The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	253684	263414	2846746		Synechococcus_phage(37.5%)	9	NA	NA
WP_041637672.1|253684_254980_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.0	3.8e-18
WP_012573955.1|255045_255768_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	44.4	1.8e-46
WP_006323591.1|255755_256010_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	35.8	1.5e-06
WP_012573956.1|256006_256693_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012573957.1|256676_258899_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.6	1.2e-165
WP_041637674.1|258874_260302_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	2.7e-49
WP_012573959.1|260264_261302_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.9	1.6e-67
WP_012573960.1|261298_261901_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.4e-26
WP_012573961.1|261878_263414_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.3	6.6e-78
>prophage 3
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	661328	746104	2846746	coat,transposase,protease,capsid,terminase,tail,tRNA,head,portal	Geobacillus_virus(18.75%)	105	NA	NA
WP_041638010.1|661328_663953_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.9	5.7e-162
WP_012574302.1|664016_665321_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012574303.1|665379_668802_+	DUF5057 domain-containing protein	NA	A0A140XG62	Salmonella_phage	29.2	5.0e-17
WP_041638011.1|668820_669669_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012574305.1|669683_671321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012574306.1|671333_671903_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_041638012.1|671886_672477_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_193330548.1|672543_673752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041638019.1|673748_674495_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_041638020.1|674508_675753_+	VanW family protein	NA	NA	NA	NA	NA
WP_012574311.1|675749_677411_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_041638021.1|677421_678456_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_012574313.1|678462_679674_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_012574314.1|679749_680289_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_012574315.1|680329_681079_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_012574316.1|681091_682060_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_041638022.1|682043_682625_+	pilus assembly protein PilN	NA	NA	NA	NA	NA
WP_041638023.1|682621_683248_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_012574319.1|683261_683702_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_041639268.1|683807_684590_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_041638024.1|684701_685271_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012574322.1|685705_687112_-	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	63.2	4.7e-171
WP_041638025.1|687169_687802_-	helix-turn-helix domain-containing protein	NA	E5DV74	Deep-sea_thermophilic_phage	53.6	3.5e-57
WP_012574325.1|687973_688189_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167316060.1|688202_688361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574326.1|688338_688515_+	hypothetical protein	NA	A6M976	Geobacillus_virus	76.8	7.7e-15
WP_041638026.1|688561_688963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041638027.1|688974_689172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574329.1|689168_689933_+	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	41.7	2.6e-38
WP_012574330.1|690165_690429_+	hypothetical protein	NA	S6AVW9	Thermus_phage	44.8	1.2e-14
WP_041638029.1|690428_690653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574332.1|690649_690823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148205013.1|690935_691172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574334.1|691242_691560_+	VRR-NUC domain-containing protein	NA	A0A1B1P7M6	Bacillus_phage	46.2	1.9e-11
WP_041639270.1|691519_692725_+	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	28.0	3.7e-31
WP_012574336.1|692729_693623_+	YqaJ viral recombinase family protein	NA	NA	NA	NA	NA
WP_012574337.1|693624_694494_+	AAA family ATPase	NA	A0A0A1ENB5	Lactobacillus_phage	50.2	1.9e-61
WP_012574338.1|694545_695016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574339.1|695027_696716_+	DNA polymerase B	NA	A0A2H4J041	uncultured_Caudovirales_phage	33.6	2.9e-74
WP_012574340.1|696728_697238_+	phage-related protein, containing Zn-ribbon domain	NA	NA	NA	NA	NA
WP_012574341.1|697240_697630_+	dUTP diphosphatase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	67.6	9.6e-34
WP_012574342.1|697629_697863_+	hypothetical protein	NA	S6B9Y8	Thermus_phage	79.6	7.1e-16
WP_012574343.1|697867_699730_+	phage associated DNA primase	NA	A0A2H4JBE3	uncultured_Caudovirales_phage	30.9	1.2e-33
WP_012574344.1|700079_700580_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	66.5	7.2e-58
WP_167316061.1|700682_700838_+	hypothetical protein	NA	S6C472	Thermus_phage	58.8	7.5e-06
WP_041638031.1|700881_701178_+	HNH endonuclease	NA	Q0H266	Geobacillus_phage	70.7	1.2e-33
WP_041638032.1|701261_701618_+|terminase	P27 family phage terminase small subunit	terminase	Q0H265	Geobacillus_phage	91.5	2.0e-54
WP_012574347.1|701614_703339_+|terminase	terminase large subunit	terminase	Q0H264	Geobacillus_phage	90.9	0.0e+00
