The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010681	Paraburkholderia phytofirmans PsJN chromosome 1, complete sequence	4467537	203897	261637	4467537	integrase,transposase	uncultured_Caudovirales_phage(28.57%)	46	217545:217560	272853:272868
WP_162175311.1|203897_204008_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012431274.1|204110_205199_-	porin	NA	NA	NA	NA	NA
WP_012431275.1|205435_206818_-	MFS transporter	NA	NA	NA	NA	NA
WP_012431276.1|206856_207183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431277.1|207179_208517_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_012431278.1|208764_209625_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012431279.1|209765_210644_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012431280.1|211203_212040_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.8	3.4e-76
WP_012428335.1|212744_213533_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.6	3.0e-34
WP_012431281.1|215927_216449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039339331.1|216866_220016_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	26.2	2.2e-91
217545:217560	attL	CAGCGACAGGCCAAGG	NA	NA	NA	NA
WP_012431283.1|220028_221492_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_041758676.1|221415_222114_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_012431285.1|222390_222723_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012431286.1|223173_223695_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	46.2	8.1e-28
WP_012431287.1|223681_224743_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012431288.1|224752_225199_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012431289.1|225220_225985_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.0	8.4e-90
WP_039346158.1|225935_227198_+	MFS transporter	NA	NA	NA	NA	NA
WP_012431291.1|227282_228665_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012431292.1|228693_231300_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_012431293.1|231296_231959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021164077.1|232170_232434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431295.1|232541_233501_+	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_113976526.1|233840_235835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431297.1|236251_236773_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012431298.1|237118_237598_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012431299.1|237939_238389_+	cyanase	NA	NA	NA	NA	NA
WP_012431300.1|238385_238841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431303.1|239773_240649_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	47.3	1.4e-08
WP_012431304.1|240735_241665_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012431305.1|241744_243148_-	cytochrome c	NA	NA	NA	NA	NA
WP_012431306.1|243159_244938_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_012431307.1|244986_245706_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_012431308.1|246114_246435_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049868861.1|249067_249280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049868863.1|249278_250412_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.8	1.4e-16
WP_012431312.1|251059_252160_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021162791.1|252453_252822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431314.1|254040_254490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431315.1|254499_255204_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_012431316.1|255196_255916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039364591.1|256030_256237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431318.1|256432_256678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431319.1|259064_260291_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012431320.1|260287_261637_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
272853:272868	attR	CCTTGGCCTGTCGCTG	NA	NA	NA	NA
>prophage 2
NC_010681	Paraburkholderia phytofirmans PsJN chromosome 1, complete sequence	4467537	814839	824223	4467537		Hokovirus(16.67%)	8	NA	NA
WP_012431797.1|814839_816792_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	48.9	8.6e-147
WP_012431798.1|817071_818211_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	40.3	8.3e-25
WP_012431799.1|818236_820153_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	35.1	8.6e-51
WP_012431800.1|820217_820364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012431801.1|820504_821320_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	29.2	7.0e-34
WP_012431802.1|821359_822040_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	27.4	4.3e-05
WP_012431803.1|822036_822585_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012431804.1|822633_824223_-	polynucleotide adenylyltransferase PcnB	NA	A0A172Q0J1	Acinetobacter_phage	30.6	2.6e-16
>prophage 3
NC_010681	Paraburkholderia phytofirmans PsJN chromosome 1, complete sequence	4467537	1293671	1335166	4467537	protease,terminase,portal,transposase,integrase,head,tail	Burkholderia_phage(11.11%)	42	1293441:1293463	1341148:1341170
1293441:1293463	attL	TGAACTACAGGGAGATGGATATT	NA	NA	NA	NA
WP_012432192.1|1293671_1294769_+|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	32.8	5.9e-44
WP_012432193.1|1294873_1296013_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	55.2	2.8e-89
WP_012432194.1|1296002_1297013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432195.1|1297066_1298020_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	66.5	3.6e-122
