The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010513	Xylella fastidiosa M12, complete sequence	2475130	382267	507095	2475130	tRNA,tail,terminase,protease,plate,portal,integrase,holin,capsid	Escherichia_phage(20.93%)	109	427334:427354	517479:517499
WP_011097581.1|382267_382765_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.0	3.7e-06
WP_049756302.1|382772_383255_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_012337622.1|383454_384831_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004085229.1|385342_386107_-	arginyltransferase	NA	NA	NA	NA	NA
WP_004085228.1|386530_387022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756303.1|387025_387877_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_004085334.1|388791_389121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193329298.1|390246_393105_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_128283824.1|393193_393451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085225.1|394404_396387_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_004085224.1|397041_399633_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_004085223.1|401554_404581_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012337628.1|404686_406129_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.1	1.5e-47
WP_021358468.1|407278_408586_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_004085220.1|409456_410161_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	38.3	1.0e-25
WP_004085219.1|410217_411375_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011097591.1|411451_412243_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_004085217.1|412264_412747_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_004085216.1|412743_413760_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_012337629.1|413947_416302_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_004085214.1|416400_417735_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_031345876.1|417761_418952_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_004085212.1|418948_419803_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085211.1|419799_420567_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.8	1.6e-16
WP_004089320.1|420569_421127_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_004085207.1|423500_424181_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004085206.1|424292_424613_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_004085205.1|425823_426555_-	UMP kinase	NA	NA	NA	NA	NA
WP_004085344.1|426999_427248_+	hypothetical protein	NA	NA	NA	NA	NA
427334:427354	attL	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
WP_004085204.1|427947_428607_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_004085203.1|428703_430620_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_004085202.1|430718_431438_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_004085201.1|431434_432448_-	glucokinase	NA	NA	NA	NA	NA
WP_021358465.1|432444_433878_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.2	5.8e-68
WP_012337631.1|434206_435301_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.1e-25
WP_004085198.1|435445_436249_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_004085343.1|436561_436780_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_021358463.1|436837_437260_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004085197.1|437256_437640_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004085196.1|437647_439438_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004085195.1|439458_440244_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004085194.1|440364_440613_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_012337633.1|440635_441016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085192.1|441041_442283_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004085191.1|442275_442998_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.2	1.6e-34
WP_012337634.1|443345_445823_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.3	1.4e-05
WP_004085189.1|445807_446470_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004089267.1|446474_446912_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004085187.1|446929_448678_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.8	5.7e-49
WP_004085186.1|448674_449694_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_012337635.1|450068_451151_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_004085341.1|451141_451360_-|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_012337636.1|451356_451839_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	8.9e-29
WP_012337637.1|451835_454055_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	47.1	6.0e-104
WP_012337638.1|454181_454469_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_012337639.1|454471_454981_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.3	5.3e-48
WP_012337640.1|454980_456159_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.0	2.9e-134
WP_012337641.1|456222_457815_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	36.1	5.4e-83
