The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	5624	46816	3075407	transposase,lysis,integrase	uncultured_Mediterranean_phage(18.18%)	44	12450:12472	46817:46839
WP_012281183.1|5624_6254_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_041314100.1|6562_7291_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_012281187.1|7835_9458_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281188.1|9496_9826_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_012281189.1|10108_11989_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	34.6	7.1e-90
12450:12472	attL	TGTTGCCATTTTGCTGCCACGGC	NA	NA	NA	NA
WP_012281191.1|12860_14204_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_012281192.1|14436_14802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281193.1|14975_15302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281195.1|15597_16254_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_148207034.1|16723_17491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281199.1|17576_18086_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_012281200.1|18269_18794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281201.1|18926_19403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281202.1|19755_21378_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281204.1|22175_23603_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	4.3e-31
WP_148207148.1|23654_24359_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281206.1|25202_25607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281207.1|25835_27179_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_041312978.1|27272_28052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281209.1|28263_28413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281210.1|28780_29125_-	hypothetical protein	NA	U6C6J3	Ralstonia_phage	45.7	4.7e-16
WP_012281211.1|29137_29446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083765262.1|29467_30439_-	DUF5131 family protein	NA	A0A1B1IPY1	uncultured_Mediterranean_phage	30.6	2.4e-25
WP_041312981.1|30438_30672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281213.1|30758_30914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281214.1|30924_31248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041312984.1|31399_31642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281215.1|31737_32148_-	hypothetical protein	NA	H7BV88	unidentified_phage	37.7	2.7e-10
WP_012281216.1|32144_32339_-	DUF3873 family protein	NA	NA	NA	NA	NA
WP_012281218.1|32924_33680_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	36.3	9.7e-06
WP_012281219.1|33809_34079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281220.1|34238_34574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281221.1|34659_35136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041312987.1|35135_35714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018035429.1|36079_36583_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012281222.1|36579_39891_-	tape measure protein	NA	A0A127AW00	Bacillus_phage	32.2	6.6e-06
WP_012281223.1|39976_41374_-	hypothetical protein	NA	A0A1B0XTI8	Freshwater_phage	46.1	1.7e-109
WP_012281224.1|41407_41701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281225.1|41728_42682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281226.1|42696_43413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281227.1|43529_44546_-	DUF4373 domain-containing protein	NA	H7BVX7	unidentified_phage	60.4	1.6e-27
WP_012281228.1|44608_44836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753980.1|45038_45656_+	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	46.6	3.2e-07
WP_012281230.1|45709_46816_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	56.1	3.5e-113
46817:46839	attR	TGTTGCCATTTTGCTGCCACGGC	NA	NA	NA	NA
>prophage 2
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	152111	267656	3075407	transposase,tail,tRNA,integrase	Bacillus_phage(15.0%)	99	180729:180745	252323:252339
WP_083765263.1|152111_152408_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_012281312.1|153052_154141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753992.1|154254_160953_-	immunoglobulin domain-containing protein	NA	M1FGL0	Enterobacteriaphage	33.1	2.9e-16
WP_083764956.1|163210_166207_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.5	2.5e-44
WP_012281317.1|166328_167027_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	9.8e-37
WP_012281318.1|167086_167701_-	hypothetical protein	NA	A0A2K9V3H4	Faecalibacterium_phage	41.2	7.8e-30
WP_012281319.1|167762_168566_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_012281320.1|168565_170182_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012281321.1|170178_171615_-	SAM-dependent DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	31.5	4.2e-34
WP_012281322.1|171633_173973_-	DEAD/DEAH box helicase family protein	NA	A0A0E3JPC8	Verrucomicrobia_phage	37.1	2.3e-05
WP_012281323.1|173998_174178_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012281326.1|175819_176233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753994.1|176243_176471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281329.1|176795_177011_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	74.6	2.1e-22
WP_012281330.1|177281_177536_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012281331.1|177547_179368_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_012281332.1|179424_180930_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
180729:180745	attL	CGAAGTCGATGGCAAGG	NA	NA	NA	NA
WP_012281334.1|181079_182864_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_041313024.1|182875_183283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281336.1|183687_183945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281337.1|184055_184349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281338.1|184353_185235_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_012281339.1|185268_185634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281340.1|185651_186737_-	M23 family metallopeptidase	NA	I2E8W3	Clostridium_phage	50.4	1.9e-26
