_615248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187146289.1|615703_616270_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012472670.1|616412_617450_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_012472671.1|617528_618641_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
WP_052290795.1|619603_619924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472672.1|620217_627798_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012472673.1|628570_628798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472674.1|629389_630928_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044282968.1|631130_632900_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	2.0e-49
WP_187146306.1|633079_634168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472677.1|634702_636094_+	magnesium transporter	NA	NA	NA	NA	NA
WP_012472678.1|637429_639172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083758808.1|639330_652953_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_148204922.1|652939_653938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472681.1|654102_654381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472682.1|654424_655090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282756.1|655110_655908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472684.1|655938_656727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204923.1|657169_657848_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_148204995.1|658005_659013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472687.1|659445_660018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472688.1|660171_661008_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_187146290.1|661373_662219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282759.1|662244_664104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472692.1|664338_665358_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_012472694.1|665976_667725_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012472695.1|667861_670360_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_012472696.1|671019_671247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472697.1|671222_672341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146291.1|673077_673176_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012472699.1|673322_673646_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012472700.1|673652_674123_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_044282762.1|674129_674726_+	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_012472704.1|675600_676173_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012472705.1|676448_677717_-	insulinase family protein	NA	NA	NA	NA	NA
WP_044282973.1|678170_679166_+	ribonucleotide-diphosphate reductase subunit beta	NA	Q8QN14	Cowpox_virus	72.5	3.2e-134
WP_012472707.1|679204_681577_+	ribonucleoside-diphosphate reductase subunit alpha	NA	Q8JLF2	Ectromelia_virus	64.3	4.5e-299
WP_148204996.1|682203_683030_-|transposase	IS5-like element ISCaa3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	1011322	1104940	1884364	tRNA,protease,transposase,integrase	Staphylococcus_phage(13.33%)	60	1024178:1024195	1107099:1107116
WP_148204949.1|1011322_1012002_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012472943.1|1012440_1013193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472944.1|1013173_1013680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472945.1|1013842_1015537_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.9	1.2e-27
WP_012472946.1|1015877_1016684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472948.1|1017510_1018050_-	F-box protein	NA	NA	NA	NA	NA
WP_187146235.1|1018115_1018283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472949.1|1018659_1020141_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012472950.1|1020373_1021150_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_012472951.1|1021203_1024554_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
1024178:1024195	attL	TTATATATAAATTTGAAT	NA	NA	NA	NA
WP_148204951.1|1024683_1025301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472953.1|1025422_1026610_+	gliding motility lipoprotein GldJ	NA	A0A075BSL8	Microcystis_phage	28.5	1.7e-09
WP_012472954.1|1027392_1027569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472957.1|1029470_1030931_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.3	1.8e-56
WP_012472958.1|1032287_1033481_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_012472959.1|1033487_1034840_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_012472960.1|1034866_1035766_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012472961.1|1035897_1036881_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_012472962.1|1038291_1041930_+	tetratricopeptide repeat protein	NA	A0A1V0SDQ4	Indivirus	30.4	8.2e-10
WP_148204952.1|1042027_1042819_+|transposase	IS5-like element ISCaa8 family transposase	transposase	NA	NA	NA	NA
WP_083758826.1|1042833_1043055_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012472965.1|1043568_1044105_+	CvpA family protein	NA	NA	NA	NA	NA
WP_012472966.1|1044229_1044988_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012472967.1|1046034_1048533_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A1W6JN57	Lactococcus_phage	28.9	2.4e-40
WP_187146236.1|1048756_1051267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472969.1|1051576_1052761_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012472970.1|1052778_1055229_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.6	2.9e-120
WP_012472971.1|1055736_1056684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472972.1|1056619_1057834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148204953.1|1058774_1059716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472974.1|1060029_1060188_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_012472975.1|1061571_1061985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472976.1|1062016_1062433_-	DUF1761 domain-containing protein	NA	NA	NA	NA	NA
WP_012472977.1|1062508_1063198_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	40.3	7.4e-29
WP_012472979.1|1064040_1067358_+	HD domain-containing protein	NA	A0A291L9W9	Bordetella_phage	38.9	1.2e-10
WP_044282808.1|1067364_1067961_+	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	42.5	3.1e-31
