The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	221740	271870	4686137	integrase,transposase	Streptococcus_phage(20.0%)	46	236226:236285	271980:272039
WP_000006255.1|221740_222238_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|222461_224201_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|224145_224931_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|225001_226057_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|226108_226402_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|226404_226803_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|226812_227265_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|228362_229820_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|230080_230539_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|230630_231875_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|231932_232334_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|232372_233428_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|233715_234819_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|234830_236084_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
236226:236285	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|236655_236997_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|237017_237335_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|237353_237575_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|237583_238060_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|238075_238534_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|238631_238871_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|238947_239415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|239437_239881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548158.1|239880_240108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|240511_241333_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|241424_242288_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|242616_243510_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|243930_245082_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|247428_248445_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|248652_250056_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|250042_250975_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|251083_252130_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001030800.1|253712_254063_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|254156_255311_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|255605_256514_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|256528_258496_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|258722_260105_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|260116_261727_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_085947770.1|262072_263441_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001281825.1|264074_265079_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|266273_267005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|267095_267722_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|267993_268692_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|268718_269573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|269691_269916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|269912_270353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|270469_271870_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
271980:272039	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	493165	524188	4686137	lysis,tRNA,transposase,protease,integrase	Enterobacteria_phage(56.52%)	39	503310:503356	524612:524658
WP_000912385.1|493165_494551_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|494586_495108_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|495215_495428_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|495429_496296_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|496766_497309_+	type 1 fimbrial major subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|497528_498221_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|498251_500855_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|500833_501874_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|501884_502400_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|502402_503035_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
503310:503356	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|503369_504533_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|504652_504916_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|505238_505334_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|505396_506558_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|506869_507202_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|507249_507399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|507456_508983_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|509447_509999_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|510008_510806_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|510922_511024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|511020_511476_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|511475_511646_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|511638_511929_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|511925_512288_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|512284_512425_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|512510_512894_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|513291_514308_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|514312_515380_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|515952_516168_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|516167_516665_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|516881_517064_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|517154_517448_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|517738_518149_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|518434_518641_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|518805_519000_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|519388_519934_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_026089880.1|520706_521333_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|522235_522985_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|523234_524188_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
524612:524658	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	623084	633194	4686137	lysis,transposase	Enterobacteria_phage(63.64%)	14	NA	NA
WP_000631384.1|623084_623810_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_000272824.1|623809_624484_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_000020941.1|624483_625224_-	glutamate/aspartate ABC transporter permease GltJ	NA	NA	NA	NA	NA
WP_001177086.1|625393_626302_-	glutamate/aspartate ABC transporter substrate-binding protein GltI	NA	NA	NA	NA	NA
WP_010723085.1|626551_627568_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|627572_628640_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|629212_629428_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|629427_629925_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|630141_630324_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|630414_630708_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|630998_631409_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|631694_631901_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|632065_632260_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|632648_633194_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
>prophage 4
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	1349815	1378719	4686137	head,lysis,terminase,holin,portal,integrase	Enterobacteria_phage(97.3%)	40	1345560:1345575	1387864:1387879
1345560:1345575	attL	TCTACCACAATCCACT	NA	NA	NA	NA
WP_000627155.1|1349815_1351009_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
WP_024168593.1|1351244_1351484_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	100.0	1.1e-37
WP_000148438.1|1352368_1352521_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_000831730.1|1352517_1352946_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	100.0	9.5e-75
WP_000187057.1|1352942_1353623_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	100.0	1.3e-131
WP_000059964.1|1353619_1354537_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	100.0	1.1e-171
WP_000995354.1|1354546_1354828_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	100.0	1.3e-48