WP_012281341.1|186741_187236_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_012281343.1|188071_189097_-|integrase	site-specific integrase	integrase	S5M872	Bacillus_phage	23.9	1.4e-07
WP_148207041.1|189093_190083_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281345.1|190079_191303_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281347.1|191372_191801_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	50.9	3.1e-25
WP_012281348.1|191868_193701_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_012281349.1|193880_194516_-	Fic family protein	NA	NA	NA	NA	NA
WP_015049870.1|194499_194691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281351.1|194800_195391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281352.1|195387_195690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281353.1|195703_196273_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	47.5	1.0e-20
WP_015049869.1|196269_197127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281355.1|197201_197543_-	DUF3852 domain-containing protein	NA	NA	NA	NA	NA
WP_012281356.1|197772_198822_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281357.1|198811_199792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281358.1|199775_201041_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281359.1|201180_202869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281360.1|202944_203499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281361.1|203591_204143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281362.1|204139_204535_-	DUF4320 family protein	NA	NA	NA	NA	NA
WP_012281364.1|204647_205520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281365.1|205526_206456_-	membrane protein	NA	NA	NA	NA	NA
WP_012281366.1|206452_207904_-	CpaF family protein	NA	NA	NA	NA	NA
WP_012281367.1|207900_208716_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012281368.1|208718_209531_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_012281369.1|209527_209989_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_012281370.1|209978_210209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281371.1|210321_210702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281372.1|210743_210962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281373.1|211009_211396_-	septation protein SpoVG family protein	NA	NA	NA	NA	NA
WP_012281374.1|211461_212022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281375.1|212057_216641_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_012281376.1|216744_217329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281377.1|217341_217626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281378.1|217615_218038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281379.1|218109_219045_-	DNA adenine methylase	NA	A0A2H4IYF4	uncultured_Caudovirales_phage	42.9	3.9e-57
WP_012281380.1|219052_219253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281381.1|219354_219954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281382.1|219955_220483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281384.1|227187_228162_-	diguanylate cyclase	NA	Q6XM27	Feldmannia_irregularis_virus	28.0	5.6e-06
WP_012281385.1|228240_230970_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	2.9e-76
WP_012281386.1|231005_231404_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_012281387.1|231623_233438_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	27.6	5.8e-65
WP_012281388.1|233562_235605_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.8	9.3e-11
WP_012281389.1|235841_237473_-	putative manganese-dependent inorganic diphosphatase	NA	NA	NA	NA	NA
WP_148207152.1|237496_238504_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_012281391.1|238679_239777_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_012281392.1|239884_240541_-	Fe-S cluster protein	NA	NA	NA	NA	NA
WP_012281393.1|240542_241253_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_012281394.1|241268_242048_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_012281396.1|242464_243631_-	flavodoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012281397.1|243766_244978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281398.1|244991_245198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281399.1|245200_245821_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012281400.1|245987_246803_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041313040.1|246909_247137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281403.1|247345_248128_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	53.6	6.5e-13
WP_148207042.1|248526_248805_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.0	1.4e-18
WP_012281405.1|248969_249116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207153.1|249271_249472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281407.1|249495_250950_-	U32 family peptidase C-terminal domain-containing protein	NA	Q6DW11	Phage_TP	36.4	9.2e-53
WP_012281408.1|250939_251956_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_012281410.1|252149_252419_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
252323:252339	attR	CCTTGCCATCGACTTCG	NA	NA	NA	NA
WP_012281411.1|252570_253020_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_041314231.1|253024_253987_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012281413.1|254045_254324_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_012281414.1|254486_257138_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.1	3.9e-86