WP_044282809.1|1068088_1068424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472982.1|1068639_1068930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472983.1|1069192_1069678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472984.1|1069665_1070100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472985.1|1070100_1071720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472986.1|1071664_1073944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012472987.1|1074103_1074307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472989.1|1075077_1077249_+	ankyrin repeat domain-containing protein	NA	R4TII5	Phaeocystis_globosa_virus	46.3	7.4e-06
WP_012472990.1|1078069_1080955_+	SEL1-like repeat protein	NA	A0A0G2Y6G7	Acanthamoeba_polyphaga_mimivirus	45.6	3.8e-10
WP_148204954.1|1081030_1083367_+	SEL1-like repeat protein	NA	A0A0G2Y6G7	Acanthamoeba_polyphaga_mimivirus	44.4	4.1e-10
WP_012472992.1|1084708_1086763_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012472993.1|1086792_1088007_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_187146237.1|1088462_1088648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472994.1|1088887_1089352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472995.1|1089605_1090580_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_012472996.1|1090738_1092535_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_012472997.1|1092930_1096392_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_012472998.1|1096512_1098018_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_012472999.1|1098861_1100355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473000.1|1100587_1100974_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	41.6	3.8e-14
WP_148205001.1|1101093_1102047_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.4e-24
WP_012473002.1|1102065_1102821_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012473003.1|1102953_1104054_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_044282811.1|1104496_1104940_+|transposase	IS200/IS605-like element ISCaa10 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.9	2.0e-19
1107099:1107116	attR	TTATATATAAATTTGAAT	NA	NA	NA	NA
>prophage 7
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	1110671	1171619	1884364	transposase	Clostridium_botulinum_C_phage(20.0%)	40	NA	NA
WP_044282811.1|1110671_1111115_+|transposase	IS200/IS605-like element ISCaa10 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.9	2.0e-19
WP_044282812.1|1111153_1112260_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012473009.1|1112252_1113146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282813.1|1113147_1113789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473011.1|1113775_1114168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204956.1|1114245_1114809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282814.1|1114810_1115590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282815.1|1115640_1118262_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_083758831.1|1118279_1118717_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_052290807.1|1118801_1119371_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473014.1|1119544_1120639_-|transposase	IS481-like element ISCaa12 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	66.7	1.5e-132
WP_083758833.1|1120697_1121474_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_187146238.1|1121555_1121693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146239.1|1122119_1123628_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_187146240.1|1123799_1123967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044282811.1|1123990_1124434_-|transposase	IS200/IS605-like element ISCaa10 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.9	2.0e-19
WP_012473019.1|1124515_1125139_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_148204948.1|1125352_1126178_+|transposase	IS5-like element ISCaa3 family transposase	transposase	NA	NA	NA	NA
WP_012473022.1|1130164_1135798_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012473023.1|1135966_1136359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473024.1|1136431_1137358_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	27.9	5.9e-21
WP_012473025.1|1137797_1142279_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012473026.1|1142303_1142702_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012473027.1|1142714_1143422_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	61.7	3.5e-82
WP_012473028.1|1143393_1144026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473030.1|1144644_1145403_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_012473031.1|1145399_1147211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148205002.1|1147242_1148877_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.3	6.9e-33
WP_052290808.1|1149103_1149286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012473033.1|1149512_1150337_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012473027.1|1150503_1151211_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	61.7	3.5e-82
WP_148204959.1|1151427_1152300_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_012473037.1|1152384_1153308_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	34.0	1.1e-14
WP_012473039.1|1154262_1155195_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_012473040.1|1155616_1158214_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_187146241.1|1159430_1162223_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473043.1|1162751_1164674_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	30.3	6.7e-43
WP_012473044.1|1164913_1167166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473045.1|1168076_1170818_-	UvrD-helicase domain-containing protein	NA	A0A1V0SDG5	Indivirus	29.2	3.2e-06
WP_148204960.1|1170941_1171619_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	1386460	1453468	1884364	tail,transposase	Synechococcus_phage(18.18%)	56	NA	NA
WP_012473177.1|1386460_1387957_+|tail	phage tail sheath family protein	tail	A0A222YVU5	Synechococcus_phage	27.1	6.4e-09
WP_012473178.1|1388077_1388581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473179.1|1388641_1389088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473180.1|1389107_1389572_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012473181.1|1389622_1389802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473182.1|1389820_1390954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473183.1|1391820_1393620_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_012473184.1|1393670_1393979_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012473185.1|1394003_1394399_+	GPW/gp25 family protein	NA	A0A0E3FJY3	Synechococcus_phage	33.0	6.6e-06