WP_148205014.1|703343_704540_+|portal	phage portal protein	portal	Q0H263	Geobacillus_phage	83.9	3.5e-199
WP_041638033.1|704523_705132_+|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	87.1	1.7e-93
WP_012574350.1|705094_706369_+|capsid	phage major capsid protein	capsid	Q0H261	Geobacillus_phage	90.3	8.0e-170
WP_012574351.1|706376_706562_+	hypothetical protein	NA	Q0H260	Geobacillus_phage	71.4	8.6e-17
WP_012574352.1|706561_706837_+	hypothetical protein	NA	A6XMJ8	Bacillus_virus	92.2	6.8e-42
WP_049753989.1|706856_707183_+	hypothetical protein	NA	A0A2I6UHP8	Bacillus_phage	33.6	4.3e-11
WP_012574354.1|707194_707500_+|head	phage head closure protein	head	A6XMK0	Bacillus_virus	82.2	8.9e-43
WP_041638034.1|707492_707876_+	HK97 gp10 family phage protein	NA	A6M956	Geobacillus_virus	65.4	2.6e-39
WP_041638035.1|707877_708198_+	hypothetical protein	NA	A6M957	Geobacillus_virus	84.0	6.9e-46
WP_012574357.1|708202_708781_+|tail	tail protein	tail	A6M958	Geobacillus_virus	77.6	1.2e-83
WP_012574358.1|708784_709132_+	hypothetical protein	NA	A6M959	Geobacillus_virus	59.6	4.0e-31
WP_167316062.1|709154_709316_+	hypothetical protein	NA	A6M960	Geobacillus_virus	57.9	2.9e-08
WP_012574359.1|709299_712251_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.0	4.7e-80
WP_012574360.1|712252_713116_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	46.2	1.1e-69
WP_049753993.1|713129_714755_+	hypothetical protein	NA	S6B1J7	Thermus_phage	47.4	1.3e-60
WP_012574362.1|714766_715150_+	hypothetical protein	NA	S6C455	Thermus_phage	76.0	8.8e-48
WP_012574363.1|715357_716503_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	42.5	1.5e-87
WP_012574364.1|716540_716759_+	hemolysin XhlA family protein	NA	A6M968	Geobacillus_virus	84.7	3.5e-25
WP_012574365.1|716755_717016_+	hypothetical protein	NA	E5DV67	Deep-sea_thermophilic_phage	91.7	1.3e-31
WP_012574366.1|717012_717654_+	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	55.3	9.9e-52
WP_012574367.1|717683_717944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638037.1|717940_718141_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012574369.1|718434_718638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012574370.1|718684_718855_+	hypothetical protein	NA	U5PZ86	Bacillus_phage	49.1	2.4e-05
WP_012574371.1|718987_720160_+	cell division protein FtsK	NA	A0A0A0RNH5	Bacillus_phage	54.8	6.3e-113
WP_049753995.1|720095_720704_+	replication-relaxation family protein	NA	A0A0U4II60	Bacillus_phage	39.7	2.9e-29
WP_080513055.1|720700_720790_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_006320433.1|721303_722326_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012574373.1|722345_723206_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012574374.1|723202_723727_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_041638038.1|723764_724457_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_006320437.1|724459_725266_+	septum site-determining protein MinD	NA	A0A0K2FLP4	Brevibacillus_phage	26.4	3.9e-05
WP_012574377.1|725353_726085_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012574378.1|726077_726941_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_032100208.1|727078_727387_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_006320440.1|727397_727733_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003396301.1|727746_728037_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012574380.1|728125_728671_+	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_006320445.1|728701_729988_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_041638040.1|730010_730451_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012574382.1|730465_731329_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_012574383.1|731341_731875_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_041638041.1|731871_733008_-	IscS subfamily cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	28.6	1.0e-35
WP_012574385.1|733100_734633_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_041638042.1|734629_735460_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_012574387.1|735472_736576_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_012574388.1|736711_737644_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_012574389.1|737718_738459_+	NAD(+) synthase	NA	A0A0K0KVL1	Prochlorococcus_phage	37.1	7.2e-30
WP_041638043.1|738537_739233_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_012574391.1|739317_740055_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012574392.1|740104_740569_+	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012574393.1|740662_741256_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_041638044.1|741268_742273_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	2.0e-06
WP_012574395.1|742344_743520_+|transposase	transposase	transposase	Q4Z968	Staphylococcus_phage	48.7	1.2e-95
WP_012574396.1|743681_743888_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_041638045.1|743912_744944_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_012574398.1|744964_746104_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.4	2.5e-82
>prophage 4
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	1017794	1023515	2846746		Staphylococcus_phage(66.67%)	8	NA	NA
WP_012574660.1|1017794_1018871_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.8	1.2e-62