WP_012281416.1|257537_258359_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_012281187.1|258531_260154_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_041313043.1|261058_261655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281418.1|261721_263071_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_148207043.1|263665_264712_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012281420.1|264600_264927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148207154.1|265036_265741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281187.1|266033_267656_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	556496	672945	3075407	transposase,holin,tRNA,coat,integrase	Streptococcus_phage(19.05%)	93	559499:559514	631373:631388
WP_012281712.1|556496_557186_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_083765033.1|557250_558282_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_148207061.1|558404_558881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049754213.1|558974_560591_-	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
559499:559514	attL	CCGGGTGCGCCTTGGC	NA	NA	NA	NA
WP_012281716.1|560823_561000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281717.1|561122_562346_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012281718.1|562421_562793_-	adenosylmethionine decarboxylase	NA	A0A222YVV4	Synechococcus_phage	37.8	1.9e-15
WP_012281720.1|563568_564243_+	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_012281721.1|564239_564482_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012281187.1|564620_566243_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281723.1|566683_567403_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_012281724.1|567423_568296_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_012281725.1|568353_569037_-	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_012281726.1|569049_570786_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_041313160.1|570793_571909_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012281728.1|572204_573077_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_012281729.1|573225_574347_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_012281731.1|574511_575822_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_012281733.1|576364_577480_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012281734.1|577853_579146_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_148207062.1|579376_580921_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	29.0	2.1e-47
WP_012281736.1|580988_584762_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	5.0e-18
WP_012281738.1|585057_586098_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012281739.1|586261_587413_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	1.5e-37
WP_041313166.1|587965_588751_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012281745.1|589115_589781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041313169.1|590112_590382_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_012281746.1|590402_591335_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_041313172.1|591337_592024_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_012281747.1|592010_592703_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_049754013.1|592705_593866_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_012281749.1|593865_594429_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_012281750.1|594438_596010_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_148207064.1|595993_598147_-	CRISPR-associated helicase Cas3'	NA	A0A2R2ZGW0	Clostridioides_phage	21.8	2.1e-05
WP_041313175.1|598330_598546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281187.1|598683_600306_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281426.1|600852_602214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281755.1|605845_606634_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_049754214.1|606797_607406_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012281757.1|607475_608129_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012281204.1|608222_609650_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	4.3e-31
WP_148207065.1|610083_610947_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041313177.1|611043_611778_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	3.3e-35
WP_012281760.1|611836_612946_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012281761.1|613376_613817_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012281762.1|614017_615157_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.9	1.0e-19
WP_012281763.1|615169_617065_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.3	3.4e-100
WP_041313181.1|617248_619300_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	82.5	5.7e-08
WP_041314436.1|619597_620734_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_041314439.1|620827_621622_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_012281767.1|621937_622804_+	VanW family protein	NA	NA	NA	NA	NA
WP_187147821.1|623338_623788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281769.1|623839_625195_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	O89815	Mus_dunni_endogenous_virus	29.4	6.0e-06
WP_012281770.1|625187_625988_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041313184.1|626699_627230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207066.1|627226_628063_-	AAA family ATPase	NA	A0A1V0DZZ0	Clostridioides_phage	29.7	1.2e-09
WP_012281773.1|628423_628750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281775.1|629114_630737_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_148207067.1|631913_632960_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
631373:631388	attR	GCCAAGGCGCACCCGG	NA	NA	NA	NA
WP_012281778.1|632848_633175_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281187.1|633555_635178_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281191.1|636094_637438_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_012281191.1|637800_639144_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_041313187.1|639398_639623_+	excisionase family DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.0	3.5e-12
WP_049754215.1|639663_640812_+	hypothetical protein	NA	A0A139ZPI3	Marinitoga_camini_virus	25.2	2.1e-12