WP_012432196.1|1298072_1298306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148225114.1|1298314_1298614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012432199.1|1300126_1300441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012432201.1|1300672_1301020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012432202.1|1301237_1301435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012432203.1|1301664_1302054_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083772040.1|1302141_1302351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432204.1|1302732_1303248_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	45.3	6.8e-27
WP_041758313.1|1303244_1303625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432206.1|1303787_1306478_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	46.5	3.3e-96
WP_012432207.1|1306716_1307499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432208.1|1307718_1308474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432209.1|1308667_1309315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432210.1|1309262_1311317_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	36.5	2.8e-100
WP_012432211.1|1311319_1311523_+	hypothetical protein	NA	A0A219YA34	Aeromonas_phage	55.6	2.0e-06
WP_012432212.1|1311524_1312994_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.4	1.8e-80
WP_012432213.1|1313088_1315152_+|head,protease	HK97 family phage prohead protease	head,protease	A0A076G7Y9	Pseudoalteromonas_phage	33.5	3.6e-71
WP_012432214.1|1315233_1315563_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_012432215.1|1315559_1315871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432216.1|1315867_1316299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432217.1|1316361_1317291_+	hypothetical protein	NA	G8EY04	Synechococcus_phage	39.1	1.3e-49
WP_012432218.1|1317370_1317700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432219.1|1317771_1318089_+	DUF1799 domain-containing protein	NA	A0A0H5ARS5	Pseudomonas_phage	41.2	1.3e-09
WP_012432220.1|1318122_1323246_+|tail	phage tail length tape measure family protein	tail	L7P7M2	Pseudomonas_phage	29.1	6.3e-32
WP_012432221.1|1323242_1324721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041758800.1|1324756_1325635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148225115.1|1326105_1327530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041758318.1|1327562_1327784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148225069.1|1327883_1328444_+	lysozyme	NA	A0A088FRS5	Escherichia_phage	40.6	2.5e-27
WP_012432226.1|1328440_1328845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012432227.1|1328898_1329240_+	hypothetical protein	NA	R4JJW4	Burkholderia_phage	48.9	6.3e-13
WP_012432228.1|1329236_1329659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148225070.1|1329714_1329930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041758322.1|1330441_1331176_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	83.2	3.6e-98
WP_012428257.1|1331100_1331889_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.1	1.7e-37
WP_012428256.1|1331891_1333418_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_083772065.1|1333583_1333856_+	DNA methyltransferase	NA	Q8W6S4	Burkholderia_virus	66.7	5.9e-22
WP_167315744.1|1334119_1335166_+	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.6	1.8e-18
1341148:1341170	attR	TGAACTACAGGGAGATGGATATT	NA	NA	NA	NA
>prophage 4
NC_010681	Paraburkholderia phytofirmans PsJN chromosome 1, complete sequence	4467537	3561453	3575447	4467537	protease	Salmonella_phage(12.5%)	11	NA	NA
WP_012434127.1|3561453_3561900_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	62.6	3.7e-45
WP_012434128.1|3562299_3564810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012434129.1|3564876_3567174_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.5	2.1e-168
WP_012434130.1|3567170_3567485_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	7.6e-13
WP_007180614.1|3568033_3568240_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	2.4e-23
WP_012434131.1|3568437_3569253_-	hypothetical protein	NA	Q98453	Paramecium_bursaria_Chlorella_virus	35.2	1.8e-34
WP_012434132.1|3569554_3570811_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	66.7	1.4e-12
WP_012434133.1|3571126_3571696_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_041758551.1|3572152_3572347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012434134.1|3572492_3573011_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	39.2	1.3e-12
WP_012434135.1|3573341_3575447_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.0e-60
>prophage 1
NC_010676	Paraburkholderia phytofirmans PsJN chromosome 2, complete sequence	3625999	2807775	2844182	3625999	integrase,transposase	Stx2-converting_phage(28.57%)	33	2808012:2808026	2847337:2847351
WP_012428330.1|2807775_2809371_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.1	8.2e-156
2808012:2808026	attL	CGGCCGCGTTGTTGT	NA	NA	NA	NA
WP_095211899.1|2809303_2809768_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.2	1.9e-28
WP_012428331.1|2809764_2810202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012428332.1|2811097_2812048_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_012428333.1|2812044_2812782_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_012428334.1|2813223_2814414_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_167315784.1|2814520_2815147_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012428335.1|2815296_2816085_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.6	3.0e-34
