The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	1723542	1731742	3958233	protease	uncultured_phage(33.33%)	9	NA	NA
WP_004451701.1|1723542_1724487_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.6	1.9e-14
WP_004451703.1|1725111_1726107_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358645.1|1726223_1726985_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_004451706.1|1727002_1727434_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	32.4	3.0e-12
WP_004451707.1|1727435_1728101_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.1	1.0e-38
WP_004451708.1|1728104_1728695_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.8	7.0e-44
WP_004451709.1|1728878_1729538_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.0e-59
WP_015957528.1|1729831_1730650_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015957755.1|1730797_1731742_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	1.7e-15
>prophage 2
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	2310014	2349516	3958233	tail,portal,capsid,integrase	uncultured_Caudovirales_phage(39.39%)	54	2307018:2307045	2349584:2349611
2307018:2307045	attL	TTAAATACATCTTATGTTAATGTTCAAC	NA	NA	NA	NA
WP_003400220.1|2310014_2310788_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.0	1.4e-87
WP_003400221.1|2310831_2311026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400223.1|2311042_2311297_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	68.4	4.1e-25
WP_003400225.1|2311463_2311931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015957905.1|2312067_2312190_-	hypothetical protein	NA	A0A0A7S0E7	Clostridium_phage	52.5	1.7e-05
WP_003400229.1|2312182_2312548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400231.1|2312560_2314366_-	PQQ-binding-like beta-propeller repeat protein	NA	E2ELJ8	Clostridium_phage	59.4	1.6e-54
WP_015958048.1|2314372_2315530_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0C5AEV9	Paenibacillus_phage	35.4	7.0e-64
WP_003400235.1|2315725_2316589_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	39.7	5.4e-45
WP_015957621.1|2316578_2319194_-|tail	phage tail tape measure protein	tail	A0A0A7RU22	Clostridium_phage	62.9	1.6e-84
WP_003400239.1|2319244_2319406_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003400241.1|2319438_2319933_-	hypothetical protein	NA	A0A0K2CP90	Brevibacillus_phage	38.0	1.2e-12
WP_003400243.1|2319979_2320573_-	bacteriophage Gp15 family protein	NA	A0A1J1J8Y5	Escherichia_phage	60.9	6.1e-64
WP_003400245.1|2320572_2320917_-	hypothetical protein	NA	A0A1J1JCF3	Escherichia_phage	45.9	8.0e-16
WP_003400246.1|2320980_2321187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003400248.1|2321203_2321428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400260.1|2321431_2321926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400262.1|2321926_2322361_-	hypothetical protein	NA	A0A0A8WJ92	Clostridium_phage	55.2	2.0e-40
WP_003400263.1|2322357_2322702_-	hypothetical protein	NA	F6K8R4	Clostridium_phage	43.4	2.1e-16
WP_003400265.1|2322701_2323112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400267.1|2323113_2323380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400269.1|2323369_2323555_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003400272.1|2323604_2324552_-	hypothetical protein	NA	D2J006	Enterococcus_phage	59.5	5.3e-102
WP_003400276.1|2324575_2325214_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	31.4	2.5e-18
WP_003400279.1|2325482_2326076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400280.1|2326284_2327007_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_003400282.1|2327006_2328284_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	51.9	1.9e-115
WP_003400283.1|2328287_2330021_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	70.3	1.9e-243
WP_003400284.1|2330043_2330688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400285.1|2330740_2330932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400287.1|2331194_2331611_-	helix-turn-helix domain-containing protein	NA	A0A2H4J863	uncultured_Caudovirales_phage	69.6	4.2e-43
WP_003400288.1|2331730_2332162_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J015	uncultured_Caudovirales_phage	67.1	2.1e-45
WP_003400289.1|2332516_2332696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015957894.1|2332725_2334591_-	primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	88.4	0.0e+00
WP_015958155.1|2334617_2336303_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	39.7	7.8e-64
WP_003400296.1|2336407_2338102_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	84.4	6.4e-292
WP_003400298.1|2338323_2338782_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	68.0	5.1e-58
WP_003400309.1|2338784_2339066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400311.1|2339065_2340772_-	AAA family ATPase	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	74.3	1.1e-217
WP_003400312.1|2340783_2340957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400314.1|2340962_2341766_-	hypothetical protein	NA	A0A2H4J786	uncultured_Caudovirales_phage	83.9	4.9e-133
WP_003400317.1|2341758_2342088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400318.1|2342092_2342389_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	75.3	1.1e-37
WP_015957922.1|2342388_2343216_-	DUF1351 domain-containing protein	NA	A0A2H4J082	uncultured_Caudovirales_phage	82.2	1.7e-120
WP_003400320.1|2343208_2343655_-	hypothetical protein	NA	A0A2H4J7N9	uncultured_Caudovirales_phage	32.7	4.0e-07
WP_012340089.1|2343658_2344756_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	78.9	3.7e-171
WP_003355976.1|2344915_2345086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400326.1|2345100_2345394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003400328.1|2345413_2346163_-	hypothetical protein	NA	Q332L4	Clostridium_botulinum_C_phage	36.6	1.0e-15