WP_012281782.1|640826_642539_+	ATP-binding protein	NA	A0A139ZPI2	Marinitoga_camini_virus	32.1	4.5e-67
WP_041313189.1|642558_644130_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012281784.1|644126_645932_+	hypothetical protein	NA	A0A139ZPI1	Marinitoga_camini_virus	23.5	5.3e-26
WP_012281785.1|647008_648202_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_187147832.1|648551_648821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049754017.1|648907_649258_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_012281788.1|649278_649539_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_012281789.1|649566_650139_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_012281790.1|650362_650830_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.2	4.4e-41
WP_012281791.1|650933_651515_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_012281792.1|651586_652015_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_187147800.1|652011_652674_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_012281794.1|652824_654882_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_049754216.1|654954_655218_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012281796.1|655660_656950_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	65.3	6.4e-159
WP_041314453.1|657093_658617_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012281187.1|658846_660469_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281798.1|660725_661481_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012281799.1|661621_662809_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_012281800.1|662958_663966_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_012281801.1|664126_665428_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_187147822.1|665471_665810_-	acyltransferase	NA	NA	NA	NA	NA
WP_012281803.1|665978_666938_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.4	4.3e-43
WP_049754217.1|666960_668322_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.7	1.3e-53
WP_012281805.1|668330_669236_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.3	2.9e-12
WP_148207160.1|669360_670848_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_012281807.1|670853_672383_-	alpha-amylase	NA	NA	NA	NA	NA
WP_012281809.1|672600_672945_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 4
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	718598	775921	3075407	transposase,coat	Acanthamoeba_polyphaga_moumouvirus(14.29%)	50	NA	NA
WP_012281851.1|718598_719714_-|coat	spore coat polysaccharide biosynthesis protein spsg/glycosyltransferase	coat	NA	NA	NA	NA
WP_012281853.1|721100_721880_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_083765268.1|722037_722304_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_049754023.1|722525_726623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281856.1|726685_726988_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_012281857.1|727002_727440_+	YaaR family protein	NA	NA	NA	NA	NA
WP_012281858.1|727471_728182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281859.1|728490_728955_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_012281860.1|729009_730308_+	flagellin	NA	NA	NA	NA	NA
WP_012281861.1|730413_731505_-	GDP-mannose 4,6-dehydratase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	25.9	3.1e-21
WP_041313218.1|731551_732157_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012281863.1|732153_733611_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_148207070.1|733614_734370_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.9	1.7e-05
WP_049754221.1|734400_734670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281866.1|734715_735897_-	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_041313220.1|735953_737048_-	UDP-galactopyranose mutase	NA	Q19CD9	Aeromonas_virus	38.3	7.1e-58
WP_012281868.1|737092_737620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187147823.1|737623_739015_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.9	1.9e-31
WP_012281870.1|739065_739578_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012281187.1|739679_741302_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281871.1|741368_741893_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012281872.1|741846_743277_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	2.9e-59
WP_012281873.1|743301_743583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281874.1|743810_744356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281876.1|744629_746033_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_148207072.1|746079_746658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281187.1|746829_748452_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281878.1|748466_750392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041313226.1|750420_752007_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012281880.1|752062_753169_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012281881.1|753251_754358_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012281882.1|754497_755841_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_148207162.1|756077_756227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281883.1|756511_756832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281884.1|758287_759334_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_012281887.1|760782_761034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281889.1|761473_762484_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.7	1.2e-35
WP_012281890.1|762595_763147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281891.1|763246_763687_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_012281892.1|763790_765596_-	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_041314516.1|765674_766049_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_012281894.1|766342_766750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281895.1|766753_768334_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_041313243.1|768534_769761_-	flagellin	NA	NA	NA	NA	NA
