The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010725	Methylorubrum populi BJ001, complete sequence	5800441	333037	367180	5800441	integrase,transposase	Tetraselmis_virus(25.0%)	32	334612:334632	370962:370982
WP_081435370.1|333037_334396_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
334612:334632	attL	TGGCGGAGAGGGGGGGATTCG	NA	NA	NA	NA
WP_012452255.1|335124_336417_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_081435371.1|336359_337109_+	response regulator	NA	NA	NA	NA	NA
WP_012452257.1|337152_337536_-	response regulator	NA	NA	NA	NA	NA
WP_012452258.1|337532_340238_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_052300021.1|340469_340691_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_012452259.1|341258_341675_-	ester cyclase	NA	NA	NA	NA	NA
WP_158022316.1|341687_341942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041371834.1|341995_343093_-	catalase family protein	NA	NA	NA	NA	NA
WP_012452262.1|343340_344423_+	catalase family protein	NA	NA	NA	NA	NA
WP_012452263.1|344461_345031_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_012452264.1|345089_345854_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.2	2.3e-10
WP_041370975.1|346000_346531_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_012452266.1|346807_347017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012452267.1|347073_347592_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_085985393.1|348176_348942_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012452268.1|349146_349332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012452269.1|349356_350778_-	exonuclease VII large subunit-like protein	NA	NA	NA	NA	NA
WP_012452270.1|350855_351776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012452271.1|352115_353987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012452272.1|354049_354478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041370979.1|354476_354704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012452273.1|355006_355318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012452274.1|355926_356502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012452275.1|356608_357448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162091587.1|357455_357893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012452277.1|360009_361056_+|transposase	IS110-like element ISMpo4 family transposase	transposase	NA	NA	NA	NA
WP_012452279.1|361807_362272_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	40.0	4.7e-19
WP_012452280.1|362630_362870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041370981.1|363128_363680_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003596089.1|364462_365671_-|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_085985395.1|365996_367180_-|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
370962:370982	attR	TGGCGGAGAGGGGGGGATTCG	NA	NA	NA	NA
>prophage 2
NC_010725	Methylorubrum populi BJ001, complete sequence	5800441	1478694	1541119	5800441	head,protease,integrase,tail	Paracoccus_phage(20.0%)	60	1477863:1477878	1524317:1524332
1477863:1477878	attL	CGGTCATCAGATCCTG	NA	NA	NA	NA
WP_012453281.1|1478694_1480038_+|integrase	tyrosine-type recombinase/integrase	integrase	Q2A0C3	Sodalis_phage	33.1	1.5e-12
WP_052300028.1|1480174_1484065_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012453283.1|1484607_1485516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453284.1|1485657_1486428_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_012453285.1|1486512_1487091_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012453286.1|1487329_1488634_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_012453287.1|1488915_1489320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453288.1|1489429_1490503_+	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_012453289.1|1490594_1491140_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_012453290.1|1491129_1491765_+	SCO family protein	NA	NA	NA	NA	NA
WP_052300029.1|1491887_1492244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453292.1|1492285_1494427_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012453293.1|1494601_1494844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453294.1|1494844_1495246_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041371144.1|1495291_1496764_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_012453296.1|1496903_1497575_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012453297.1|1497738_1498761_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_012453298.1|1498757_1499483_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_012453299.1|1499479_1500832_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_012453300.1|1501088_1501286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453301.1|1501788_1502019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012453302.1|1502080_1503127_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	36.4	1.5e-41
WP_012453303.1|1503236_1503389_+	DUF3309 family protein	NA	NA	NA	NA	NA
WP_012453304.1|1503408_1504863_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012453305.1|1505144_1510451_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_012453306.1|1510455_1512570_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_012453307.1|1512709_1513030_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_012453308.1|1513034_1513832_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012453309.1|1513882_1514494_-	class GN sortase	NA	NA	NA	NA	NA