WP_012337642.1|457822_458380_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.3	7.3e-51
WP_012337643.1|458372_459266_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	2.3e-70
WP_004088650.1|459265_459604_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004087027.1|459711_459993_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087025.1|460004_460304_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_004085174.1|460360_460642_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.2	1.6e-14
WP_012337645.1|460652_460928_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012337646.1|460932_461520_-|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	36.5	1.8e-23
WP_012337647.1|461516_462059_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.6	6.9e-38
WP_012337648.1|462034_462556_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	9.6e-13
WP_012337649.1|462552_462876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|462875_463136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337651.1|463153_465028_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.6	1.3e-163
WP_012337652.1|465024_466611_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.6	1.2e-130
WP_012337653.1|466607_467156_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	4.4e-40
WP_012337654.1|467159_469112_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.9	6.4e-251
WP_012337655.1|469104_469680_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.0	9.5e-46
WP_012337656.1|469810_470035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337657.1|470036_470498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337658.1|470487_470817_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012337659.1|470809_471310_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
WP_012337660.1|471409_472141_-	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	50.9	4.6e-61
WP_004085025.1|472330_472666_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_004089517.1|472662_472917_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012337661.1|472969_473692_-	hypothetical protein	NA	C8CLH7	Xylella_phage	82.1	3.0e-105
WP_162010044.1|473634_473982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337663.1|475434_475713_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	3.6e-43
WP_012337664.1|475714_476020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337665.1|476104_477523_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.6	1.7e-269
WP_012337666.1|477519_477765_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	80.5	1.2e-29
WP_012337667.1|477764_478784_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	89.7	2.2e-170
WP_004085684.1|479560_480202_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	40.7	3.4e-12
WP_004085683.1|480229_480706_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_004085682.1|480710_481283_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_038231298.1|481279_483238_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_071869548.1|484221_484614_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004085680.1|485900_486386_-	asparaginase	NA	NA	NA	NA	NA
WP_004085679.1|486628_487228_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004085726.1|487629_487773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004085678.1|487802_488987_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.3	1.4e-51
WP_004085677.1|489175_489751_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004089989.1|491104_491398_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_004085676.1|491482_494254_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.3	3.7e-63
WP_012337670.1|494910_495624_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_031345756.1|495821_496946_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	A0A0P0IKJ1	Acinetobacter_phage	25.1	1.8e-08
WP_004085673.1|497144_500387_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_027700071.1|500395_500860_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_004085671.1|500867_501788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337671.1|501790_503599_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_100206163.1|504266_505391_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	1.2e-07
WP_004085668.1|505574_507095_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.1	5.0e-86
517479:517499	attR	TGCGTCTACCAATTCCGCCAC	NA	NA	NA	NA
>prophage 2
NC_010513	Xylella fastidiosa M12, complete sequence	2475130	966066	990171	2475130	integrase,holin	Xylella_phage(70.0%)	23	956268:956281	971614:971627
956268:956281	attL	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_021358572.1|966066_967434_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.6	2.9e-109
WP_004083658.1|967965_969375_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004083657.1|969526_970546_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	90.0	1.5e-171
WP_049756312.1|970853_971294_+	SocA family protein	NA	K4NZT7	Burkholderia_phage	33.3	9.9e-11
WP_012337787.1|971390_971933_-	pilin	NA	NA	NA	NA	NA
971614:971627	attR	TTAGCGGGCAATAC	NA	NA	NA	NA
WP_004084093.1|972172_972526_-	hypothetical protein	NA	C8CLJ8	Xylella_phage	54.7	3.4e-22