WP_012281897.1|769907_770171_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	52.9	5.5e-09
WP_012281898.1|770171_770633_-	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_012281899.1|770675_771086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281900.1|771319_772249_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_012281901.1|772292_774503_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_012281902.1|774772_775921_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 5
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	789686	833365	3075407	transposase	Klosneuvirus(14.29%)	38	NA	NA
WP_148207074.1|789686_790034_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041314529.1|790248_791343_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_041313251.1|791500_791941_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_049754027.1|791985_792306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281923.1|792429_792918_+	DUF4330 domain-containing protein	NA	NA	NA	NA	NA
WP_012281924.1|793264_794542_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041313254.1|794637_796569_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_041314540.1|796692_797040_+	EamA family transporter	NA	NA	NA	NA	NA
WP_012281927.1|797611_798745_-	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	27.2	8.0e-20
WP_012281928.1|798964_799498_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_083765089.1|799494_800301_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012281930.1|800452_801157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083765091.1|801373_801556_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012281931.1|801615_802551_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_148207075.1|802660_803791_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	34.9	2.3e-27
WP_012281933.1|803747_804233_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_187147802.1|804251_805049_-	sulfate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_049754030.1|805045_805870_-	sulfate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012281936.1|805866_806907_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012281187.1|807125_808748_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012281937.1|809042_810917_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.2	2.6e-31
WP_012281938.1|810916_811816_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_041313263.1|813857_815084_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_012281942.1|815073_816216_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012281943.1|816226_816502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281945.1|817130_817643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281946.1|817639_817960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012281939.1|818405_819158_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_187147803.1|819264_819633_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_083765093.1|820302_820509_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	48.3	7.9e-11
WP_012281952.1|822773_823967_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	23.2	3.7e-07
WP_012281953.1|823974_825090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041313271.1|825094_827224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041314558.1|827226_827814_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_012281956.1|827888_828821_-	NAD-dependent epimerase/dehydratase	NA	A0A0F7LC08	uncultured_marine_virus	46.3	3.0e-73
WP_012281957.1|829127_830471_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_012281958.1|830572_831556_-	GHMP kinase	NA	A0A067XQL1	Caulobacter_phage	29.6	1.2e-27
WP_012281959.1|831715_833365_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	1019353	1066838	3075407	transposase,protease	Pseudomonas_phage(22.22%)	42	NA	NA
WP_012282120.1|1019353_1021330_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	28.8	9.6e-29
WP_012282121.1|1021434_1021881_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_049754038.1|1022068_1024099_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_012282123.1|1024134_1025106_-	YybS family protein	NA	NA	NA	NA	NA
WP_012282124.1|1025333_1025870_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	50.9	9.6e-24
WP_012282125.1|1025963_1027064_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012282126.1|1027252_1027396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282127.1|1027518_1028604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282128.1|1028737_1028947_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_049754225.1|1028952_1029834_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012282130.1|1029887_1030892_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012282131.1|1030898_1031324_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_049754226.1|1031353_1032805_-	aminopeptidase	NA	NA	NA	NA	NA
WP_012282133.1|1032855_1033581_-	CvpA family protein	NA	NA	NA	NA	NA
WP_012282134.1|1033654_1034629_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	29.3	2.9e-18
WP_041313341.1|1034640_1036023_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_012282136.1|1036123_1036567_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_187147807.1|1036664_1039208_-	DEAD/DEAH box helicase	NA	F2Y0S4	Organic_Lake_phycodnavirus	29.0	6.7e-67
WP_012282138.1|1039297_1040188_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_012282139.1|1040201_1041272_-	permease	NA	NA	NA	NA	NA
WP_148207084.1|1041391_1041778_-	metalloregulator ArsR/SmtB family transcription factor	NA	E4ZFI8	Streptococcus_phage	36.7	3.4e-15
WP_012282141.1|1042030_1042528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282143.1|1042785_1044507_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	67.0	4.2e-190
WP_148207085.1|1044683_1046114_+	MFS transporter	NA	NA	NA	NA	NA