WP_041639300.1|1018876_1019515_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.8	1.3e-43
WP_041638184.1|1019520_1020714_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.6	9.3e-120
WP_006318211.1|1020726_1021191_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.7	3.2e-44
WP_006318213.1|1021273_1021618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012574663.1|1021624_1022152_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_041639302.1|1022179_1022941_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	6.1e-08
WP_080513062.1|1022933_1023515_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	1.5e-14
>prophage 6
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	1607336	1657687	2846746	tail,transposase	Lactococcus_phage(16.67%)	45	NA	NA
WP_041638476.1|1607336_1607801_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012575199.1|1607845_1608235_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_041638478.1|1608231_1608483_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012575201.1|1608694_1609066_-	iron chaperone	NA	NA	NA	NA	NA
WP_041638480.1|1609226_1610201_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.2	2.1e-13
WP_012575203.1|1610197_1610584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049754161.1|1610608_1611550_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012575205.1|1611739_1612132_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_041638482.1|1612161_1612623_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_041638484.1|1612694_1613474_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041638485.1|1613634_1614204_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_012575209.1|1614251_1614959_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_012575210.1|1615211_1615589_-	VOC family protein	NA	NA	NA	NA	NA
WP_012575211.1|1615687_1616827_-	virulence factor	NA	NA	NA	NA	NA
WP_041638486.1|1616963_1617392_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041639336.1|1617444_1617927_-	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	30.4	1.5e-07
WP_012575214.1|1618068_1620192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638488.1|1620255_1620771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638490.1|1622208_1623492_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041638491.1|1623858_1624155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012575219.1|1624158_1624653_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_041638492.1|1625026_1625335_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012575222.1|1626447_1628415_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012575224.1|1628809_1630120_-	DUF3895 domain-containing protein	NA	NA	NA	NA	NA
WP_012575225.1|1630307_1632017_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012575226.1|1632667_1634617_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_012575227.1|1634652_1635012_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_041638499.1|1635334_1636189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012575032.1|1637017_1637530_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.5	8.3e-09
WP_012575033.1|1637547_1638078_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167316068.1|1639537_1639687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012575232.1|1640630_1641077_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041638501.1|1641475_1643179_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_167316069.1|1643269_1643443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638502.1|1643533_1645024_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041638504.1|1645296_1646745_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_012575236.1|1647241_1648357_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.9	2.4e-24
WP_041638505.1|1648387_1649050_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_012574977.1|1649334_1650564_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.7	7.7e-85
WP_041638507.1|1650986_1651361_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012575239.1|1651381_1652851_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.2	4.8e-142
WP_012575240.1|1653075_1653492_+	universal stress protein	NA	NA	NA	NA	NA
WP_012575242.1|1653673_1654678_-	CapA family protein	NA	NA	NA	NA	NA
WP_049754163.1|1654767_1655988_-	GntP family permease	NA	NA	NA	NA	NA
WP_041638511.1|1656553_1657687_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	1992128	2049736	2846746	integrase,transposase	uncultured_Caudovirales_phage(18.18%)	50	2034885:2034944	2050261:2050342
WP_012575559.1|1992128_1993232_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	50.4	1.8e-85
WP_041638689.1|1993726_1994005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012575561.1|1993997_1995257_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041638691.1|1995455_1997183_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_012575564.1|1997326_1997482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012575565.1|1997478_1997619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638693.1|1997702_1998044_+	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_012575567.1|1998185_1999001_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_012575568.1|1999013_1999904_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012575569.1|2000007_2001276_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012575570.1|2001330_2002020_-	beta-phosphoglucomutase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.8	7.7e-10
