The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010501	Pseudomonas putida W619, complete sequence	5774330	1437047	1479223	5774330	protease,head,tail,capsid,integrase,terminase,portal	Pseudomonas_phage(61.54%)	55	1437007:1437029	1485000:1485022
1437007:1437029	attL	GGCCCTATCGCCGGCAAGCCGGC	NA	NA	NA	NA
WP_012313213.1|1437047_1438793_-	N-acetylglutaminylglutamine synthetase	NA	A0A0B5IYG7	Pandoravirus	31.2	6.5e-05
WP_012313214.1|1438796_1440584_-	N-acetylglutaminylglutamine amidotransferase	NA	R4TIC1	Phaeocystis_globosa_virus	28.2	9.9e-33
WP_012313215.1|1440620_1441811_-|integrase	site-specific integrase	integrase	A0A1B0Z061	Pseudomonas_phage	54.8	3.2e-112
WP_012313216.1|1442022_1442775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313217.1|1442771_1443461_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	35.7	1.3e-28
WP_012313218.1|1443451_1443601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313220.1|1444255_1444630_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	51.0	2.3e-08
WP_012313221.1|1444720_1445116_-	LuxR family transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	68.3	9.8e-34
WP_012313222.1|1445250_1445940_-	LexA family transcriptional regulator	NA	A0A2H4J868	uncultured_Caudovirales_phage	66.7	4.3e-53
WP_042111230.1|1446026_1446326_+	helix-turn-helix domain-containing protein	NA	A0A1B0VMF5	Pseudomonas_phage	54.7	1.5e-10
WP_012313224.1|1446488_1446974_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	43.2	5.2e-29
WP_012313225.1|1447151_1447430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313226.1|1447426_1447732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313227.1|1447728_1447965_+	hypothetical protein	NA	A0A1B0VMK4	Pseudomonas_phage	42.5	3.6e-07
WP_012313228.1|1447961_1448252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313229.1|1448248_1449019_+	antirepressor	NA	A0A1W6JTB0	Pseudomonas_phage	38.2	7.3e-17
WP_012313230.1|1449015_1449390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313231.1|1449386_1449614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313232.1|1449625_1450393_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	52.3	3.3e-25
WP_012313233.1|1450389_1451163_+	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	50.8	2.0e-67
WP_012313234.1|1451159_1452572_+	replicative DNA helicase	NA	A0A1W6JTB3	Pseudomonas_phage	50.4	4.5e-121
WP_012313235.1|1452558_1453065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313236.1|1453061_1453349_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	42.5	4.5e-12
WP_012313237.1|1453345_1453735_+	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	57.8	5.5e-37
WP_012313238.1|1453960_1454470_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	94.7	2.2e-86
WP_012313239.1|1454789_1454978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313241.1|1455393_1455627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009685286.1|1455748_1456120_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	71.3	1.5e-39
WP_012313242.1|1456119_1456437_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	56.2	2.1e-15
WP_042111232.1|1456502_1456733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190273331.1|1457301_1457481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313246.1|1457471_1457840_+	HNH endonuclease	NA	D4FUN2	Pseudomonas_phage	60.9	1.7e-19
WP_010952646.1|1457967_1458351_+|terminase	phage terminase small subunit	terminase	Q9XJT7	Pseudomonas_phage	44.2	3.9e-19
WP_012313247.1|1458350_1460060_+|terminase	terminase large subunit	terminase	A0A0R6PIM0	Moraxella_phage	68.2	1.5e-232
WP_012313248.1|1460071_1460236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313249.1|1460228_1461563_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	55.7	2.6e-131
WP_012313250.1|1461559_1462306_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.7	7.4e-75
WP_012313251.1|1462315_1463572_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	48.4	1.2e-90
WP_012313252.1|1463613_1463838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313253.1|1463841_1464318_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	39.0	7.0e-18
WP_012313254.1|1464317_1464659_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	48.3	5.5e-17
WP_012313255.1|1464651_1465137_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	74.7	2.8e-59
WP_012313256.1|1465133_1465502_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	63.1	1.2e-38
WP_012313257.1|1465564_1466062_+	hypothetical protein	NA	Q9MCA5	Pseudomonas_phage	61.4	1.0e-51
WP_012313258.1|1466058_1466397_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_012313260.1|1466758_1467097_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	55.1	7.1e-09
WP_012313261.1|1467150_1469712_+|tail	phage tail tape measure protein	tail	A0A2H4PI09	Pseudomonas_phage	57.8	2.6e-220
WP_012313262.1|1469721_1470306_+	hypothetical protein	NA	A0A2H4IYI9	uncultured_Caudovirales_phage	49.0	2.2e-53
WP_012313263.1|1470305_1470902_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	69.2	1.7e-77
WP_012313264.1|1470907_1471306_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	62.1	1.7e-46
WP_080516509.1|1472205_1476798_+	DUF1983 domain-containing protein	NA	A0A059VFW9	Pseudomonas_phage	57.8	3.3e-16
WP_042111235.1|1477120_1477972_+	hypothetical protein	NA	A0A1S5R1H4	Pseudomonas_phage	40.4	8.3e-46