WP_000005775.1|1354835_1355804_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	100.0	1.8e-97
WP_000448252.1|1355908_1356745_-	zf-TFIIB domain-containing protein	NA	M9NYX5	Enterobacteria_phage	100.0	6.2e-155
WP_000607102.1|1356755_1356965_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	100.0	4.7e-35
WP_000218995.1|1356961_1357120_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	100.0	6.9e-23
WP_001281305.1|1357121_1357331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564503.1|1357486_1357783_-	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	100.0	3.1e-48
WP_000362427.1|1358340_1358550_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	7.0e-23
WP_000432054.1|1358580_1359447_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	100.0	3.5e-153
WP_000244936.1|1359583_1360348_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	100.0	1.9e-134
WP_000608751.1|1360411_1360633_+	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
WP_000555791.1|1360663_1361206_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	100.0	1.6e-95
WP_000072106.1|1361291_1362200_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000838083.1|1362196_1362886_+	hypothetical protein	NA	M9NYX7	Enterobacteria_phage	100.0	8.8e-131
WP_000586532.1|1363889_1364345_+	YbcN family protein	NA	K7P7B8	Enterobacteria_phage	100.0	5.7e-86
WP_000106777.1|1364344_1364515_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	100.0	1.1e-23
WP_000063208.1|1364511_1365180_+	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	100.0	2.3e-131
WP_001231139.1|1365172_1365814_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	100.0	2.4e-114
WP_048813386.1|1365810_1366017_+	Lar family restriction alleviation protein	NA	M9NZE6	Enterobacteria_phage	100.0	2.4e-36
WP_085903671.1|1366013_1366130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047620.1|1366129_1366939_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	100.0	2.3e-154
WP_000286101.1|1367417_1367642_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	100.0	1.9e-34
WP_001070143.1|1367619_1368114_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	100.0	1.3e-91
WP_012305470.1|1368110_1368569_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	100.0	2.2e-77
WP_001064347.1|1368767_1369286_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_001446081.1|1369357_1369954_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_000509882.1|1370344_1371073_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	100.0	8.7e-121
WP_000453624.1|1371320_1371866_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_001027236.1|1371840_1373763_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	100.0	0.0e+00
WP_000235412.1|1373762_1373969_+	gpW family protein	NA	E4WL20	Enterobacteria_phage	100.0	5.8e-30
WP_000701345.1|1373965_1375558_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	100.0	1.3e-310
WP_000929806.1|1375538_1376882_+	S49 family peptidase	NA	E4WL22	Enterobacteria_phage	100.0	1.3e-215
WP_001018610.1|1376891_1377224_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000118199.1|1377291_1378719_+	cyanase	NA	K7PGW9	Enterobacteria_phage	99.7	2.3e-181
1387864:1387879	attR	AGTGGATTGTGGTAGA	NA	NA	NA	NA
>prophage 5
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	1483495	1525512	4686137	tail,tRNA,lysis,transposase	Escherichia_phage(48.39%)	43	NA	NA
WP_010723085.1|1483495_1484512_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|1484784_1485042_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1485091_1486042_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1486193_1486946_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1487140_1487656_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1487666_1489193_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1489229_1490675_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1490674_1491985_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1492160_1493069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1493398_1493962_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1493982_1495215_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1495469_1496453_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1496930_1498304_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1498432_1499368_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1499419_1500655_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1500656_1500872_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1500950_1501160_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1501152_1501347_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1501403_1502213_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1502205_1504806_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1504907_1505183_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1505257_1505428_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1505427_1505649_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1506090_1506579_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1506575_1506731_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1507184_1507661_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1507784_1508081_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1508103_1508526_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1508538_1509396_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1509402_1510149_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1510171_1510732_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1510819_1511005_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1511201_1512659_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1512796_1513060_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1513040_1513400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019451.1|1515165_1516146_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_000279097.1|1516468_1519831_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1519830_1520406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1520503_1521094_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1521410_1521644_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_010723085.1|1521798_1522815_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001300461.1|1523803_1524238_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1524378_1525512_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	1717101	1761766	4686137	lysis,transposase,protease,tail	Enterobacteria_phage(30.0%)	59	NA	NA
WP_000527743.1|1717101_1718562_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1720538_1720652_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1720720_1720954_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1721270_1721861_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1721958_1722534_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1722533_1723496_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1723446_1724016_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1724404_1724638_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1724695_1725106_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1725257_1725431_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1725602_1725758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1725836_1725902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1725904_1726093_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1726103_1726316_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1726678_1727176_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1727172_1727706_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1727702_1728014_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1728018_1728234_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1728987_1729203_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1729503_1729716_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1729770_1729860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1730137_1730890_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1730903_1731953_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1731954_1732233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1732299_1732551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1732767_1732923_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1732994_1733282_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1733281_1733521_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