WP_041638697.1|2002016_2004359_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_041639346.1|2004429_2005446_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_148205054.1|2005682_2007431_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.8	2.1e-11
WP_012575574.1|2007505_2008609_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012575575.1|2008704_2010117_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_012575576.1|2010113_2011457_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_041638699.1|2011468_2012278_-	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	55.4	2.1e-30
WP_041638701.1|2012362_2012866_-	ferritin	NA	NA	NA	NA	NA
WP_041638703.1|2012921_2013707_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.4	5.3e-31
WP_012575580.1|2013956_2015372_-	amino acid permease	NA	NA	NA	NA	NA
WP_012575581.1|2015464_2016736_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_012575582.1|2016854_2018021_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_041638705.1|2018029_2019025_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	38.1	3.0e-47
WP_012575584.1|2019021_2020734_-	membrane protein	NA	NA	NA	NA	NA
WP_012575585.1|2020785_2021349_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012575586.1|2021509_2022145_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_148205032.1|2022358_2022889_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_012575589.1|2023371_2024472_-	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_041638707.1|2024468_2025551_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_012575591.1|2025796_2027212_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_012575592.1|2027244_2028654_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_041638709.1|2028654_2029665_-	asparaginase	NA	NA	NA	NA	NA
WP_041638711.1|2029848_2030181_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	33.6	1.0e-07
WP_012575595.1|2030195_2030957_-	serine/threonine-protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	27.8	1.8e-15
WP_012575596.1|2030956_2031130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638714.1|2031258_2031948_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_012575598.1|2031937_2032240_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_041638716.1|2032276_2033155_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012575600.1|2033898_2034483_-	hypothetical protein	NA	NA	NA	NA	NA
2034885:2034944	attL	AAAAATCCCTTGAAGCCTTATGGCTCAAGGGATTTCACTTGATGATTCCGACTGGGCTCG	NA	NA	NA	NA
WP_012576225.1|2036263_2037445_+|transposase	IS701-like element ISAfl1 family transposase	transposase	NA	NA	NA	NA
WP_012575601.1|2037541_2038672_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_012575602.1|2038743_2041806_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.5	4.7e-67
WP_012575603.1|2041841_2043092_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	27.2	5.9e-16
WP_012575604.1|2043088_2044636_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_012575605.1|2044961_2045840_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012575606.1|2045935_2047114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041637668.1|2047185_2048634_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_148205033.1|2048775_2049372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080513108.1|2049493_2049736_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	39.7	8.1e-07
2050261:2050342	attR	AAAAATCCCTTGAAGCCTTATGGCTCAAGGGATTTCACTTGATGATTCCGACTGGGCTCGAACCAGCGACCTCCACCCTGTC	NA	NA	NA	NA
>prophage 8
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	2190660	2241945	2846746	bacteriocin,transposase	Clostridium_botulinum_C_phage(16.67%)	43	NA	NA
WP_012575746.1|2190660_2191821_-|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	56.1	1.4e-117
WP_012575747.1|2191817_2192414_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	68.5	1.5e-78
WP_012575748.1|2193759_2194377_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_012575749.1|2194393_2194543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041638823.1|2194630_2195161_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012575751.1|2195175_2195691_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.9	1.9e-08
WP_041639361.1|2195727_2196021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012575754.1|2197027_2197525_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041638825.1|2197552_2199145_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	2.8e-39
WP_009361956.1|2199284_2199509_+	spore germination protein	NA	NA	NA	NA	NA
WP_012575757.1|2199512_2199734_+	spore germination protein	NA	NA	NA	NA	NA
WP_006319008.1|2199746_2199959_+	spore germination protein GerPB	NA	NA	NA	NA	NA
WP_012575758.1|2200031_2200616_+	spore germination protein GerPC	NA	NA	NA	NA	NA
WP_012575759.1|2200612_2200810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041638828.1|2200806_2201202_+	spore germination protein GerPE	NA	NA	NA	NA	NA
WP_012575761.1|2201176_2201398_+	spore germination protein	NA	NA	NA	NA	NA
WP_012575762.1|2201394_2201673_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012575763.1|2201685_2205045_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	24.1	6.4e-09