WP_042111237.1|1477995_1478220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313268.1|1478282_1478720_+	hypothetical protein	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	54.4	1.0e-36
WP_012313269.1|1478716_1479223_+	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	75.5	6.9e-40
1485000:1485022	attR	GCCGGCTTGCCGGCGATAGGGCC	NA	NA	NA	NA
>prophage 2
NC_010501	Pseudomonas putida W619, complete sequence	5774330	1523503	1530331	5774330		Escherichia_phage(33.33%)	7	NA	NA
WP_012313303.1|1523503_1524448_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	34.0	2.0e-40
WP_012313304.1|1524500_1525610_-	acyltransferase	NA	NA	NA	NA	NA
WP_012313305.1|1525864_1526797_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	1.1e-35
WP_012313306.1|1526917_1527466_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	4.1e-54
WP_012313307.1|1527465_1528356_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.6	2.0e-98
WP_012313308.1|1528352_1529258_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	32.6	2.3e-25
WP_012313309.1|1529254_1530331_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.0	3.9e-101
>prophage 3
NC_010501	Pseudomonas putida W619, complete sequence	5774330	1939797	2002679	5774330	protease,coat	Bacillus_virus(10.0%)	58	NA	NA
WP_012313645.1|1939797_1941081_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	1.4e-137
WP_012313646.1|1941237_1943634_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	6.0e-219
WP_012313647.1|1943786_1944059_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	61.8	3.8e-21
WP_012313648.1|1944242_1946114_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012313649.1|1946194_1947235_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_012313650.1|1947388_1947667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313651.1|1947681_1948461_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_012313652.1|1948537_1949335_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_012313653.1|1949338_1949707_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_012313654.1|1949782_1951261_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012313655.1|1951376_1952174_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012313656.1|1952332_1953739_+	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	29.3	9.0e-05
WP_012313657.1|1953853_1954288_+	DoxX family protein	NA	NA	NA	NA	NA
WP_012313658.1|1954502_1954811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313659.1|1954822_1955296_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_012313660.1|1955353_1957861_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012313661.1|1957860_1958544_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	4.8e-36
WP_012313662.1|1958554_1959160_+	arylesterase	NA	NA	NA	NA	NA
WP_012313663.1|1959218_1959500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313664.1|1959631_1960609_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003250288.1|1960749_1961001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313665.1|1961517_1961799_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012313666.1|1961862_1962939_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.5	2.8e-83
WP_012313667.1|1963172_1964120_+	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_012313668.1|1964224_1964722_+	universal stress protein	NA	NA	NA	NA	NA
WP_012313669.1|1964851_1965826_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_012313670.1|1965927_1966662_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_012313671.1|1966781_1968125_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	33.5	4.8e-48
WP_012313672.1|1968296_1969280_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_012313673.1|1969279_1970815_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_012313674.1|1970820_1971357_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012313675.1|1971651_1972356_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012313676.1|1972364_1973255_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_012313677.1|1973409_1974537_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_012313678.1|1974691_1977280_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012313679.1|1977419_1978610_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_012313680.1|1978748_1980233_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_039602878.1|1980298_1982908_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_012313682.1|1983313_1983781_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_012313683.1|1983848_1984610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012313684.1|1984636_1984993_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_012313685.1|1985044_1986124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313686.1|1986277_1986586_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012313687.1|1986585_1986900_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012313688.1|1986900_1987569_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012313689.1|1987565_1988885_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012313690.1|1989095_1990253_+	HPP family protein	NA	NA	NA	NA	NA
WP_012313691.1|1990226_1991093_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012313692.1|1991273_1993163_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	29.5	5.3e-53