WP_003400331.1|2346179_2346509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015957767.1|2346531_2346756_-	transcriptional regulator	NA	A0A0A7RTI3	Clostridium_phage	70.4	3.7e-22
WP_003400335.1|2346977_2347427_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	56.5	1.9e-33
WP_003400337.1|2347476_2347893_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	30.1	1.8e-06
WP_003400341.1|2348451_2349516_+|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	33.1	1.1e-31
2349584:2349611	attR	TTAAATACATCTTATGTTAATGTTCAAC	NA	NA	NA	NA
>prophage 3
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	2681277	2735211	3958233	portal,terminase,tail,capsid,protease,tRNA,head,integrase	Clostridium_phage(39.29%)	70	2699405:2699424	2713343:2713362
WP_191590059.1|2681277_2682348_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	E2ELJ7	Clostridium_phage	58.5	4.9e-120
WP_015957549.1|2682348_2683215_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	70.2	5.7e-111
WP_015957775.1|2683231_2688592_-|tail	phage tail tape measure protein	tail	Q0SPL2	Clostridium_phage	36.6	6.1e-62
WP_015957938.1|2688853_2689180_-	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	34.8	1.2e-05
WP_003399875.1|2689215_2689797_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	59.4	3.8e-58
WP_003399877.1|2689799_2690144_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	44.3	1.4e-20
WP_003399880.1|2690140_2690530_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	54.2	4.9e-30
WP_003399882.1|2690522_2690849_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015958020.1|2690829_2691156_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	51.6	1.9e-14
WP_003399886.1|2691172_2691274_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003399888.1|2691368_2692496_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	65.3	7.9e-129
WP_015957668.1|2692488_2693247_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	63.4	1.9e-73
WP_015957484.1|2693236_2694421_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	38.8	2.3e-70
WP_015957709.1|2694436_2696137_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	56.0	9.0e-185
WP_003399893.1|2696133_2696598_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	61.3	1.5e-49
WP_003399895.1|2696869_2697106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399897.1|2697196_2697670_-	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	35.5	1.8e-10
WP_003399899.1|2697669_2698092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399901.1|2698136_2698439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399902.1|2698599_2699145_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	52.5	1.4e-51
WP_003399905.1|2699141_2699357_-	hypothetical protein	NA	NA	NA	NA	NA
2699405:2699424	attL	TTAAGTGCTTTTAGTACATA	NA	NA	NA	NA
WP_003399907.1|2699539_2699968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399909.1|2699951_2700122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399911.1|2700123_2700414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399915.1|2700570_2701566_-|integrase	tyrosine-type recombinase/integrase	integrase	B6SCW8	Bacteriophage	25.0	7.5e-06
WP_003399919.1|2701930_2702980_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	29.6	5.4e-39
WP_003399921.1|2703006_2703210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003385222.1|2703223_2703418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100915.1|2703455_2703641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012340082.1|2703678_2704002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958011.1|2704035_2704197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015957902.1|2704246_2704543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399929.1|2704583_2705303_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	43.0	1.0e-49
WP_015957532.1|2705367_2705556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399933.1|2705581_2705881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015957613.1|2705893_2706202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399939.1|2706224_2706938_-	ATP-binding protein	NA	M9Q1J4	Clostridium_phage	45.1	2.9e-52
WP_015958059.1|2706927_2707794_-	phage replisome organizer N-terminal domain-containing protein	NA	C5J987	Streptococcus_phage	51.8	2.2e-33
WP_003399944.1|2707831_2708104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399945.1|2708120_2708303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399947.1|2708304_2708565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003399949.1|2708576_2709377_-	ORF6C domain-containing protein	NA	A0A0A7RUE5	Clostridium_phage	51.0	5.8e-41
WP_003399954.1|2709730_2709934_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003399955.1|2710139_2710505_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015957900.1|2710516_2712031_+	recombinase family protein	NA	A0A0A7S0M8	Clostridium_phage	76.6	1.3e-227
WP_003386384.1|2712896_2713076_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_004452043.1|2713520_2713658_-	hypothetical protein	NA	NA	NA	NA	NA
2713343:2713362	attR	TTAAGTGCTTTTAGTACATA	NA	NA	NA	NA
WP_003386388.1|2714048_2714303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004452045.1|2715037_2715346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004452046.1|2715673_2716342_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_004452048.1|2716420_2716897_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_004452050.1|2717023_2717224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079007496.1|2717342_2717456_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_004452051.1|2717951_2718236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004452053.1|2718246_2719050_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	53.6	5.0e-77
WP_004452056.1|2719030_2719834_-	recombinase RecT	NA	H7BUU1	unidentified_phage	54.3	1.6e-59