1733545_1733851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1734053_1734386_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1734822_1734972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1735268_1735499_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1735582_1735990_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1736156_1736312_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1736471_1736690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1737257_1737446_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1737442_1737634_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_088895425.1|1739515_1740744_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001360138.1|1741712_1741823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1741880_1742900_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1742911_1744126_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1744331_1744658_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1744792_1745134_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1745168_1745729_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1745731_1746442_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1746549_1746855_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1747053_1749480_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1749540_1751964_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1751974_1752592_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1752593_1753448_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1753490_1754105_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1754263_1755556_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1755508_1756204_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1756328_1757549_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1757683_1758577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1758683_1759937_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1760333_1760669_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1760761_1760845_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1760944_1761766_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	2196257	2204928	4686137		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2196257_2197361_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2197368_2198616_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2198612_2199170_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2199169_2200051_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2200108_2201008_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2201007_2202093_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2202465_2203359_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2203533_2204928_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	2555087	2566297	4686137	integrase,tail	Enterobacteria_phage(53.33%)	16	2553062:2553078	2569972:2569988
2553062:2553078	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2555087_2556020_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2556331_2557489_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2557641_2558004_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2558000_2558921_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2558917_2560249_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2560283_2560565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2560863_2561304_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2561330_2561849_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2561898_2562174_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2562173_2562668_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2563390_2563753_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2563818_2564643_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2564770_2565307_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2565297_2565660_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2565659_2565965_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2566096_2566297_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2569972:2569988	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 9
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	2947656	2954795	4686137		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2947656_2950218_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2950323_2950980_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2951030_2951798_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2951993_2952902_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2952898_2954065_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|2954156_2954795_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 10
NC_010473	Escherichia coli str. K-12 substr. DH10B, complete sequence	4686137	3170650	3226961	4686137	tRNA,protease,transposase	Escherichia_phage(33.33%)	48	NA	NA
WP_010723085.1|3170650_3171667_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000428766.1|3171704_3171950_-	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	94.7	1.4e-14
WP_001239650.1|3171977_3172421_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000098614.1|3172734_3174726_-	transketolase	NA	NA	NA	NA	NA
WP_001326497.1|3175003_3175762_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3175967_3176888_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|3177025_3179002_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3179010_3179142_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3179277_3179493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3179796_3180951_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_012775975.1|3181374_3182769_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|3182845_3183343_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286501.1|3183437_3184145_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3184224_3184956_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3184968_3185919_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3186027_3186591_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3186590_3187007_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|3187190_3188171_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3188188_3188893_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3188910_3189477_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|3189473_3189764_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|3189771_3190365_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|3190357_3191494_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745210.1|3191648_3192656_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394140.1|3192772_3193819_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3193994_3194714_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3194897_3195224_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3195223_3195943_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3196103_3197156_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3197183_3197459_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3197523_3198603_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001339197.1|3199575_3200784_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001333829.1|3203944_3204754_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001324279.1|3204819_3205230_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000135077.1|3205247_3206243_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000942785.1|3207170_3207707_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000234514.1|3208036_3208744_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001326492.1|3209141_3211277_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001352368.1|3212035_3213244_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000259302.1|3215363_3217046_-	glycolate permease GlcA	NA	NA	NA	NA	NA
WP_000084131.1|3217400_3219572_-	malate synthase G	NA	NA	NA	NA	NA
WP_000853256.1|3219593_3219998_-	protein GlcG	NA	NA	NA	NA	NA
WP_001194661.1|3220002_3221226_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_000943100.1|3221236_3222289_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_000026117.1|3222288_3223788_-	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_001297764.1|3224038_3224803_+	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000626849.1|3224809_3225946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723085.1|3225944_3226961_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
