The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010334	Shewanella halifaxensis HAW-EB4, complete sequence	5226917	1461213	1468763	5226917		Staphylococcus_phage(50.0%)	7	NA	NA
WP_012276313.1|1461213_1462881_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.8	1.7e-39
WP_012276314.1|1463159_1464416_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.2	1.9e-94
WP_012276315.1|1464569_1465019_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012276316.1|1465087_1466209_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.2	7.1e-53
WP_012276317.1|1466212_1466878_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	30.6	1.7e-25
WP_012276318.1|1467037_1468141_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	7.1e-66
WP_012276319.1|1468286_1468763_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	2.5e-28
>prophage 2
NC_010334	Shewanella halifaxensis HAW-EB4, complete sequence	5226917	1491194	1501925	5226917	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_012276338.1|1491194_1491947_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.5	1.3e-71
WP_012276339.1|1492048_1492684_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.9e-36
WP_012276340.1|1492748_1493642_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_012276341.1|1493718_1494684_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	32.4	1.1e-33
WP_012276342.1|1494803_1497383_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.4	1.5e-34
WP_012276343.1|1497703_1498771_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.4e-111
WP_012276344.1|1499300_1501925_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	38.5	4.1e-67
>prophage 3
NC_010334	Shewanella halifaxensis HAW-EB4, complete sequence	5226917	1583978	1659242	5226917	integrase,capsid,terminase,plate,head,tRNA,portal,tail	Pseudoalteromonas_phage(42.11%)	83	1583315:1583362	1619850:1619897
1583315:1583362	attL	TTGGTGGAGGCGGCGGGGCTCGAACCCGCGTCCAAAAAGCCTACATCC	NA	NA	NA	NA
WP_150102135.1|1583978_1584137_-|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	73.3	3.0e-10
WP_012276409.1|1584531_1585779_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	23.2	2.5e-06
WP_012276410.1|1585771_1586353_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012276411.1|1586451_1586625_-|integrase	integrase	integrase	F1BUN9	Cronobacter_phage	71.4	2.3e-11
WP_041415883.1|1587215_1587773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012276413.1|1587769_1588795_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	54.8	9.5e-105
WP_012276414.1|1588795_1589986_-	hypothetical protein	NA	U3PB51	Vibrio_phage	40.0	1.1e-51
WP_012276415.1|1590005_1590695_-	helix-turn-helix domain containing protein	NA	R9TR74	Vibrio_phage	24.5	3.0e-14
WP_012276416.1|1590779_1590986_+	hypothetical protein	NA	Q1I116	Pasteurella_virus	37.3	5.9e-06
WP_012276417.1|1591054_1591597_+	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	39.3	1.1e-19
WP_012276418.1|1591609_1592056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276419.1|1592135_1592375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276420.1|1592376_1592682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041415884.1|1592678_1592879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276421.1|1592875_1593112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276422.1|1593108_1593363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276423.1|1593362_1595663_+	replication endonuclease	NA	A0A2P1CKY6	Pseudoalteromonas_phage	38.1	3.9e-82
WP_150102069.1|1595963_1596284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273656.1|1596411_1596624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276425.1|1596547_1596799_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	60.2	3.5e-21
WP_041416290.1|1597011_1597353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150102070.1|1597509_1598016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276428.1|1598151_1599168_-|portal	phage portal protein	portal	A0A1L5C2C1	Pseudoalteromonas_phage	78.7	9.9e-155
WP_041415888.1|1599149_1600940_-|terminase	terminase	terminase	A0A1L5C295	Pseudoalteromonas_phage	79.2	1.4e-284
WP_012276430.1|1601162_1602059_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2I7RNH1	Vibrio_phage	44.3	7.7e-34
WP_012276431.1|1602108_1603149_+|capsid	phage major capsid protein, P2 family	capsid	A0A1L5C2B0	Pseudoalteromonas_phage	71.1	1.2e-136
WP_012276432.1|1603229_1603790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083758337.1|1603837_1604503_+	hypothetical protein	NA	A0A1L5C2B7	Pseudoalteromonas_phage	65.1	5.6e-66
WP_012276434.1|1604624_1605074_+|head	head completion/stabilization protein	head	A0A1L5C2A5	Pseudoalteromonas_phage	73.2	6.9e-52
WP_012276435.1|1605070_1605571_+|tail	phage tail protein	tail	A0A1L5C2C9	Pseudoalteromonas_phage	72.4	5.3e-61