WP_041638831.1|2205041_2206202_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_012575765.1|2206203_2209833_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.6	1.4e-20
WP_041638832.1|2209837_2213302_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_012575767.1|2213318_2213921_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_041638835.1|2214359_2215478_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	45.0	2.6e-87
WP_041638839.1|2216110_2218096_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012575770.1|2218096_2219908_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	24.0	1.7e-32
WP_041639364.1|2220258_2221989_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_012575772.1|2222125_2222371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012575773.1|2222374_2223499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012575774.1|2223879_2225160_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_012575775.1|2225378_2226626_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012575776.1|2226769_2227360_+	SCO family protein	NA	NA	NA	NA	NA
WP_012575777.1|2227446_2229558_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.2	6.5e-07
WP_148205034.1|2229575_2229938_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012575779.1|2230066_2231434_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_148205055.1|2231543_2232053_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012575781.1|2232068_2233289_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041638842.1|2233390_2235763_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041638844.1|2235775_2236570_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	7.8e-14
WP_041638846.1|2236535_2237510_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080513080.1|2237527_2238514_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041638848.1|2238619_2240170_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.3	2.8e-52
WP_080513081.1|2240417_2240642_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_148205035.1|2240823_2241945_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	38.0	1.5e-58
>prophage 9
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	2308086	2356341	2846746	tRNA,integrase,transposase,protease	Streptococcus_phage(33.33%)	42	2331223:2331240	2339087:2339104
WP_012575858.1|2308086_2309052_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_012575859.1|2309048_2309981_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_041638899.1|2309985_2310444_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.7	3.3e-25
WP_012575861.1|2310544_2310796_+	YhdB family protein	NA	NA	NA	NA	NA
WP_041638900.1|2310824_2311532_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041638902.1|2311603_2313343_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.8	4.6e-160
WP_041638904.1|2313654_2314086_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	33.6	1.5e-11
WP_012575865.1|2314213_2314642_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_012575866.1|2314638_2315103_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006319180.1|2315127_2315520_-	YhcU family protein	NA	NA	NA	NA	NA
WP_041638907.1|2315625_2316537_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_012575869.1|2316615_2318103_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.2	2.1e-129
WP_041639368.1|2318097_2319435_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012575871.1|2319481_2320168_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_012575872.1|2320322_2321456_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012575873.1|2321509_2321737_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_006319186.1|2321819_2322596_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006319187.1|2322644_2322872_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_012575874.1|2322883_2323279_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_012575875.1|2323275_2323857_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_035048092.1|2323868_2324168_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_041639369.1|2324312_2325473_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.8	4.9e-25
WP_041638911.1|2325692_2327588_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.6	4.3e-103
WP_012575879.1|2327869_2328352_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_041638915.1|2328354_2329212_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_012575881.1|2329270_2330407_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_049754096.1|2330467_2331130_+|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
2331223:2331240	attL	TGGGAATCGAACCCACGA	NA	NA	NA	NA
WP_148205037.1|2331641_2331833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012575883.1|2331915_2332944_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_148205038.1|2333034_2333868_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_012575885.1|2333888_2334815_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041639370.1|2334875_2336165_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041638917.1|2336348_2337701_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	1.3e-69
WP_041638919.1|2338133_2338406_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_049754097.1|2345416_2346331_-	DMT family transporter	NA	NA	NA	NA	NA