WP_012313693.1|1993198_1994284_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012313694.1|1994389_1994632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012313695.1|1995104_1997492_-	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.4	4.6e-09
WP_012313696.1|1997506_1997968_-	response regulator	NA	NA	NA	NA	NA
WP_012313697.1|1997983_2000254_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	22.4	7.6e-30
WP_012313698.1|2000519_2001047_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012313699.1|2001076_2001613_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012313700.1|2001632_2002166_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_012313701.1|2002175_2002679_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NC_010501	Pseudomonas putida W619, complete sequence	5774330	3738861	3747359	5774330	tRNA	uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_012315235.1|3738861_3739533_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	1.1e-104
WP_012315236.1|3739755_3741135_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	3.3e-28
WP_012315237.1|3741220_3741613_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.9	2.0e-55
WP_012315238.1|3741614_3741974_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.0	1.6e-35
WP_012315239.1|3741973_3742270_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	7.3e-26
WP_012315240.1|3742266_3742602_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	1.3e-42
WP_012315241.1|3742598_3743603_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	78.6	1.0e-151
WP_012315242.1|3743695_3744652_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012315243.1|3744683_3746078_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012315244.1|3746078_3747359_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.0	7.2e-94
>prophage 5
NC_010501	Pseudomonas putida W619, complete sequence	5774330	4363148	4394891	5774330	protease,head,holin,tail,capsid,integrase,terminase,portal	Pseudomonas_phage(53.12%)	48	4352625:4352684	4393997:4394061
4352625:4352684	attL	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAA	NA	NA	NA	NA
WP_012315750.1|4363148_4363778_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	65.2	9.1e-66
WP_012315751.1|4363820_4364171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315752.1|4364203_4364959_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	77.3	2.6e-123
WP_012315753.1|4364961_4365711_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	78.7	1.4e-121
WP_012315754.1|4365707_4366046_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	52.7	2.2e-26
WP_012315755.1|4366045_4369360_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	40.2	2.9e-102
WP_012315756.1|4369404_4369638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315757.1|4369634_4369979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315758.1|4370019_4370520_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	72.7	1.0e-64
WP_012315759.1|4370575_4370962_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	83.6	4.4e-55
WP_012315760.1|4370954_4371455_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	71.0	1.7e-62
WP_012315761.1|4371458_4371638_-	hypothetical protein	NA	A0A2D1GNQ5	Pseudomonas_phage	46.4	1.1e-05
WP_012315762.1|4371646_4371973_-|head	phage head closure protein	head	A0A2D1GNG1	Pseudomonas_phage	63.6	2.3e-28
WP_012315763.1|4371972_4372272_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	74.7	4.6e-36
WP_012315764.1|4372272_4372644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315765.1|4372699_4373902_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	61.9	1.6e-135
WP_012315766.1|4373898_4374540_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	78.4	7.5e-92
WP_012315767.1|4374526_4375741_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	71.8	7.1e-168
WP_190273344.1|4375743_4377429_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	82.9	8.2e-255
WP_012315769.1|4377428_4377962_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	47.6	1.4e-22
WP_012315770.1|4378120_4378459_-	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	46.8	1.3e-21
WP_012315771.1|4378458_4378653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315772.1|4378702_4379035_-|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	89.1	8.7e-52
WP_012315773.1|4379919_4380279_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	64.7	3.9e-37
WP_012315774.1|4380429_4380819_-	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	58.6	5.5e-37
WP_012315775.1|4380815_4381103_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	44.8	6.9e-13
WP_012315776.1|4381099_4381630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315777.1|4381616_4382999_-	AAA family ATPase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	57.1	6.7e-138
WP_012315778.1|4382995_4383778_-	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	62.2	5.9e-91
WP_012315779.1|4383774_4384569_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	51.1	1.2e-27
WP_012315780.1|4384565_4384796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315781.1|4384792_4385434_-	hypothetical protein	NA	A0A1B0VMK2	Pseudomonas_phage	42.9	7.1e-34