WP_012276436.1|1605567_1606221_+	hypothetical protein	NA	A0A1L5C2C4	Pseudoalteromonas_phage	61.8	9.4e-66
WP_012276437.1|1606234_1607353_+	DUF2586 family protein	NA	A0A1L5C2B3	Pseudoalteromonas_phage	73.6	2.3e-152
WP_012276438.1|1607377_1607827_+	DUF2597 family protein	NA	A0A1L5C2D0	Pseudoalteromonas_phage	90.6	9.6e-70
WP_012276439.1|1607840_1608047_+	TraR/DksA C4-type zinc finger protein	NA	C4MZI8	Enterobacteria_phage	38.1	6.5e-05
WP_012276440.1|1608043_1608592_+	N-acetylmuramidase	NA	A2I317	Vibrio_virus	51.1	6.7e-49
WP_012276441.1|1608601_1608991_+	hypothetical protein	NA	A0A1B1ITB4	uncultured_Mediterranean_phage	45.5	1.4e-19
WP_012276442.1|1608987_1609254_+	hypothetical protein	NA	A0A1L5C2D5	Pseudoalteromonas_phage	46.2	1.9e-12
WP_012276443.1|1609250_1609514_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	47.7	1.4e-15
WP_190273657.1|1609564_1609702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276444.1|1609746_1611501_+|tail	phage tail tape measure protein	tail	A0A1L5C2B2	Pseudoalteromonas_phage	66.9	4.3e-206
WP_012276445.1|1611497_1611851_+	DUF2590 family protein	NA	A0A1L5C2D6	Pseudoalteromonas_phage	69.5	1.6e-35
WP_012276446.1|1611843_1613040_+|plate	baseplate J/gp47 family protein	plate	A0A1L5C2D1	Pseudoalteromonas_phage	73.0	6.4e-169
WP_041416292.1|1613043_1613703_+	hypothetical protein	NA	A0A1L5C2C5	Pseudoalteromonas_phage	67.1	2.3e-59
WP_012276448.1|1616518_1617016_+	hypothetical protein	NA	A0A1L5C2B6	Pseudoalteromonas_phage	70.2	6.7e-40
WP_012276449.1|1617015_1617705_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	48.0	4.0e-67
WP_012276450.1|1617717_1618392_+	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	63.8	5.3e-72
WP_012276451.1|1618415_1618613_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	67.7	3.6e-13
WP_012276452.1|1618760_1619126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012154535.1|1620315_1620810_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.1	5.7e-23
1619850:1619897	attR	TTGGTGGAGGCGGCGGGGCTCGAACCCGCGTCCAAAAAGCCTACATCC	NA	NA	NA	NA
WP_012276453.1|1621002_1621434_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_012276454.1|1621430_1621763_+	RnfH family protein	NA	NA	NA	NA	NA
WP_012276455.1|1621861_1622356_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_012276456.1|1622861_1623668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276457.1|1623745_1623958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041415891.1|1623965_1625750_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_012276459.1|1626594_1628232_+	malate synthase A	NA	NA	NA	NA	NA
WP_012276460.1|1628610_1630089_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_012276461.1|1630263_1630755_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012276462.1|1630814_1631639_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
WP_012276463.1|1631903_1632350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012276464.1|1632309_1633053_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	43.8	3.2e-38
WP_012276465.1|1633660_1633894_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_012276466.1|1634072_1634375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012276467.1|1634542_1635052_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012276468.1|1635143_1635683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012276469.1|1635785_1637552_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_012276470.1|1637762_1638833_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012276471.1|1638992_1640114_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_012276472.1|1640134_1640935_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_012276473.1|1640934_1641918_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_012276474.1|1641940_1643056_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_012276475.1|1643193_1644468_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012276476.1|1644482_1645103_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012276477.1|1645114_1646302_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_012276478.1|1646387_1647860_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_012276479.1|1648362_1648944_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_012276480.1|1649626_1651075_+	purine permease	NA	H9YQ34	environmental_Halophage	43.7	3.9e-19
WP_190273626.1|1651425_1653015_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012276482.1|1653550_1654888_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.0	3.4e-38
WP_012276483.1|1655007_1656480_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	3.8e-91
WP_012276484.1|1656604_1658182_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_150102071.1|1658318_1658513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083758310.1|1658720_1659242_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