WP_004452057.1|2720150_2720354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003397157.1|2720560_2720713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015957707.1|2720930_2722601_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015957949.1|2722686_2723307_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	3.7e-35
WP_015958170.1|2723452_2724679_-	U32 family peptidase	NA	Q6DW11	Phage_TP	37.0	1.5e-51
WP_004452060.1|2724671_2725328_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_004452061.1|2725410_2726442_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012100455.1|2726519_2728346_-	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	38.5	7.8e-17
WP_004452066.1|2728986_2730696_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003385810.1|2730743_2731196_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004452069.1|2731317_2731572_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_004440635.1|2731585_2731999_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003385813.1|2732205_2732457_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_004452073.1|2732571_2735211_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.0	3.2e-64
>prophage 4
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	2877406	2883455	3958233		Enterobacteria_phage(33.33%)	6	NA	NA
WP_003399225.1|2877406_2877976_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.3e-50
WP_003399226.1|2877987_2879043_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	46.4	9.2e-79
WP_003399227.1|2879061_2879955_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.2	4.6e-39
WP_003399228.1|2879959_2880880_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.3e-101
WP_003399229.1|2881330_2882437_-	LegC family aminotransferase	NA	A0A2K9L470	Tupanvirus	29.1	1.5e-39
WP_003399230.1|2882462_2883455_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L0I7	Tupanvirus	31.8	6.1e-32
>prophage 5
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	3110470	3120005	3958233		Synechococcus_phage(28.57%)	7	NA	NA
WP_003403046.1|3110470_3111970_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	2.1e-68
WP_015958132.1|3112183_3112801_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.8	3.1e-26
WP_003403054.1|3112927_3113923_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.4	7.6e-67
WP_003403058.1|3114094_3115543_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	9.4e-58
WP_015957931.1|3115634_3116339_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	41.9	6.0e-42
WP_003403061.1|3116338_3116818_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.1	1.4e-26
WP_015957582.1|3117449_3120005_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.7e-09
>prophage 6
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	3271339	3279971	3958233		Clostridium_phage(100.0%)	8	NA	NA
WP_003403517.1|3271339_3272425_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	70.4	3.5e-142
WP_003403518.1|3272436_3273435_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	73.2	2.7e-141
WP_003403519.1|3273446_3273722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403520.1|3273724_3275746_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	48.5	1.3e-57
WP_003403521.1|3275757_3277266_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	37.9	1.4e-93
WP_003403522.1|3277277_3278264_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.4	6.5e-111
WP_003403525.1|3278265_3279615_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	75.1	2.1e-75
WP_003403527.1|3279629_3279971_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	54.3	1.0e-15
>prophage 7
NC_010516	Clostridium botulinum B1 str. Okra, complete sequence	3958233	3283251	3293610	3958233		Clostridium_phage(75.0%)	16	NA	NA
WP_003403534.1|3283251_3283476_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	67.6	3.1e-21
WP_003403536.1|3283453_3283870_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	64.5	6.0e-42
WP_003403549.1|3283884_3284772_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.7	4.5e-119
WP_003403551.1|3284776_3285196_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	72.7	6.0e-58
WP_003403554.1|3285201_3285549_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	59.8	5.6e-33
WP_003403564.1|3285553_3285919_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.0	5.9e-33
WP_003403567.1|3285918_3286203_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	60.2	1.0e-24
WP_003403570.1|3286707_3287229_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	49.4	1.4e-35
WP_003403572.1|3287341_3287662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003403574.1|3287718_3288519_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.8	9.9e-33
WP_003403575.1|3288508_3289414_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	40.2	4.2e-40
WP_003403576.1|3289507_3289720_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003403577.1|3289781_3289991_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|3290182_3290593_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003403583.1|3290892_3291042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003403585.1|3292122_3293610_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.8	8.2e-65
>prophage 1
NC_010379	Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence	148780	42316	54017	148780		Clostridium_botulinum_D_phage(50.0%)	6	NA	NA
WP_012291519.1|42316_46192_-	botulinum neurotoxin type B	NA	Q332E0	Clostridium_botulinum_C_phage	33.2	4.4e-187
WP_003404192.1|46217_49811_-	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	69.0	0.0e+00
WP_003404193.1|49972_50509_-	botulinum neurotoxin transcription-activating sigma factor BotR	NA	Q9ZWV5	Clostridium_botulinum_D_phage	52.8	5.6e-40
WP_012291520.1|50735_51620_+	ricin-type beta-trefoil lectin domain protein	NA	Q38196	Clostridium_botulinum_phage	32.4	8.9e-35
WP_012291566.1|51682_52123_+	hemagglutinin	NA	Q786Y1	Clostridium_botulinum_D_phage	63.7	7.8e-48
WP_012291512.1|52136_54017_+	botulinum neurotoxin hemagglutinin HA70 subunit	NA	Q786X9	Clostridium_botulinum_D_phage	67.5	7.8e-238