WP_114415924.1|1514490_1516674_-	marine proteobacterial sortase target protein	NA	A0A2K9L1J5	Tupanvirus	21.5	7.1e-09
WP_012453311.1|1516907_1517519_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012453312.1|1517509_1518235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012453313.1|1518299_1519313_-	nickel transporter	NA	NA	NA	NA	NA
WP_012453314.1|1519303_1519963_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_012453315.1|1520045_1520507_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012453316.1|1520503_1522504_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_012453317.1|1522550_1523060_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_012453318.1|1523222_1524773_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
1524317:1524332	attR	CGGTCATCAGATCCTG	NA	NA	NA	NA
WP_012453319.1|1524921_1526337_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012453320.1|1526429_1526666_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_012453321.1|1526665_1527064_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012453322.1|1527070_1527748_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041371149.1|1527787_1528162_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012453324.1|1528344_1528581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012453325.1|1528599_1528953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012453326.1|1529050_1529641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012453327.1|1529627_1530257_-	glycoside hydrolase family protein	NA	W6E9Q2	Rhizobium_phage	42.1	2.0e-25
WP_012453328.1|1530303_1531386_-	DUF2793 domain-containing protein	NA	A0A0S0MV96	Pseudomonas_phage	43.0	7.1e-10
WP_012453329.1|1531412_1535315_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	37.0	1.1e-198
WP_012453330.1|1535341_1535800_-	peptidase P60	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.3	5.3e-31
WP_012453331.1|1535807_1536701_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	38.9	2.3e-54
WP_012453332.1|1536711_1537353_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.8	1.9e-47
WP_012453333.1|1537364_1537991_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	67.4	1.5e-07
WP_012453334.1|1537977_1538220_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_012453335.1|1538216_1538543_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_012453336.1|1538545_1538956_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_012453337.1|1538986_1539406_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012453338.1|1539402_1539741_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_012453339.1|1539763_1540339_-	phiE125 gp8 family protein	NA	NA	NA	NA	NA
WP_012453340.1|1540372_1541119_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_010725	Methylorubrum populi BJ001, complete sequence	5800441	3406518	3413887	5800441	tRNA	Cronobacter_phage(16.67%)	9	NA	NA
WP_012455040.1|3406518_3407790_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	1.2e-53
WP_012455041.1|3407928_3409062_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_012455042.1|3409058_3409664_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_012455043.1|3409668_3409956_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	45.1	7.4e-15
WP_012455044.1|3409952_3410255_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	57.0	2.0e-23
WP_012455045.1|3410387_3411488_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	6.2e-78
WP_012455046.1|3411523_3412600_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.4	1.1e-58
WP_012455047.1|3412699_3412933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041372038.1|3412957_3413887_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	32.4	3.6e-34
>prophage 4
NC_010725	Methylorubrum populi BJ001, complete sequence	5800441	3930323	4073253	5800441	protease,transposase	Corynebacterium_phage(11.11%)	120	NA	NA
WP_012452059.1|3930323_3931667_+|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
WP_012455550.1|3934229_3934991_-	ubiquitin-activating protein	NA	NA	NA	NA	NA
WP_012455551.1|3934983_3936609_-	guanylate cyclase	NA	NA	NA	NA	NA
WP_012455552.1|3936623_3937244_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_157228243.1|3937459_3938335_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_012455554.1|3938518_3940549_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012455555.1|3940536_3941907_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012455556.1|3942036_3943674_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_012455557.1|3944159_3946355_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012455558.1|3946408_3946948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455559.1|3946944_3947931_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_012455560.1|3948015_3948939_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012455561.1|3949152_3950319_+	NAD-dependent formate dehydrogenase	NA	NA	NA	NA	NA
WP_012455562.1|3950406_3950910_+	HPP family protein	NA	NA	NA	NA	NA
WP_081435406.1|3951350_3951704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081435407.1|3951756_3951936_-	DUF2478 domain-containing protein	NA	NA	NA	NA	NA
WP_017487495.1|3951966_3952269_-	DUF2478 domain-containing protein	NA	NA	NA	NA	NA
