The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010159	Yersinia pestis Angola, complete sequence	4504254	58144	118754	4504254	transposase,tRNA,protease	Bacillus_phage(17.65%)	58	NA	NA
WP_002213775.1|58144_58603_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208996.1|58845_59493_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002208995.1|59627_60224_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_011566231.1|60345_60804_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.0e-51
WP_002208993.1|60781_61999_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.1e-46
WP_002208992.1|62192_62861_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002208991.1|63123_63360_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002208990.1|63371_63539_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002208989.1|63621_64431_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.7	6.7e-21
WP_002208988.1|64436_64916_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.7	1.0e-29
WP_002208987.1|64912_65695_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_172601538.1|65695_66970_-	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_002208985.1|67392_68358_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_002208984.1|68357_69422_-	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_002208983.1|69452_70385_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	1.3e-31
WP_002208982.1|70630_71842_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	4.6e-34
WP_002208981.1|71851_72877_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	8.0e-19
WP_002208980.1|73972_75343_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.7	2.4e-10
WP_002208979.1|75352_76900_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002208978.1|77296_77731_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002208977.1|77849_78098_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	5.4e-14
WP_002208976.1|78185_78662_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_002208975.1|78661_79681_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002208974.1|79946_80768_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_002208973.1|80890_81379_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000255944.1|82470_83493_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_012228794.1|83492_84272_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.9e-138
WP_002208971.1|84639_86016_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
WP_002208970.1|86012_86711_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208969.1|86884_87373_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_002353252.1|88089_89010_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002208967.1|89571_90474_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002208966.1|90691_91675_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208965.1|91895_92885_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002218867.1|93134_93911_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208963.1|94028_95456_-	anion permease	NA	NA	NA	NA	NA
WP_002208962.1|95521_96235_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208961.1|96231_96969_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208960.1|97105_98341_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208959.1|98572_99340_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208958.1|99468_100083_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_002208957.1|100251_100686_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208956.1|101007_101754_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_041854751.1|101908_102919_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_002218876.1|103155_104679_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002208954.1|104855_105704_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208953.1|106331_106571_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002213759.1|106778_107237_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002230357.1|107607_109722_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	2.8e-34
WP_002208949.1|109714_111007_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002215873.1|111219_111459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228141.1|112088_112673_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|112789_113275_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|113416_114334_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|114569_115901_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|115971_116496_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|116595_117441_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002213775.1|118295_118754_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_010159	Yersinia pestis Angola, complete sequence	4504254	123561	211826	4504254	transposase,plate,tRNA,protease	Escherichia_phage(25.0%)	54	NA	NA
WP_002209474.1|123561_124665_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_002228170.1|125144_127022_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	24.8	1.3e-11
WP_002228171.1|126966_127830_+	glutamate racemase	NA	NA	NA	NA	NA
WP_086016626.1|133819_134918_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_001297096.1|135583_136363_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|136362_137385_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215609.1|138047_138746_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|138878_139700_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|139987_140542_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|140538_140829_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|140928_141522_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|141514_142645_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002209743.1|142813_144022_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_041854754.1|144157_153490_-	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_011566213.1|153985_154231_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002228656.1|154188_154719_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002209989.1|154830_155757_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|155867_156194_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|156193_156913_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_041854841.1|157250_158366_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|158543_158816_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|158998_160075_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|160356_161457_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|161545_163579_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_012228890.1|163661_164642_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|164674_166174_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|166219_167179_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|167734_169897_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|171225_171861_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|172468_173166_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|173261_174029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|174015_176313_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012228901.1|176328_178677_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_012228902.1|178673_181322_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_012228903.1|181739_182231_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_041854755.1|182234_183971_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|183970_184657_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002213011.1|184653_186006_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_041854756.1|186017_187562_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012228906.1|187604_188105_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|190379_190775_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|191225_191876_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215903.1|193050_193701_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002211655.1|193681_194425_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|194704_195913_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_012228910.1|196309_197650_+	peptidase	NA	NA	NA	NA	NA
WP_002211652.1|198026_198860_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_002228661.1|199007_199202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211651.1|199149_200373_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211649.1|202267_203218_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002211648.1|203214_204963_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_012228914.1|206360_208541_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002211645.1|208799_210224_-	MFS transporter	NA	NA	NA	NA	NA
WP_100067904.1|210471_211826_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 3
NC_010159	Yersinia pestis Angola, complete sequence	4504254	619793	689269	4504254	transposase,tRNA,protease	Escherichia_phage(25.0%)	54	NA	NA
WP_002209743.1|619793_621002_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209017.1|621095_621509_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_002209018.1|621647_623024_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_041854762.1|623079_624369_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002209020.1|624462_625410_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.8	1.2e-05
WP_002209021.1|625434_625947_-	peptide deformylase	NA	NA	NA	NA	NA
WP_002213759.1|626929_627388_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209023.1|627885_628359_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_002228134.1|628399_628939_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002209025.1|628940_629513_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	30.2	4.9e-10
WP_002209026.1|629521_630343_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002230372.1|630397_630940_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000255944.1|637320_638343_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|638342_639122_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002212076.1|639635_640565_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|640985_642584_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|642630_643938_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002209054.1|644246_645461_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_002209055.1|645457_645727_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_002209056.1|645804_646788_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209057.1|646957_648244_+	transporter	NA	NA	NA	NA	NA
WP_002215044.1|648289_649471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_002209058.1|649611_650412_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.9e-15
