The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	42317	53773	2209198		Synechococcus_phage(33.33%)	8	NA	NA
WP_000668272.1|42317_44471_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	3.6e-45
WP_000801611.1|44483_45833_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043309.1|46002_46710_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.3e-41
WP_050167432.1|46711_46855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361173.1|46911_50637_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.8	2.1e-37
WP_000220633.1|50729_52172_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
WP_001284588.1|52208_53231_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	1.2e-64
WP_000717505.1|53227_53773_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	5.7e-24
>prophage 2
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	105485	129549	2209198	tRNA,bacteriocin	Streptococcus_phage(66.67%)	24	NA	NA
WP_001230165.1|105485_105773_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724257.1|105824_107933_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571330.1|107929_108571_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	4.3e-23
WP_001038474.1|108777_109584_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001268157.1|110308_111172_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000915346.1|111637_111976_+	peptidase C39	NA	NA	NA	NA	NA
WP_000424429.1|111953_112325_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000989849.1|112332_112545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812342.1|113426_114485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812343.1|114799_115777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424478.1|116134_116509_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619809.1|116716_117619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424425.1|117674_118007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072920.1|118003_118732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770315.1|119475_119706_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	55.9	1.5e-13
WP_001813670.1|119690_119969_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	53.8	9.3e-23
WP_001035312.1|120254_122084_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_001282991.1|122484_123606_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193615.1|123746_124202_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220940.1|124211_126125_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331974.1|126477_128157_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|128158_128392_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000977347.1|129209_129362_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180803.1|129363_129549_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
>prophage 3
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	156961	182544	2209198	integrase,transposase	Streptococcus_phage(85.71%)	26	176123:176138	182996:183011
WP_000085666.1|156961_158023_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	6.7e-29
WP_000444652.1|158024_158717_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001180348.1|158847_159606_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000420682.1|159929_160244_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|160259_160646_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|160674_162060_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|162062_162215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398284.1|162237_163443_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_001009055.1|163485_163707_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	98.6	1.6e-30
WP_000342539.1|163823_164321_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|164295_164802_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000331160.1|164785_167233_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000804748.1|167235_169413_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000769868.1|169409_170411_+	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_001224320.1|170407_171343_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_001814923.1|171587_171704_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691733.1|171719_173639_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	96.7	0.0e+00
WP_000336323.1|173757_173925_+	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001814874.1|174355_174439_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038789.1|174563_175301_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	1.8e-134
WP_000576156.1|175655_176210_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
176123:176138	attL	CAAAGAGTATTCTATT	NA	NA	NA	NA
WP_001240984.1|176213_179132_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.4e-169
WP_000804885.1|179931_180354_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|180350_180581_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|181041_181245_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_001291561.1|181326_182544_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
182996:183011	attR	AATAGAATACTCTTTG	NA	NA	NA	NA
>prophage 5
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	824239	900512	2209198	integrase,transposase,holin,protease	Streptococcus_phage(50.0%)	69	820002:820042	896201:896241
820002:820042	attL	TCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCAGG	NA	NA	NA	NA
WP_000444456.1|824239_825205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.8e-33
WP_000466653.1|825227_825809_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000526345.1|825838_829189_+	DEAD/DEAH box helicase family protein	NA	A0A2H4P9W3	Gordonia_phage	24.8	1.4e-11
WP_001813704.1|829588_830935_-|transposase	IS1380-like element ISSpn5 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	39.8	2.2e-77
WP_000095641.1|830996_831191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693053.1|831168_831369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840765.1|831901_832045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821301.1|832137_832725_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000926541.1|833122_833932_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000078473.1|833936_834638_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000654135.1|834662_835580_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000537365.1|835607_837149_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_000587138.1|837167_837626_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000739353.1|837627_839850_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000248712.1|839889_840999_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000691263.1|841155_842046_+	ROK family protein	NA	NA	NA	NA	NA
WP_000185367.1|842070_842394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018348.1|842383_844375_+	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000400484.1|844390_844867_+	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_000067169.1|844900_845482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380539.1|845546_846554_+	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_000387941.1|846543_846864_+	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_000191784.1|846926_848702_+	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_000111249.1|848702_850088_+	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000251933.1|850110_850722_+	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_000012987.1|852473_852734_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_001043003.1|852837_853308_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212044.1|853324_855598_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561537.1|855944_859046_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.8	8.9e-114
WP_000820854.1|859128_860136_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042814.1|860194_861700_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000749594.1|863517_864390_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000420562.1|865022_865334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759765.1|865337_866054_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617845.1|866183_866999_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123614.1|866995_867901_-	permease	NA	NA	NA	NA	NA