WP_012473186.1|1394410_1396906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204969.1|1396912_1401622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204970.1|1401840_1402008_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_187146308.1|1402086_1402807_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	1.4e-17
WP_012473189.1|1403290_1403791_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_148204971.1|1403820_1404303_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_187146254.1|1404310_1404790_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_148204972.1|1404929_1405481_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_044282856.1|1405491_1406151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473194.1|1407655_1407937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146255.1|1408279_1409323_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012473196.1|1409390_1410278_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_012473197.1|1410455_1411658_+	amidohydrolase	NA	NA	NA	NA	NA
WP_012473198.1|1411964_1412558_+	MarC family protein	NA	NA	NA	NA	NA
WP_012473199.1|1412563_1413022_+	ribonuclease HI	NA	A0A2I7QI15	Vibrio_phage	40.5	1.3e-26
WP_012473200.1|1413075_1414086_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012473201.1|1414091_1414415_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_012473202.1|1414855_1415545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473203.1|1415687_1416218_+	HIT family protein	NA	X4YGS3	Lactococcus_phage	31.2	4.4e-05
WP_012473204.1|1416539_1417943_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_012473205.1|1417963_1419058_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_187146256.1|1419273_1421754_-	SEL1-like repeat protein	NA	A0A2K9V9H4	Bandra_megavirus	23.4	1.3e-19
WP_012473208.1|1422595_1425403_-	sel1 repeat family protein	NA	A0A2P1EKA7	Megavirus	21.2	3.6e-13
WP_012473209.1|1426835_1428791_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.0	4.0e-136
WP_148204973.1|1428952_1429225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148204974.1|1429205_1429532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473212.1|1430423_1430912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473213.1|1430875_1431274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473214.1|1431286_1432951_+	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	31.1	2.4e-28
WP_012472753.1|1433029_1433857_+|transposase	IS5-like element ISCaa6 family transposase	transposase	NA	NA	NA	NA
WP_012473215.1|1433970_1434960_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_187146309.1|1435592_1437503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473217.1|1439318_1439612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473218.1|1439908_1440490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611288.1|1440980_1441807_-|transposase	IS5-like element ISCaa3 family transposase	transposase	NA	NA	NA	NA
WP_076611597.1|1442180_1443007_-|transposase	IS5-like element ISCaa2 family transposase	transposase	NA	NA	NA	NA
WP_012473223.1|1444198_1445035_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_012473224.1|1445105_1445324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473225.1|1445477_1445987_+	CvpA family protein	NA	NA	NA	NA	NA
WP_044282861.1|1447079_1447916_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_148204975.1|1447878_1448705_-|transposase	IS5-like element ISCaa3 family transposase	transposase	NA	NA	NA	NA
WP_052290810.1|1448792_1449515_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012473228.1|1449585_1450200_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	35.8	1.6e-14
WP_044282811.1|1450519_1450963_-|transposase	IS200/IS605-like element ISCaa10 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.9	2.0e-19
WP_012473229.1|1451133_1451535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473230.1|1451886_1452498_+	LysE family translocator	NA	NA	NA	NA	NA
WP_148204975.1|1452641_1453468_-|transposase	IS5-like element ISCaa3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	1465569	1538625	1884364	tRNA,protease,transposase	Acanthamoeba_polyphaga_mimivirus(10.0%)	47	NA	NA
WP_148204952.1|1465569_1466362_-|transposase	IS5-like element ISCaa8 family transposase	transposase	NA	NA	NA	NA
WP_012473239.1|1466817_1467135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473240.1|1467800_1470143_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	37.9	6.3e-136
WP_012473241.1|1470390_1471434_+	agmatinase family protein	NA	NA	NA	NA	NA
WP_012473242.1|1471505_1472525_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473243.1|1473061_1475497_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044282865.1|1475568_1476327_-	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	37.1	4.5e-27
WP_012473245.1|1476488_1477184_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012473246.1|1477161_1478058_-	DUF3822 family protein	NA	NA	NA	NA	NA
WP_012473247.1|1478349_1478694_+	DUF4296 domain-containing protein	NA	NA	NA	NA	NA
WP_044282868.1|1478700_1479186_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_148205006.1|1482054_1488732_+	AAA family ATPase	NA	Q6XLV6	Feldmannia_irregularis_virus	25.4	3.2e-36
WP_012473250.1|1489620_1490445_+|transposase	IS982-like element ISCaa5 family transposase	transposase	NA	NA	NA	NA
WP_012473251.1|1491318_1492059_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012473252.1|1492183_1494358_+	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	38.3	1.4e-86
WP_012473253.1|1494487_1494973_+	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
WP_012473254.1|1495001_1495484_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_012473255.1|1495480_1496872_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_012473256.1|1496952_1498254_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_012473257.1|1498444_1499890_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012473258.1|1499985_1500966_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	2.1e-13
WP_012473259.1|1501639_1503028_+|transposase	IS1182-like element ISCaa15 family transposase	transposase	NA	NA	NA	NA
WP_044283067.1|1503038_1506032_+	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_012473261.1|1506103_1507990_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.4	1.1e-71
WP_083758847.1|1508512_1509340_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148204919.1|1510496_1511175_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012473265.1|1513251_1514463_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	52.0	2.3e-110