WP_004083654.1|972522_973305_-	hypothetical protein	NA	C8CLJ7	Xylella_phage	66.0	4.5e-91
WP_041572637.1|973338_974223_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	58.9	1.0e-83
WP_080513455.1|974212_974602_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	61.2	1.2e-28
WP_004083651.1|975042_976254_-	hypothetical protein	NA	C8CLJ2	Xylella_phage	61.7	1.6e-119
WP_012337788.1|976257_977013_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	72.5	2.7e-56
WP_004084211.1|977062_977308_-	hypothetical protein	NA	C8CLJ0	Xylella_phage	80.6	1.0e-28
WP_004083648.1|978942_979350_-	hypothetical protein	NA	C8CLI8	Xylella_phage	60.3	2.5e-32
WP_004083647.1|979353_980583_-	hypothetical protein	NA	C8CLI7	Xylella_phage	71.8	3.0e-166
WP_004083646.1|980620_981478_-	hypothetical protein	NA	C8CLI6	Xylella_phage	49.3	1.7e-46
WP_004083645.1|981497_983519_-	hypothetical protein	NA	C8CLI5	Xylella_phage	77.7	3.2e-298
WP_004083644.1|983521_984940_-	DNA packaging protein	NA	C8CLI4	Xylella_phage	80.6	3.0e-234
WP_021358615.1|984845_985172_-	hypothetical protein	NA	C8CLI3	Xylella_phage	63.9	3.1e-33
WP_004083643.1|985922_986276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004083642.1|986277_986592_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	32.3	6.2e-07
WP_012337789.1|986584_987079_-	lysozyme	NA	A0A2I7RLY1	Vibrio_phage	53.8	2.6e-28
WP_004083639.1|987178_987700_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	53.2	8.6e-38
WP_038260243.1|987684_990171_+	VWA domain-containing protein	NA	A0A2D2W222	Stenotrophomonas_phage	31.1	3.8e-59
>prophage 3
NC_010513	Xylella fastidiosa M12, complete sequence	2475130	1174994	1250967	2475130	tRNA,tail,terminase,protease,plate,portal,integrase,holin,capsid	Xylella_phage(32.61%)	82	1167027:1167043	1260064:1260080
1167027:1167043	attL	ACAGTCATCATGCCTAA	NA	NA	NA	NA
WP_012337837.1|1174994_1175825_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	46.0	1.4e-61
WP_012337838.1|1176367_1176718_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	53.1	2.4e-07
WP_021358687.1|1176777_1177089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337836.1|1177837_1179166_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	50.5	1.7e-114
WP_021358671.1|1179165_1179495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337835.1|1179507_1180803_-	hypothetical protein	NA	Q94MX3	Xanthomonas_phage	47.7	7.7e-19
WP_004084291.1|1180930_1181059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337834.1|1181078_1181330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337833.1|1181454_1181766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337841.1|1181806_1182982_-	replication initiation factor domain-containing protein	NA	S0F3F7	Stenotrophomonas_phage	45.8	8.7e-78
WP_012337830.1|1183629_1183812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085576.1|1184980_1185673_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2I2L6M4	Escherichia_phage	38.5	6.5e-25
WP_012337842.1|1186192_1187962_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_031345926.1|1188156_1189674_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012337844.1|1189915_1191523_-|protease	carboxyl-terminal processing protease	protease	NA	NA	NA	NA
WP_012337845.1|1191615_1193217_-|protease	carboxyl-terminal processing protease	protease	A0A0R6PIZ1	Moraxella_phage	27.8	3.5e-05
WP_012337846.1|1193374_1193698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337847.1|1194458_1197356_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_012337848.1|1197940_1198183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085584.1|1198160_1198742_-	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_004084849.1|1198786_1199836_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_004084850.1|1199828_1201256_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004084854.1|1203244_1204696_-	ammonium transporter	NA	NA	NA	NA	NA
WP_004084855.1|1204685_1205024_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004084856.1|1205278_1206688_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_010894307.1|1206911_1207697_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004084858.1|1207864_1208578_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_004084859.1|1209036_1209996_+	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_012337635.1|1210794_1211877_-	phage late control D family protein	NA	A0A088FRU7	Escherichia_phage	45.6	5.7e-92
WP_004085341.1|1211867_1212086_-|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	50.0	3.1e-13
WP_012337636.1|1212082_1212565_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	8.9e-29
WP_012337637.1|1212561_1214781_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	47.1	6.0e-104
WP_012337638.1|1214907_1215195_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	44.6	1.4e-13
WP_012337639.1|1215197_1215707_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.3	5.3e-48
WP_012337640.1|1215706_1216885_-|tail	phage tail sheath family protein	tail	A0A088FVH5	Escherichia_phage	55.0	2.9e-134