WP_000442116.1|868290_869610_+	DUF1919 domain-containing protein	NA	NA	NA	NA	NA
WP_000359134.1|869711_871841_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778585.1|871827_872277_+	SprT family protein	NA	NA	NA	NA	NA
WP_012386730.1|872334_872607_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680767.1|872960_873152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173354.1|873579_874338_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.1e-25
WP_000489398.1|874339_876328_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_162828736.1|876369_877014_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153911.1|877039_877915_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	4.0e-27
WP_000661009.1|878621_880097_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001821685.1|880062_880533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000366713.1|881033_881894_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088782.1|881890_883150_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764364.1|883149_884277_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969454.1|884273_885359_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.2	5.9e-89
WP_001246755.1|885368_886244_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593574.1|886424_887234_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602446.1|887505_887727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000745370.1|887780_888452_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001025704.1|888693_889602_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|889598_890060_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403193.1|890049_890937_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000728269.1|890939_892823_+|holin	phosphorylcholine esterase CbpE	holin	Q332B9	Clostridium_botulinum_C_phage	22.9	1.2e-09
WP_001844793.1|892902_894033_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
WP_000254675.1|894042_895305_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	2.5e-139
WP_000689710.1|895308_896106_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.9	1.2e-59
WP_000033390.1|896325_896964_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.6	6.4e-75
896201:896241	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGA	NA	NA	NA	NA
WP_000806714.1|896960_897851_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|897890_898208_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166880.1|898210_899080_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.1	2.7e-116
WP_001261452.1|899306_899825_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345256.1|899933_900071_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_000008690.1|900077_900512_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	40.0	4.6e-08
>prophage 6
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	1209525	1260899	2209198	transposase,holin,protease,integrase,tRNA	Bacillus_phage(15.38%)	46	1197204:1197221	1267415:1267432
1197204:1197221	attL	TATTTTGATGATTGATTT	NA	NA	NA	NA
WP_000021543.1|1209525_1211163_-|tRNA	methionine--tRNA ligase	tRNA	A0A167RM67	Powai_lake_megavirus	32.0	2.5e-75
WP_000903082.1|1211230_1211905_-	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_000291699.1|1211963_1212086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001155347.1|1212750_1213704_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	4.8e-34
WP_000705304.1|1214275_1215124_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.5	4.2e-34
WP_000643970.1|1215219_1215909_-	NTP transferase domain-containing protein	NA	A0A127AW70	Bacillus_phage	45.0	3.4e-05
WP_000837614.1|1215920_1216799_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000411218.1|1216788_1217658_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609886.1|1217674_1218697_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638503.1|1218701_1219409_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835893.1|1219744_1221232_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811992.1|1221241_1222045_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	5.3e-10
WP_001199651.1|1222046_1222856_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
WP_001126409.1|1223130_1226307_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|1226619_1227699_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293845.1|1227748_1228672_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	8.7e-25
WP_000850024.1|1228690_1229212_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000244451.1|1229422_1230052_-	endonuclease III	NA	NA	NA	NA	NA
WP_000773226.1|1230051_1230594_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000389597.1|1230763_1231081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001812708.1|1231319_1232879_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	9.3e-11
WP_000895736.1|1233027_1233927_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219823.1|1233928_1234489_-	LemA family protein	NA	NA	NA	NA	NA
WP_000801941.1|1234582_1235296_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000808288.1|1235647_1236931_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.3	4.0e-60
WP_000863653.1|1237125_1238697_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402071.1|1238708_1239041_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_000702355.1|1239131_1239509_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003498.1|1239580_1240885_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.2	1.7e-26
WP_000023503.1|1240897_1241704_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000002875.1|1241914_1243690_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_000868700.1|1244175_1245357_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_000722391.1|1245369_1246590_-	caspase family protein	NA	NA	NA	NA	NA
WP_000427009.1|1246683_1247538_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001812200.1|1247769_1247937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068669.1|1248217_1248565_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237416.1|1248683_1249013_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.8	6.3e-10
WP_000712098.1|1249006_1249381_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362438.1|1249377_1249644_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162130.1|1249759_1250203_-	flavodoxin	NA	NA	NA	NA	NA
WP_000401770.1|1250306_1251242_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|1251295_1251580_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000252103.1|1251636_1252215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199540.1|1254185_1255532_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000058659.1|1255820_1259399_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000237019.1|1259711_1260899_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.6	5.2e-30
1267415:1267432	attR	TATTTTGATGATTGATTT	NA	NA	NA	NA
>prophage 7
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	1306690	1321581	2209198	transposase	Streptococcus_phage(85.71%)	17	NA	NA
WP_000420682.1|1306690_1307005_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1307020_1307407_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000813488.1|1307435_1308821_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000879507.1|1308823_1308976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001815707.1|1308998_1310417_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	1.5e-233
WP_001814874.1|1310465_1310549_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038797.1|1310673_1311459_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	3.3e-134
WP_000627290.1|1311796_1312339_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|1312431_1313226_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000635249.1|1314403_1314643_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
WP_001814874.1|1314691_1314775_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038791.1|1314899_1315637_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	98.8	1.2e-133