2339087:2339104	attR	TGGGAATCGAACCCACGA	NA	NA	NA	NA
WP_003398734.1|2346367_2347045_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	3.3e-13
WP_080513084.1|2347738_2348005_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012575892.1|2348227_2349565_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004892278.1|2349643_2350114_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041638924.1|2352848_2353037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041639373.1|2353578_2354943_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012575894.1|2355105_2356341_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	24.0	4.3e-11
>prophage 10
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	2596555	2611870	2846746	bacteriocin,integrase,transposase,protease	Bacillus_phage(66.67%)	15	2607738:2607751	2612844:2612857
WP_012576101.1|2596555_2597278_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012576102.1|2597288_2598947_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012576103.1|2598959_2601155_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.3	2.9e-58
WP_075039767.1|2601633_2601876_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_128713019.1|2601953_2602187_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_012576108.1|2602688_2602898_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_019417539.1|2603126_2604104_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_012576110.1|2604100_2605438_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012576111.1|2605451_2606093_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012576112.1|2606945_2607380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012576113.1|2607624_2608005_+	hypothetical protein	NA	NA	NA	NA	NA
2607738:2607751	attL	AAATAAACATCCGA	NA	NA	NA	NA
WP_049754113.1|2610055_2610454_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_035067544.1|2610410_2610653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167316078.1|2611132_2611474_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.9	5.9e-19
WP_080513092.1|2611480_2611870_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	51.7	2.5e-26
2612844:2612857	attR	AAATAAACATCCGA	NA	NA	NA	NA
>prophage 11
NC_011567	Anoxybacillus flavithermus WK1, complete sequence	2846746	2731825	2763779	2846746	protease,transposase,tRNA,coat	Bacillus_virus(25.0%)	35	NA	NA
WP_012576219.1|2731825_2733496_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012576220.1|2733492_2733930_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_012576221.1|2734034_2735252_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	44.8	8.6e-97
WP_012576222.1|2735248_2735851_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	44.4	2.8e-40
WP_012576223.1|2736276_2736735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012576224.1|2736785_2737358_+	VanZ family protein	NA	NA	NA	NA	NA
WP_012576225.1|2737453_2738635_+|transposase	IS701-like element ISAfl1 family transposase	transposase	NA	NA	NA	NA
WP_004893113.1|2738826_2739699_-	agmatinase	NA	NA	NA	NA	NA
WP_026011432.1|2739711_2740539_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_041639168.1|2740714_2742766_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_012576228.1|2742904_2743411_-	YwhD family protein	NA	NA	NA	NA	NA
WP_041639170.1|2743428_2744097_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003397075.1|2744227_2744416_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_148205044.1|2744426_2744939_-	YwgA family protein	NA	NA	NA	NA	NA
WP_012576232.1|2744951_2746274_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.3	1.4e-23
WP_003397078.1|2746371_2746596_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_041639171.1|2746741_2747413_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	47.0	3.3e-05
WP_041639174.1|2747439_2748267_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_012576236.1|2748263_2749247_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012576237.1|2749443_2750007_+	DedA family protein	NA	NA	NA	NA	NA
WP_035020173.1|2750074_2750821_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_012576238.1|2750942_2751365_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_006321023.1|2751379_2751823_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_012576239.1|2751849_2752212_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_012576240.1|2752223_2752460_-	YwdI family protein	NA	NA	NA	NA	NA
WP_012576241.1|2752558_2754175_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_041639176.1|2754192_2755188_-	potassium channel protein	NA	NA	NA	NA	NA
WP_041639178.1|2755365_2756040_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	47.7	5.5e-53
WP_012576245.1|2756098_2757481_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	29.7	2.4e-50
WP_012576246.1|2757780_2759310_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.1	1.1e-19
WP_012576247.1|2759323_2759887_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_012576248.1|2760123_2760357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041639180.1|2760368_2761184_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012576250.1|2761245_2762442_-	MFS transporter	NA	NA	NA	NA	NA
WP_041639182.1|2762603_2763779_-|transposase	transposase	transposase	D2XQ03	Bacillus_virus	51.4	1.1e-99