WP_012473266.1|1514465_1515140_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.7	7.0e-40
WP_012473267.1|1515181_1516579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473268.1|1517014_1518289_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_012473269.1|1518581_1519910_+	MFS transporter	NA	NA	NA	NA	NA
WP_012472753.1|1520083_1520911_-|transposase	IS5-like element ISCaa6 family transposase	transposase	NA	NA	NA	NA
WP_012473271.1|1521091_1521676_-	ribonuclease HII	NA	A0A0N9QYD4	Chrysochromulina_ericina_virus	44.2	7.7e-35
WP_187146257.1|1521694_1523698_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_148204952.1|1524267_1525059_+|transposase	IS5-like element ISCaa8 family transposase	transposase	NA	NA	NA	NA
WP_012473274.1|1525408_1526110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148204977.1|1526101_1526781_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012473275.1|1526990_1527158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187146258.1|1528158_1528314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473276.1|1528885_1530220_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012473277.1|1530697_1531027_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_012473278.1|1531032_1531836_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_187146259.1|1531893_1533441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473280.1|1533617_1534982_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	22.0	3.6e-11
WP_012473281.1|1534991_1535849_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012473282.1|1535878_1537009_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012473283.1|1537257_1538625_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 12
NC_010830	Candidatus Amoebophilus asiaticus 5a2, complete sequence	1884364	1551168	1638599	1884364	tRNA,transposase,integrase	Chrysochromulina_ericina_virus(12.5%)	52	1548032:1548052	1645259:1645279
1548032:1548052	attL	GCCTTGCTCAGCTGCTTTTTC	NA	NA	NA	NA
WP_083758850.1|1551168_1551339_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012473298.1|1551265_1551763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083758851.1|1551674_1551899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473299.1|1551921_1556130_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012473300.1|1556590_1558249_-	SEL1-like repeat protein	NA	A0A0N9QA05	Chrysochromulina_ericina_virus	50.0	4.6e-08
WP_012473301.1|1558214_1558688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473302.1|1559129_1559546_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473303.1|1559613_1561032_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473304.1|1562263_1563568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473305.1|1564106_1564931_+|transposase	IS982-like element ISCaa5 family transposase	transposase	NA	NA	NA	NA
WP_148204978.1|1565096_1565987_-	F-box-like domain-containing protein	NA	NA	NA	NA	NA
WP_012473307.1|1566174_1567467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473308.1|1568071_1568401_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473309.1|1568696_1572446_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473310.1|1573758_1574883_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	29.2	9.3e-21
WP_012473311.1|1574962_1576264_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012473312.1|1576329_1577517_+	GTPase HflX	NA	NA	NA	NA	NA
WP_012473313.1|1579103_1580678_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_012473314.1|1580775_1581627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473315.1|1581871_1582531_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_012473316.1|1583300_1584176_+	lyase	NA	NA	NA	NA	NA
WP_012473317.1|1585972_1586872_-	site-specific tyrosine recombinase XerD	NA	S5W9T9	Leptospira_phage	28.7	2.7e-18
WP_012473318.1|1586950_1587265_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_012473319.1|1587944_1589453_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.7	7.2e-85
WP_044282877.1|1589546_1590029_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_148204979.1|1590429_1591109_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_012473322.1|1591169_1592573_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_148204980.1|1592924_1594424_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_012473324.1|1594548_1595310_+	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_012473325.1|1595312_1596623_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_012473326.1|1596642_1598109_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_012473327.1|1598932_1601890_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_083758854.1|1602557_1605023_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012473329.1|1605292_1608163_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_148204981.1|1608571_1609639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044282879.1|1610383_1611559_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012473332.1|1611652_1614286_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.8	4.1e-152
WP_012473333.1|1614323_1614875_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_012473334.1|1615230_1616373_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_012473336.1|1616691_1618440_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	3.7e-32
WP_012473338.1|1618871_1619051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473339.1|1619412_1620168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473340.1|1620473_1621010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473341.1|1621296_1622259_+	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
WP_012473345.1|1626022_1626967_-|transposase	IS481 family transposase	transposase	A0A0U3SCL7	Gibbon_ape_leukemia_virus	25.9	7.9e-05
WP_012473346.1|1627518_1627737_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_012473347.1|1628228_1628654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473348.1|1629665_1631339_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	32.9	1.7e-79
WP_044282883.1|1631913_1632117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012473349.1|1633112_1634159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012473350.1|1635636_1636335_+|transposase	IS1-like element ISCaa1 family transposase	transposase	NA	NA	NA	NA
WP_012473351.1|1637597_1638599_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1645259:1645279	attR	GCCTTGCTCAGCTGCTTTTTC	NA	NA	NA	NA