WP_012337641.1|1216948_1218541_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	36.1	5.4e-83
WP_012337642.1|1218548_1219106_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.3	7.3e-51
WP_012337643.1|1219098_1219992_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	46.4	2.3e-70
WP_004088650.1|1219991_1220330_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	61.3	2.4e-33
WP_004087027.1|1220437_1220719_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_004087025.1|1220730_1221030_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.2e-15
WP_004085174.1|1221086_1221368_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.2	1.6e-14
WP_012337645.1|1221378_1221654_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012337646.1|1221658_1222246_-|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	36.5	1.8e-23
WP_012337647.1|1222242_1222785_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	42.6	6.9e-38
WP_012337648.1|1222760_1223282_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	34.5	9.6e-13
WP_012337649.1|1223278_1223602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337650.1|1223601_1223862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337651.1|1223879_1225754_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.6	1.3e-163
WP_012337652.1|1225750_1227337_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.6	1.2e-130
WP_012337653.1|1227333_1227882_-	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	51.7	4.4e-40
WP_012337654.1|1227885_1229838_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	66.9	6.4e-251
WP_012337655.1|1229830_1230406_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	58.0	9.5e-46
WP_012337656.1|1230536_1230761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337657.1|1230762_1231224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337658.1|1231213_1231543_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012337849.1|1231535_1232036_-	lysozyme	NA	I2GUG4	Acinetobacter_phage	51.4	8.6e-27
WP_012337850.1|1232002_1232620_-	hypothetical protein	NA	A0A1W6JT18	Escherichia_phage	47.9	2.6e-25
WP_021358648.1|1232653_1232851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337851.1|1233317_1235846_-	primase	NA	C8CLH6	Xylella_phage	75.4	0.0e+00
WP_012337852.1|1235982_1236564_-	Bro-N domain-containing protein	NA	C8CLH5	Xylella_phage	60.4	1.5e-30
WP_012337854.1|1236823_1237207_-	hypothetical protein	NA	C8CLH2	Xylella_phage	89.7	3.6e-57
WP_021358651.1|1237294_1237624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337855.1|1237613_1237859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021358652.1|1237857_1238637_+	helix-turn-helix transcriptional regulator	NA	D0UIL9	Aggregatibacter_phage	27.2	7.4e-09
WP_004087040.1|1238687_1239299_-	Fic family protein	NA	NA	NA	NA	NA
WP_004087046.1|1239295_1239484_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_012337857.1|1239864_1240269_+	hypothetical protein	NA	C8CLG9	Xylella_phage	38.7	1.4e-11
WP_012337858.1|1240265_1240727_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_012337859.1|1240723_1241131_+	hypothetical protein	NA	C8CLG7	Xylella_phage	79.3	8.2e-52
WP_004086069.1|1241127_1241319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337860.1|1241350_1241920_-	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.7	3.3e-99
WP_004085029.1|1242004_1242409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337663.1|1242410_1242689_-	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	3.6e-43
WP_012337861.1|1242685_1244866_-	DNA polymerase	NA	C8CLG0	Xylella_phage	94.9	0.0e+00
WP_031345946.1|1244867_1246034_-	Bro-N domain-containing protein	NA	C8CLG1	Xylella_phage	76.6	2.0e-159
WP_012337863.1|1246120_1246687_-	DUF2815 family protein	NA	C8CLG2	Xylella_phage	94.7	8.6e-100
WP_012337864.1|1246686_1247964_-	DUF2800 domain-containing protein	NA	C8CLG3	Xylella_phage	93.4	5.0e-228
WP_012337865.1|1247960_1248458_-	hypothetical protein	NA	C8CLG4	Xylella_phage	94.7	1.0e-51
WP_004086187.1|1248447_1248642_-	hypothetical protein	NA	C8CLG5	Xylella_phage	98.4	1.6e-26
WP_012337666.1|1249702_1249948_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	80.5	1.2e-29
WP_012337868.1|1249947_1250967_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	87.0	6.6e-167
1260064:1260080	attR	TTAGGCATGATGACTGT	NA	NA	NA	NA
>prophage 4
NC_010513	Xylella fastidiosa M12, complete sequence	2475130	1349286	1393444	2475130	tail,terminase,plate,integrase,holin,head	Haemophilus_phage(25.0%)	55	1379688:1379704	1396470:1396486
WP_012337886.1|1349286_1350162_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	2.4e-08
WP_004084992.1|1350158_1351127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004084994.1|1351385_1351832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012337887.1|1351935_1353180_-|tail	tail fiber protein	tail	A4PE46	Ralstonia_virus	32.0	2.6e-08
WP_004084996.1|1353183_1353744_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	26.8	8.5e-07
WP_012337888.1|1353740_1354886_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	49.7	2.5e-98
WP_012337889.1|1354978_1355332_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.4	5.7e-25