WP_012282145.1|1046177_1046348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282146.1|1046367_1046826_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_012282147.1|1046860_1047679_-	2-phosphosulfolactate phosphatase	NA	NA	NA	NA	NA
WP_012282148.1|1047691_1048534_-	phosphosulfolactate synthase	NA	NA	NA	NA	NA
WP_012282149.1|1048622_1049588_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041314679.1|1049751_1049976_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_187147808.1|1050073_1051147_-	endospore germination permease	NA	NA	NA	NA	NA
WP_012282152.1|1051203_1051422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041313347.1|1051424_1052594_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_187147809.1|1052590_1054135_-	spore germination protein	NA	NA	NA	NA	NA
WP_012281204.1|1054701_1056129_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	4.3e-31
WP_012282157.1|1056586_1058014_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	7.4e-31
WP_012281778.1|1058406_1058733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148207087.1|1058621_1059668_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_187147810.1|1059985_1061362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012281426.1|1061858_1063220_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012282160.1|1063315_1064809_-	hypothetical protein	NA	P79669	Escherichia_phage	21.7	1.1e-13
WP_012281187.1|1065215_1066838_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	1508968	1574050	3075407	transposase	Bacillus_phage(20.0%)	46	NA	NA
WP_012281187.1|1508968_1510591_+|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_012282593.1|1510885_1512085_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012282594.1|1512148_1513126_-	YpdA family putative bacillithiol disulfide reductase	NA	G3MA85	Bacillus_virus	23.2	4.6e-08
WP_012282596.1|1514368_1515241_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_041314961.1|1515316_1516975_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_012282598.1|1517001_1517484_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_012282599.1|1517608_1518604_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_083765181.1|1518635_1520366_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	31.6	5.6e-57
WP_012282601.1|1520515_1522054_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.9	2.0e-05
WP_012282602.1|1522329_1523592_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_012282603.1|1523591_1524092_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_012282604.1|1524342_1525413_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_012282605.1|1525712_1527308_+	citramalate synthase	NA	NA	NA	NA	NA
WP_012282607.1|1527542_1527920_-	small basic family protein	NA	NA	NA	NA	NA
WP_012282608.1|1528046_1528859_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_012282609.1|1528855_1529953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282610.1|1529977_1531660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282611.1|1531793_1533173_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_041313496.1|1533775_1535602_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	40.3	2.5e-108
WP_012282613.1|1535846_1537103_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012282614.1|1537291_1538224_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.6	3.6e-10
WP_012282616.1|1538577_1539126_+	NADH peroxidase	NA	NA	NA	NA	NA
WP_012282617.1|1539267_1540560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187147826.1|1541831_1543661_+	hypothetical protein	NA	D4P754	Rhodococcus_phage	27.0	1.3e-35
WP_012282621.1|1543960_1544632_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	9.4e-37
WP_012282622.1|1544634_1546080_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.8	2.0e-31
WP_012282623.1|1546492_1547308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041313504.1|1547468_1548719_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012282627.1|1548731_1551851_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012282628.1|1551925_1552555_-	DUF3793 family protein	NA	NA	NA	NA	NA
WP_012282629.1|1552843_1553524_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_012282630.1|1553616_1554957_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	46.4	4.0e-79
WP_012282631.1|1555565_1556966_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_012282632.1|1557010_1558228_-	reductive dehalogenase	NA	NA	NA	NA	NA
WP_041313507.1|1558354_1559176_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012282637.1|1561429_1561588_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_148207172.1|1561689_1562376_-	YjbE family putative metal transport protein	NA	W8EBD0	Pseudomonas_phage	39.3	1.1e-27
WP_012282640.1|1563095_1564193_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_187147756.1|1564230_1564476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148207100.1|1565952_1566999_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012282646.1|1566887_1567214_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012282647.1|1567615_1569265_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148207101.1|1569475_1569751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012281187.1|1569884_1571507_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_148207102.1|1571716_1572202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012282648.1|1572427_1574050_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	2802346	2859397	3075407	portal,transposase,holin,protease,capsid,head,tail,terminase	Erysipelothrix_phage(66.67%)	57	NA	NA
WP_012281191.1|2802346_2803690_-|transposase	IS1380-like element ISHmo1 family transposase	transposase	NA	NA	NA	NA
WP_083765251.1|2804001_2804607_-	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_148207139.1|2804689_2805256_-	RNA polymerase sigma factor SigZ	NA	NA	NA	NA	NA
WP_041313971.1|2805291_2805828_-	permease	NA	NA	NA	NA	NA
WP_041313973.1|2805824_2806304_-	permease	NA	NA	NA	NA	NA