WP_012455563.1|3952673_3953663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455564.1|3953764_3955018_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_012455565.1|3955110_3955455_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012455566.1|3955550_3956801_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012455567.1|3958031_3958829_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012455568.1|3958825_3959518_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012455569.1|3959545_3960622_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	2.1e-17
WP_012455570.1|3960781_3960991_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_158022296.1|3961304_3961667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596089.1|3961980_3963189_+|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_012455572.1|3963176_3964166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455573.1|3964162_3965113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455574.1|3965621_3966929_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012455575.1|3966918_3967263_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017487491.1|3970168_3970420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455579.1|3970930_3971266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455580.1|3971282_3971690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041372075.1|3971803_3972328_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012455541.1|3972418_3972901_-	Hsp20 family protein	NA	E3SM62	Prochlorococcus_phage	37.2	1.9e-18
WP_026105999.1|3973360_3973774_-	thioredoxin TrxC	NA	V9SJ74	Achromobacter_phage	43.6	1.0e-12
WP_012455582.1|3974006_3975227_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012455583.1|3975395_3978020_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	36.2	5.6e-125
WP_158022297.1|3978358_3978640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455584.1|3980197_3980434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455585.1|3983590_3984019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455586.1|3984679_3985171_+	raiA ribosome-associated inhibitor A	NA	NA	NA	NA	NA
WP_012452059.1|3985566_3986910_+|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
WP_085985407.1|3987078_3987833_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	34.7	1.2e-11
WP_012455588.1|3989134_3989881_-	glutaredoxin	NA	A0A248SKD6	Salicola_phage	42.4	4.8e-05
WP_012455589.1|3990004_3990172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455591.1|3991046_3991469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455592.1|3991588_3992086_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_012455593.1|3992272_3992488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455594.1|3992571_3992964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455595.1|3992947_3995014_+	histidine kinase	NA	NA	NA	NA	NA
WP_012455596.1|3995032_3995698_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012455597.1|3995782_3997081_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_012455599.1|3997609_3998728_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_012455600.1|3999244_3999430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455601.1|3999498_4001910_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	38.9	3.0e-149
WP_012455602.1|4001923_4002331_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_012452059.1|4002481_4003825_+|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
WP_012455603.1|4004055_4004337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455604.1|4004333_4005245_-	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	27.0	1.7e-12
WP_012452059.1|4005477_4006821_-|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
WP_012455605.1|4007009_4007576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455606.1|4007860_4008112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455607.1|4008095_4008488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455609.1|4008741_4009149_-	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	44.5	4.1e-19
WP_012455610.1|4009329_4009515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153876384.1|4009842_4010049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455611.1|4011218_4011452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012455612.1|4011804_4012767_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012455613.1|4013069_4014263_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012455614.1|4014389_4015265_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012455615.1|4015261_4017043_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A285PWH2	Cedratvirus	29.4	2.6e-09
WP_012455616.1|4017042_4017780_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.4e-12
WP_012455617.1|4017861_4018563_+	cyclase family protein	NA	NA	NA	NA	NA
WP_012455618.1|4018615_4020025_+	amidase	NA	NA	NA	NA	NA
WP_012455620.1|4021068_4022433_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012455621.1|4022442_4022772_+	nitrile hydratase subunit beta	NA	NA	NA	NA	NA
WP_081435408.1|4022768_4023398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455623.1|4023331_4024342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003596089.1|4024528_4025737_+|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_157228163.1|4025814_4026603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455624.1|4026745_4027279_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_085985411.1|4027770_4028527_+|transposase	IS5-like element ISMpo7 family transposase	transposase	NA	NA	NA	NA