WP_000576156.1|1315991_1316546_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
WP_001240984.1|1316549_1319468_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.4e-169
WP_000804885.1|1320267_1320690_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|1320686_1320917_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|1321377_1321581_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
>prophage 8
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	1410949	1472212	2209198	transposase,holin,tRNA	Streptococcus_phage(25.0%)	60	NA	NA
WP_094866127.1|1410949_1411336_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_000691855.1|1411319_1411514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001136122.1|1412049_1412235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065728.1|1412538_1414101_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936187.1|1414242_1414941_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071672.1|1414983_1415880_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872206.1|1415888_1416824_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102216.1|1416820_1417546_-	CppA family protein	NA	NA	NA	NA	NA
WP_000290652.1|1417629_1418265_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.2	7.4e-07
WP_000972923.1|1418266_1419094_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001272961.1|1420691_1421303_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855754.1|1421347_1422076_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272318.1|1422114_1423026_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	3.8e-89
WP_000926599.1|1423091_1423316_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|1423393_1424137_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|1424136_1424937_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1425094_1425451_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170352.1|1425463_1425976_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	9.4e-45
WP_000405821.1|1425975_1426470_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.8	2.9e-43
WP_000858735.1|1426604_1427051_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097982.1|1427047_1427695_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000915992.1|1428046_1429363_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000247936.1|1429380_1430112_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000689942.1|1430668_1431253_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1431253_1432129_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036789.1|1432280_1433660_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175407.1|1433953_1434877_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915928.1|1434936_1435542_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.7	2.2e-53
WP_000673689.1|1435560_1436805_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	3.8e-55
WP_000371293.1|1437027_1437285_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164752.1|1437326_1439363_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038762.1|1439648_1440566_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000369579.1|1440757_1441519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099675.1|1441791_1442634_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.7e-51
WP_013193417.1|1442747_1444139_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001810003.1|1444373_1444751_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_000915891.1|1444875_1445853_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000850585.1|1445849_1446932_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	1.8e-37
WP_001040724.1|1448400_1449597_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.6	7.3e-32
WP_000348122.1|1450529_1451399_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_041170898.1|1452099_1453206_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_000935666.1|1453316_1453571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001813701.1|1453910_1454357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000121704.1|1454988_1456707_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	83.2	1.2e-272
WP_000434643.1|1458309_1458657_+	thioredoxin	NA	NA	NA	NA	NA
WP_000759185.1|1458936_1459773_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891772.1|1459785_1460415_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	1.2e-28
WP_000120830.1|1460424_1461066_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001065961.1|1461211_1462441_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000435439.1|1462430_1463597_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000665619.1|1463740_1464754_+	lactonase family protein	NA	NA	NA	NA	NA
WP_000068050.1|1464798_1465218_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_000094360.1|1465228_1466635_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_000301210.1|1466720_1467599_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_000996644.1|1467614_1469120_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000359036.1|1469134_1469671_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_000558554.1|1469670_1470165_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000392851.1|1470178_1470895_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_001054562.1|1470929_1471130_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_001179431.1|1471204_1472212_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	35.7	5.4e-36
>prophage 9
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	1520140	1526891	2209198	protease	Streptococcus_phage(50.0%)	9	NA	NA
WP_000081011.1|1520140_1521106_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
WP_000011276.1|1521139_1522051_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	100.0	2.3e-155
WP_001231086.1|1522047_1523025_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	100.0	1.2e-184
WP_000163035.1|1523021_1523912_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	6.7e-06
WP_001140412.1|1523963_1524344_-	RidA family protein	NA	NA	NA	NA	NA
WP_000422605.1|1524354_1524942_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000106354.1|1524950_1526183_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	6.4e-132
WP_000442276.1|1526214_1526385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162437.1|1526384_1526891_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	43.8	4.6e-28
>prophage 10
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	1824342	1831674	2209198		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167829.1|1824342_1825044_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.5	5.4e-35
WP_000777248.1|1825466_1826426_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193674.1|1826415_1827372_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764304.1|1827368_1828121_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	5.6e-14
WP_000858246.1|1828216_1829182_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821614.1|1829406_1829649_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	1.0e-17
WP_001222228.1|1829648_1830371_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105310.1|1830357_1830927_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	5.0e-15
WP_000351912.1|1830945_1831674_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	6.9e-09
>prophage 11
NC_010582	Streptococcus pneumoniae CGSP14, complete sequence	2209198	2187051	2195805	2209198		Bacillus_phage(33.33%)	9	NA	NA
WP_000510412.1|2187051_2187891_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.1e-15
WP_000835715.1|2187875_2188703_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	33.3	3.5e-17
WP_000712129.1|2188699_2189245_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2189255_2190077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170191.1|2190118_2191402_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	8.4e-18
WP_000424272.1|2191398_2192649_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.3	2.7e-93
WP_000455903.1|2192807_2193176_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266650.1|2193178_2194276_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|2194326_2195805_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