WP_012315783.1|4386191_4386485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315784.1|4386481_4386772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315785.1|4386768_4387098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080516490.1|4387543_4387849_-	helix-turn-helix domain-containing protein	NA	H2BD64	Pseudomonas_phage	61.4	3.8e-09
WP_012315786.1|4387935_4388715_+	helix-turn-helix transcriptional regulator	NA	A0A1B0VRI7	Pseudomonas_phage	51.8	2.0e-62
WP_012315787.1|4388871_4389261_+	response regulator transcription factor	NA	A0A1W6JTA9	Pseudomonas_phage	40.6	1.9e-13
WP_012315788.1|4389351_4389765_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_190273314.1|4389761_4389905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042111669.1|4389901_4390264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012315789.1|4390256_4390814_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012315790.1|4390803_4391046_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	49.1	2.0e-05
WP_012315791.1|4391100_4391349_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	59.2	5.8e-16
WP_042111672.1|4391364_4392312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042111673.1|4392435_4392855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042111674.1|4392911_4393889_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	69.2	2.7e-125
WP_012315794.1|4394180_4394891_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	38.0	8.7e-41
4393997:4394061	attR	TATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT	NA	NA	NA	NA
>prophage 6
NC_010501	Pseudomonas putida W619, complete sequence	5774330	4425188	4478031	5774330	tail,lysis,tRNA,plate	uncultured_Caudovirales_phage(29.63%)	57	NA	NA
WP_012315822.1|4425188_4426964_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	26.3	5.6e-12
WP_012315823.1|4427059_4427281_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012315824.1|4427374_4427704_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012315825.1|4427893_4428367_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	36.4	3.1e-18
WP_012315826.1|4428648_4429242_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	48.3	1.8e-10
WP_012315827.1|4429281_4429488_-	protein SlyX	NA	NA	NA	NA	NA
WP_042111678.1|4429489_4429909_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_012315829.1|4430667_4431936_+	OprD family porin	NA	NA	NA	NA	NA
WP_012315830.1|4432096_4433812_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012315831.1|4433832_4434786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273345.1|4434816_4435875_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_012315833.1|4436843_4439486_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_012315834.1|4439485_4440778_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_012315835.1|4440815_4442714_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.5	9.1e-77
WP_012315836.1|4442950_4444282_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012315837.1|4444367_4444823_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042111682.1|4444944_4445655_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012315839.1|4445702_4446164_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	49.7	1.0e-37
WP_012315840.1|4446170_4446866_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_012315841.1|4447113_4447893_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012315842.1|4448010_4448937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012315843.1|4448933_4449296_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_012315844.1|4449369_4450020_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012315845.1|4450198_4450909_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_190273315.1|4450990_4451134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315846.1|4451132_4451552_+	quorum-sensing-regulated virulence factor family protein	NA	NA	NA	NA	NA
WP_012315847.1|4451552_4451756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315848.1|4452058_4453177_+	LOG family protein	NA	NA	NA	NA	NA
WP_012315849.1|4453202_4453673_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_012315850.1|4453690_4454758_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	6.4e-112
WP_012315851.1|4454861_4455344_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	76.1	1.6e-57
WP_150105133.1|4455427_4455907_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	55.8	1.1e-31
WP_012315853.1|4455900_4456449_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	68.0	1.3e-68
WP_012315854.1|4456476_4457511_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	65.5	4.6e-123
WP_012315855.1|4457515_4457722_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	65.7	4.6e-19
WP_012315856.1|4457696_4458542_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	52.5	9.6e-79
WP_150105134.1|4458551_4459868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150105135.1|4460099_4460393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012315858.1|4460529_4460832_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012315859.1|4460842_4461352_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	69.1	3.4e-63
WP_012315860.1|4461365_4462532_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	6.0e-180
WP_012315861.1|4462601_4463051_-	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	42.5	8.8e-23
WP_012315862.1|4463054_4465199_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	53.3	8.7e-84