WP_083765252.1|2806453_2806690_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_012283846.1|2806905_2808267_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083765253.1|2809005_2809860_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_012283848.1|2809867_2810827_-	DNA cytosine methyltransferase	NA	A0A1S5SAY6	Streptococcus_phage	27.7	6.3e-26
WP_012283849.1|2810895_2811357_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	58.3	2.8e-32
WP_012283850.1|2811387_2813919_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_012283851.1|2813938_2814934_-	AAA family ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	31.5	2.7e-16
WP_041313976.1|2814980_2815193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012283852.1|2815261_2816836_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	59.6	4.7e-172
WP_041313979.1|2816783_2817617_-	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_041315623.1|2817617_2819192_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	49.6	1.2e-143
WP_041315625.1|2819252_2819435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012283857.1|2819572_2820295_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	46.9	1.2e-48
WP_012283858.1|2820295_2820709_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.9	1.7e-49
WP_012283859.1|2820796_2823265_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	68.5	0.0e+00
WP_041313982.1|2823261_2823846_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	55.7	3.0e-55
WP_041315627.1|2824291_2824486_-	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	69.2	3.9e-20
WP_012283861.1|2824501_2827024_-|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	64.3	0.0e+00
WP_012283862.1|2827061_2827835_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	52.7	2.5e-73
WP_012283863.1|2827848_2830137_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	44.2	2.7e-14
WP_012283864.1|2830352_2830736_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	67.2	1.2e-39
WP_012283865.1|2830735_2831335_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	75.3	1.5e-81
WP_012283866.1|2831340_2831685_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	55.9	1.5e-30
WP_012283867.1|2831681_2832113_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	63.6	9.3e-46
WP_012283868.1|2832099_2832441_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	57.1	5.7e-30
WP_012283869.1|2832444_2832753_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	71.6	2.8e-36
WP_012283870.1|2832774_2833971_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	77.9	1.4e-176
WP_041315628.1|2833984_2834692_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q6DMU1	Streptococcus_phage	66.5	3.4e-77
WP_012283872.1|2834723_2835995_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.7	2.6e-184
WP_041313988.1|2835991_2837593_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	78.4	4.7e-252
WP_012283874.1|2837704_2838172_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_041313991.1|2838231_2839131_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	40.4	5.3e-51
WP_012283877.1|2839272_2839503_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	51.6	2.6e-10
WP_012283878.1|2839506_2839836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012283879.1|2839828_2840503_-	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	33.6	8.0e-28
WP_012283880.1|2840621_2841875_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	45.7	6.8e-97
WP_012283881.1|2841880_2843179_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	40.5	1.1e-76
WP_041313994.1|2843180_2843732_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	69.8	2.2e-71
WP_041313997.1|2843879_2844239_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	65.5	3.0e-42
WP_049754186.1|2844372_2844825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012283886.1|2845440_2847942_-	primase	NA	A0A1B1P7L5	Bacillus_phage	32.2	1.6e-41
WP_012283887.1|2847928_2848363_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	58.2	2.8e-42
WP_012283888.1|2848359_2850297_-	bifunctional 3'-5' exonuclease/DNA polymerase	NA	S5M8J1	Bacillus_phage	28.9	5.3e-40
WP_012283889.1|2850364_2851132_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	43.9	2.7e-48
WP_012283890.1|2851153_2851576_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	57.8	3.3e-35
WP_083765288.1|2851572_2853009_-	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	50.1	3.4e-124
WP_012283892.1|2852998_2853190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012283893.1|2853269_2853668_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012283897.1|2854406_2856623_-	DUF5301 domain-containing protein	NA	NA	NA	NA	NA
WP_012283898.1|2856622_2856991_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_041315636.1|2857159_2857762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012281426.1|2858035_2859397_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	2881062	2934377	3075407	portal,transposase,protease,holin,capsid,head,tail,terminase,integrase	Erysipelothrix_phage(83.33%)	56	2870832:2870848	2946120:2946136
2870832:2870848	attL	CAAACCCGGCAGGGCTA	NA	NA	NA	NA
WP_012283919.1|2881062_2881281_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	48.5	4.1e-10
WP_148207143.1|2881549_2881759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148207144.1|2881878_2882391_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012283921.1|2882537_2882720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012283922.1|2882703_2883036_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	37.3	3.5e-08
WP_012283923.1|2883028_2884150_+	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	58.3	1.4e-125
WP_012283924.1|2884163_2884742_+	DUF2815 family protein	NA	E4ZFK3	Streptococcus_phage	73.0	1.7e-74
WP_012283925.1|2884738_2886679_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	71.7	4.1e-282
WP_012283926.1|2886759_2886966_+	hypothetical protein	NA	A0A2K5B269	Erysipelothrix_phage	55.9	3.9e-18