WP_148225174.1|2817811_2818222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012428338.1|2818388_2819576_-	porin	NA	NA	NA	NA	NA
WP_012428339.1|2819757_2820882_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012428340.1|2820878_2822294_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012428341.1|2822277_2822670_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_148225210.1|2823287_2825021_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_012428343.1|2825085_2827122_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_012428344.1|2827410_2827881_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012428345.1|2828014_2828419_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_012428346.1|2828415_2829096_+	LrgB family protein	NA	NA	NA	NA	NA
WP_012428347.1|2829345_2830158_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012428348.1|2830172_2831045_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012428349.1|2831031_2832120_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	4.8e-30
WP_041759856.1|2832192_2833260_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012428351.1|2833583_2834501_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167315785.1|2834632_2835178_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A1I5U0	Burkholderia_phage	44.3	1.0e-25
WP_012428352.1|2835673_2836999_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012428353.1|2837284_2838652_-|integrase	site-specific integrase	integrase	Q858E8	Salmonella_phage	51.5	5.5e-108
WP_012428354.1|2839655_2840243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012428355.1|2840437_2840794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012428356.1|2841066_2841669_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167315760.1|2841855_2841993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148225211.1|2841943_2842081_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085966745.1|2842197_2842440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012428357.1|2842946_2844182_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	62.1	1.7e-137
2847337:2847351	attR	CGGCCGCGTTGTTGT	NA	NA	NA	NA
>prophage 1
NC_010679	Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence	121122	52822	94993	121122	integrase	uncultured_Caudovirales_phage(33.33%)	41	75173:75189	96399:96415
WP_012428288.1|52822_54271_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_148225104.1|55101_56151_+	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	28.3	1.9e-23
WP_012428290.1|56147_58031_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_012428291.1|58027_58390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430982.1|58442_59036_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	36.7	6.4e-21
WP_012430983.1|59087_59288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430984.1|59265_59538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430985.1|59527_59788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430986.1|60479_60860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430987.1|60908_61121_+	DUF3717 domain-containing protein	NA	NA	NA	NA	NA
WP_012430988.1|61139_61418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430989.1|61577_61940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430991.1|62683_63091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012430992.1|63087_63843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148225228.1|63846_64389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012430994.1|64811_65195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430995.1|65196_66885_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012430996.1|66890_71351_+	relaxase domain-containing protein	NA	Q8W6J4	Sinorhizobium_phage	61.2	5.0e-49
WP_012430997.1|71458_72151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430998.1|72158_72971_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_041760058.1|73139_73421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012430999.1|73389_73812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431000.1|73816_74152_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_012431001.1|74135_76685_+	hypothetical protein	NA	NA	NA	NA	NA
75173:75189	attL	TATCGCCGTGTTCGAGG	NA	NA	NA	NA
WP_012431002.1|76687_77392_+	type IV secretion system family protein	NA	NA	NA	NA	NA
WP_012431003.1|77469_78468_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_012431004.1|78669_79569_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_012431005.1|79565_80474_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_012431006.1|80470_81769_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012431007.1|81765_82941_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_012431008.1|83096_84278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148225232.1|84461_84875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431010.1|84888_85194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431011.1|85221_85881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431012.1|85880_87089_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012431013.1|87085_88825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431014.1|88817_90884_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_148225240.1|90913_91273_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012431017.1|91608_91920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012431018.1|92003_93197_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012431019.1|93193_94993_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
96399:96415	attR	TATCGCCGTGTTCGAGG	NA	NA	NA	NA