WP_012315863.1|4465191_4465800_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	62.9	9.0e-71
WP_012315864.1|4465801_4466683_-|plate	baseplate J/gp47 family protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	67.2	8.1e-105
WP_012315865.1|4466679_4467006_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	67.3	1.6e-34
WP_012315866.1|4467093_4467654_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	57.4	4.6e-53
WP_012315867.1|4467650_4468148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012315868.1|4468161_4468497_-	pyocin	NA	B5TK61	Pseudomonas_phage	72.7	1.0e-39
WP_012315869.1|4468971_4469718_-	helix-turn-helix domain-containing protein	NA	B5TK58	Pseudomonas_phage	82.7	1.5e-115
WP_012315870.1|4469857_4472431_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.9	3.4e-26
WP_012315871.1|4472571_4472895_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_012315872.1|4473398_4474406_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
WP_012315873.1|4474514_4475372_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
WP_161872020.1|4475558_4476197_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	3.9e-40
WP_012315875.1|4476235_4476985_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.0	1.4e-65
WP_012315876.1|4476972_4478031_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 7
NC_010501	Pseudomonas putida W619, complete sequence	5774330	4694802	4702580	5774330		Planktothrix_phage(16.67%)	10	NA	NA
WP_012316069.1|4694802_4695612_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-24
WP_012316070.1|4695859_4696834_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	5.2e-36
WP_042111715.1|4696849_4697374_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	46.6	1.0e-25
WP_012316072.1|4697381_4697954_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_012316073.1|4697940_4698465_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_012316074.1|4698465_4699191_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.1e-22
WP_012316075.1|4699365_4700859_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_012316076.1|4700938_4701247_+	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QCF2	Escherichia_phage	36.4	6.7e-06
WP_012316077.1|4701258_4701723_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_012316078.1|4701725_4702580_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.9	5.3e-08
>prophage 8
NC_010501	Pseudomonas putida W619, complete sequence	5774330	5417066	5451822	5774330	holin,integrase	Bacillus_virus(66.67%)	33	5422759:5422791	5457407:5457439
WP_012316661.1|5417066_5418011_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012316662.1|5418177_5419062_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_012316663.1|5419078_5420044_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_012316664.1|5420054_5420525_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_012316665.1|5420530_5422138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012316666.1|5422483_5422741_+	hypothetical protein	NA	NA	NA	NA	NA
5422759:5422791	attL	GGCCTCATCGCCGGCAAGCCGGCTCCCACAGGT	NA	NA	NA	NA
WP_012316667.1|5422871_5423978_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012316668.1|5424368_5425745_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_012316669.1|5426186_5427134_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_190273347.1|5427215_5428064_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_012316671.1|5428060_5429239_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.2	7.7e-26
WP_012316672.1|5429353_5430124_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_012316673.1|5430134_5430872_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_012316674.1|5430984_5431245_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_012316675.1|5431245_5431884_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_012316676.1|5431884_5432478_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_012316677.1|5432710_5434369_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_012316678.1|5434739_5436983_+	AsmA family protein	NA	NA	NA	NA	NA
WP_012316679.1|5436979_5438047_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_012316680.1|5438043_5438316_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_012316681.1|5438673_5439669_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_012316682.1|5439781_5440225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012316683.1|5440333_5441719_-	GABA permease	NA	NA	NA	NA	NA
WP_012316684.1|5442359_5443133_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	1.4e-20
WP_012316685.1|5443144_5443897_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012316686.1|5443952_5444648_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012316687.1|5444644_5445334_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012316688.1|5445419_5446625_+	methyltransferase	NA	NA	NA	NA	NA
WP_012316689.1|5446909_5447182_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_012316690.1|5447171_5447453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039604502.1|5448000_5448255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012316692.1|5448591_5449911_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	1.2e-67
WP_012316693.1|5450841_5451822_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
5457407:5457439	attR	GGCCTCATCGCCGGCAAGCCGGCTCCCACAGGT	NA	NA	NA	NA