WP_012283927.1|2886962_2887631_+	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	80.6	9.2e-101
WP_041314019.1|2887646_2888072_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	58.2	4.3e-43
WP_012283930.1|2888068_2890456_+	virulence-associated protein E	NA	A0A2K5B271	Erysipelothrix_phage	48.6	4.3e-209
WP_012283931.1|2890621_2890903_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	64.4	1.2e-25
WP_012283932.1|2890883_2892242_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	73.6	9.1e-172
WP_012283933.1|2892238_2892688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041314022.1|2892815_2893172_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	64.7	2.3e-42
WP_012283934.1|2893287_2893866_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	50.8	6.6e-47
WP_012283935.1|2893872_2895105_+	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	61.9	1.1e-144
WP_012283936.1|2895097_2897101_+	DNA cytosine methyltransferase	NA	A0A2K9V3X0	Faecalibacterium_phage	60.0	8.5e-33
WP_012283937.1|2897191_2897860_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	49.1	2.0e-50
WP_041314026.1|2897852_2898077_+	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	56.7	3.0e-11
WP_012281187.1|2898276_2899899_-|transposase	IS1182-like element ISHmo2 family transposase	transposase	NA	NA	NA	NA
WP_041314029.1|2900149_2900524_+	amidoligase family protein	NA	NA	NA	NA	NA
WP_012281343.1|2900562_2901588_-|integrase	site-specific integrase	integrase	S5M872	Bacillus_phage	23.9	1.4e-07
WP_148207041.1|2901584_2902574_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012281345.1|2902570_2903794_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012283940.1|2904611_2905076_+	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	36.0	2.0e-17
WP_041314032.1|2905068_2905254_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_041315645.1|2905343_2906945_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	83.1	1.6e-263
WP_012283943.1|2906941_2908201_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	73.5	6.5e-180
WP_012283944.1|2908197_2908911_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	66.7	9.3e-75
WP_012283945.1|2908931_2910131_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	80.1	9.2e-184
WP_012283946.1|2910150_2910471_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	82.0	1.9e-40
WP_012283947.1|2910473_2910806_+|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	58.5	7.2e-30
WP_012283948.1|2910798_2911230_+	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	65.0	3.2e-46
WP_012283949.1|2911226_2911571_+	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	54.1	6.7e-31
WP_012283950.1|2911573_2912164_+|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	73.6	5.3e-76
WP_012283951.1|2912178_2912562_+	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	72.2	2.4e-45
WP_012283953.1|2912835_2915394_+	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	80.0	6.0e-23
WP_012283954.1|2915407_2916181_+|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	52.7	5.0e-74
WP_012283955.1|2916185_2918705_+|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	61.6	5.6e-311
WP_012283956.1|2918717_2918912_+	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	53.8	7.9e-13
WP_041314035.1|2918921_2919491_+	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	51.4	5.9e-48
WP_012283958.1|2919487_2921956_+	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	66.9	0.0e+00
WP_012283959.1|2922034_2922466_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	68.1	3.4e-48
WP_012283960.1|2922936_2923635_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	43.4	2.9e-49
WP_012283961.1|2923783_2924005_+	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	51.9	2.3e-08
WP_012283962.1|2924055_2925618_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	52.8	7.6e-154
WP_012283963.1|2925618_2926050_+	hypothetical protein	NA	A0A2K5B2B3	Erysipelothrix_phage	45.3	1.8e-25
WP_012283964.1|2926036_2927605_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	56.9	2.4e-160
WP_041314041.1|2927674_2927998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012283966.1|2928000_2928684_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012283967.1|2929097_2930570_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.0	2.9e-62
WP_012283968.1|2930755_2932018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041314044.1|2932059_2933706_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083765254.1|2933702_2934377_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2946120:2946136	attR	TAGCCCTGCCGGGTTTG	NA	NA	NA	NA
>prophage 10
NC_010337	Heliobacterium modesticaldum Ice1, complete sequence	3075407	3053528	3066397	3075407		Synechococcus_phage(20.0%)	12	NA	NA
WP_012284075.1|3053528_3054386_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.9	4.3e-10
WP_041315690.1|3054608_3055016_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	33.6	1.3e-09
WP_041314082.1|3055189_3056485_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012284078.1|3056521_3058105_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	1.5e-77
WP_012284079.1|3058238_3058844_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.2	1.5e-28
WP_012284080.1|3058840_3059941_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FK46	Synechococcus_phage	44.7	3.7e-70
WP_012284081.1|3059950_3061396_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.6	2.1e-65
WP_012284082.1|3061418_3061757_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_041315691.1|3061760_3062477_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SSV5	Cyanophage	40.3	9.4e-43
WP_012284084.1|3062612_3063905_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	2.2e-21
WP_012284086.1|3064192_3064708_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.4	5.2e-27
WP_012284087.1|3065032_3066397_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.6	4.9e-48