WP_081435409.1|4028555_4029143_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012455626.1|4029139_4029937_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.3e-29
WP_012455627.1|4029948_4030260_+	nitrile hydratase subunit beta	NA	NA	NA	NA	NA
WP_012455628.1|4030259_4030547_+	nitrile hydratase subunit beta	NA	NA	NA	NA	NA
WP_012455629.1|4030539_4031196_+	nitrile hydratase subunit alpha	NA	NA	NA	NA	NA
WP_012455630.1|4031617_4032448_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012455631.1|4032707_4033376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157228162.1|4036673_4037431_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_026105551.1|4037699_4039877_+	response regulator	NA	NA	NA	NA	NA
WP_012455636.1|4040089_4042513_+	response regulator	NA	NA	NA	NA	NA
WP_012455637.1|4042539_4042860_-	DUF3140 domain-containing protein	NA	NA	NA	NA	NA
WP_012455638.1|4042950_4043463_-	DUF892 family protein	NA	NA	NA	NA	NA
WP_017484712.1|4043812_4043971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157228161.1|4044176_4044410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157228160.1|4045623_4047912_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012455641.1|4049563_4050094_-	AAA family ATPase	NA	A0A1J0GSM4	Shigella_phage	34.5	2.2e-12
WP_012455642.1|4050105_4051071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012455643.1|4051048_4051864_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	2.0e-09
WP_012455644.1|4051860_4052907_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012455645.1|4052903_4053749_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017484710.1|4053756_4055691_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012455647.1|4056563_4058789_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012455648.1|4058815_4060381_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012455649.1|4060377_4061316_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157228159.1|4061324_4062149_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012455651.1|4062145_4063534_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	32.8	2.0e-12
WP_012455652.1|4064565_4065162_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012455653.1|4065279_4065657_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085985395.1|4065874_4067057_+|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
WP_012455654.1|4067380_4068019_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012455655.1|4068230_4068863_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012455656.1|4068859_4069822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455657.1|4069890_4070502_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012455658.1|4070516_4070723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455659.1|4070829_4071597_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012455660.1|4071816_4073253_+|transposase	IS1182-like element ISMpo6 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_010725	Methylorubrum populi BJ001, complete sequence	5800441	4231703	4244029	5800441	transposase	Corynebacterium_phage(100.0%)	8	NA	NA
WP_003596089.1|4231703_4232912_-|transposase	IS256-like element ISMex14 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	48.5	4.9e-92
WP_052300063.1|4233488_4233998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085985412.1|4234931_4235688_+|transposase	IS5-like element ISMpo8 family transposase	transposase	NA	NA	NA	NA
WP_041371609.1|4236138_4237464_+|transposase	IS701-like element ISMpo9 family transposase	transposase	NA	NA	NA	NA
WP_131801334.1|4237849_4238299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012455798.1|4238503_4239307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012452059.1|4240535_4241879_-|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
WP_012452059.1|4242685_4244029_-|transposase	IS1380-like element ISMpo3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_010727	Methylorubrum populi BJ001 plasmid pMPOP01, complete sequence	25164	11364	19640	25164	transposase	Aurantimonas_phage(28.57%)	11	NA	NA
WP_012457141.1|11364_12129_+	metallophosphoesterase	NA	K4K650	Caulobacter_phage	31.0	2.7e-19
WP_012457142.1|12216_12960_-	GntR family transcriptional regulator	NA	A0A0A8IK91	Aurantimonas_phage	33.0	1.4e-12
WP_012457143.1|13501_13792_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012457144.1|13784_14054_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_012457145.1|14312_14999_+	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	45.8	6.5e-41
WP_158022323.1|14995_15364_+	stability/partitioning determinant	NA	NA	NA	NA	NA
WP_158022324.1|15472_15637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012457147.1|15792_16230_-	hypothetical protein	NA	A0A097EYP5	Mycobacterium_phage	37.3	1.1e-12
WP_012457148.1|16234_16816_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	50.8	1.3e-42
WP_012457137.1|17646_18399_-|transposase	IS6-like element ISMpo1 family transposase	transposase	A0A0N9SKD3	Staphylococcus_phage	36.8	1.1e-30
WP_012457149.1|18395_19640_-	ergothioneine biosynthesis protein EgtB	NA	A0A075BUR2	Microcystis_phage	36.4	6.1e-05