WP_012337890.1|1355328_1355970_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	38.1	4.3e-31
WP_004085000.1|1355966_1356797_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	51.5	6.8e-77
WP_004085001.1|1356793_1357111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337891.1|1357110_1357881_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.2	9.8e-30
WP_004091377.1|1357991_1358219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004087087.1|1358202_1358469_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	41.9	2.3e-15
WP_012337892.1|1358479_1360369_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	28.0	1.8e-24
WP_014607750.1|1360325_1360490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337893.1|1360516_1360939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085006.1|1360935_1361373_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	61.0	2.0e-43
WP_012337894.1|1361382_1362879_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	48.2	1.1e-125
WP_004085008.1|1362879_1363413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337896.1|1363336_1363717_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	40.4	6.5e-19
WP_012337897.1|1363691_1364171_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	29.3	7.8e-09
WP_012337898.1|1364167_1364539_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	37.4	1.5e-12
WP_012337899.1|1364541_1364841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337900.1|1364904_1365888_-	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	38.7	3.2e-49
WP_012337901.1|1365897_1366380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337902.1|1366389_1367598_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	42.2	3.3e-40
WP_021358621.1|1367597_1368443_-|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	33.5	1.6e-28
WP_031345929.1|1369784_1371335_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	44.4	3.5e-111
WP_012337905.1|1371285_1371684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085111.1|1371775_1371988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337906.1|1371989_1372451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004086918.1|1372440_1372770_-|holin	phage holin family protein	holin	A0A172PZR6	Pseudomonas_phage	44.0	5.7e-19
WP_012337907.1|1372762_1373263_-	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	1.9e-26
WP_012337908.1|1373428_1374127_-	hypothetical protein	NA	C8CLH7	Xylella_phage	84.3	2.3e-102
WP_031345921.1|1374255_1374666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021358588.1|1375030_1376896_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004085711.1|1376892_1377528_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004085709.1|1378277_1378736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085707.1|1378943_1379441_-	hypothetical protein	NA	NA	NA	NA	NA
1379688:1379704	attL	AACCGCGACATTACGTC	NA	NA	NA	NA
WP_004085705.1|1380064_1381069_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_012337912.1|1381629_1382013_-	VOC family protein	NA	NA	NA	NA	NA
WP_004085734.1|1382166_1382499_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_004085701.1|1383354_1384689_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_027700580.1|1384783_1385638_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004085698.1|1386129_1386903_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004085697.1|1386899_1387364_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_004085696.1|1387525_1387864_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
WP_004085695.1|1387850_1388111_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	40.7	5.7e-06
WP_012337913.1|1388326_1388998_-	hypothetical protein	NA	C8CLH7	Xylella_phage	84.2	6.6e-99
WP_021358593.1|1389126_1389588_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	43.0	2.7e-11
WP_004085691.1|1389584_1390349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012337914.1|1391029_1391545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085686.1|1391918_1392158_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012337915.1|1392176_1392425_+	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	85.4	1.6e-34
WP_012337916.1|1392424_1393444_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	88.8	8.4e-170
1396470:1396486	attR	AACCGCGACATTACGTC	NA	NA	NA	NA
>prophage 5
NC_010513	Xylella fastidiosa M12, complete sequence	2475130	1550388	1556522	2475130		Xylella_phage(50.0%)	7	NA	NA
WP_004083461.1|1550388_1550685_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	48.1	3.4e-07
WP_004084124.1|1550681_1550996_-	hypothetical protein	NA	C8CLF7	Xylella_phage	94.7	1.9e-32
WP_012337663.1|1552615_1552894_+	VRR-NUC domain-containing protein	NA	C8CLF9	Xylella_phage	95.6	3.6e-43
WP_004085897.1|1552895_1553342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004085894.1|1553426_1554839_+	DEAD/DEAH box helicase	NA	C8CLF7	Xylella_phage	96.2	2.7e-227
WP_012337962.1|1555190_1555922_+	site-specific DNA-methyltransferase	NA	A0A2P1CGF5	Mycobacterium_phage	50.9	4.6e-61
WP_012337659.1|1556021_1556522_+	lysozyme	NA	A0A1B1UZH2	Plesiomonas_phage	51.1	3.3e-26