WP_002209059.1|650404_651409_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002209060.1|651405_652245_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209061.1|652241_653279_-	hemin-degrading factor	NA	NA	NA	NA	NA
WP_002209062.1|653397_655428_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_002230445.1|655557_655749_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_002209064.1|655834_656485_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002209065.1|656518_657028_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_041854763.1|657060_658359_-	heme anaerobic degradation radical SAM methyltransferase ChuW/HutW	NA	NA	NA	NA	NA
WP_002209067.1|658709_659510_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002209068.1|659824_660313_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_002209069.1|660710_661670_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_002209070.1|661669_662749_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	36.1	3.7e-43
WP_002209071.1|662741_663554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209072.1|663546_664683_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	4.8e-33
WP_012229088.1|664694_665753_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_002228131.1|666028_666622_+	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	34.5	1.2e-11
WP_002209075.1|666621_667806_+	tellurite resistance protein	NA	NA	NA	NA	NA
WP_002209076.1|667838_668294_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_002209077.1|668315_669353_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	48.8	2.9e-77
WP_002209078.1|669416_669995_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	4.9e-34
WP_002209079.1|670178_670754_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.0	1.6e-29
WP_002213759.1|670945_671404_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209080.1|672176_672815_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_012229089.1|673065_675444_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209082.1|675515_676259_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002214631.1|676269_676524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041854764.1|677714_679034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209085.1|680042_682100_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_002209087.1|687060_687585_+	chorismate lyase	NA	NA	NA	NA	NA
WP_002209088.1|687750_688617_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_002213775.1|688810_689269_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_010159	Yersinia pestis Angola, complete sequence	4504254	870936	931145	4504254	transposase,plate,tRNA	uncultured_virus(16.67%)	49	NA	NA
WP_002213759.1|870936_871395_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209200.1|871608_874695_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	18.9	3.5e-17
WP_002209199.1|874694_875777_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002209198.1|875828_876062_-	LapA family protein	NA	NA	NA	NA	NA
WP_002209197.1|876871_878104_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002209196.1|878151_879315_-	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
WP_012229133.1|879660_881253_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_002221620.1|882448_882655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209192.1|882764_884348_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	2.3e-25
WP_002209191.1|884341_885397_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_002209190.1|885393_886395_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_002209189.1|886453_887473_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_002209188.1|887528_888404_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_002209186.1|888467_888758_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_002209184.1|889080_889572_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_002228120.1|889633_892192_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.3	5.2e-11
WP_012229134.1|892556_893651_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002209181.1|893789_894110_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_002209180.1|894202_894547_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_002209179.1|894539_895415_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209178.1|895416_895953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209177.1|896658_897855_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_002209176.1|897865_898912_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209174.1|899057_900212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209173.1|900208_901597_-	ATPase involved in DNA repair	NA	NA	NA	NA	NA
WP_002209172.1|901661_901859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525507.1|902009_902348_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209743.1|902780_903989_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209461.1|904395_904743_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002222284.1|904823_905564_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209459.1|905602_906151_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002209458.1|906172_906421_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209456.1|906648_908010_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209455.1|908175_908967_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001297096.1|909810_910590_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|910589_911612_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209453.1|912366_912882_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002209452.1|913049_914648_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209451.1|914691_915120_-	DedA family protein	NA	NA	NA	NA	NA
WP_002209450.1|915116_915683_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209449.1|916935_917121_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209448.1|917370_919998_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209743.1|920328_921537_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209446.1|922154_923225_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209445.1|923339_923828_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_002209444.1|924143_925484_+	MFS transporter	NA	NA	NA	NA	NA
WP_002209443.1|925731_926676_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209441.1|926897_928322_-	L-fucose/L-arabinose isomerase family protein	NA	NA	NA	NA	NA
WP_100067904.1|929790_931145_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 6
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1173134	1228611	4504254	transposase,protease,tail	uncultured_Mediterranean_phage(18.18%)	50	NA	NA
WP_002216203.1|1173134_1173650_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_012229216.1|1173655_1174297_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|1174476_1174674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|1174670_1175063_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|1175077_1175506_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|1175819_1176947_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|1177170_1177575_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|1177845_1179219_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|1179335_1179794_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|1180019_1181108_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|1181288_1182551_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|1182691_1182946_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|1183092_1183395_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|1183430_1184054_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|1184066_1184624_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|1184628_1185411_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|1185628_1186447_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|1186711_1187686_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|1187796_1188783_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|1189031_1189595_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|1189591_1190155_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|1190138_1190684_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|1190690_1191416_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_012229232.1|1191477_1192911_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|1193339_1193822_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|1194127_1194982_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|1194978_1195251_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|1195588_1196524_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|1196535_1197000_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|1197137_1197524_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|1197822_1198299_+	PliI family lysozyme inhibitor of I-type lysozyme	NA	NA	NA	NA	NA
WP_002210106.1|1198532_1199486_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|1199896_1201312_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|1201406_1203074_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|1203426_1203837_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|1204076_1204463_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|1204670_1205315_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_012229239.1|1205563_1206904_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|1207084_1207633_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|1207744_1208026_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|1208030_1208504_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|1210439_1212395_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|1212396_1213332_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|1213339_1213543_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|1213845_1214757_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|1215017_1215884_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|1216119_1218621_+	toxin	NA	NA	NA	NA	NA
WP_012229241.1|1218661_1222255_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|1222311_1226802_+	toxin	NA	NA	NA	NA	NA
WP_012229243.1|1227141_1228611_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	3.7e-179
>prophage 7
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1269002	1342913	4504254	transposase,tRNA,integrase,protease	Bacillus_virus(12.5%)	58	1275438:1275454	1346774:1346790
WP_042666681.1|1269002_1269461_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210051.1|1269865_1271041_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_002210050.1|1271147_1272494_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_002228699.1|1272747_1273599_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_012229272.1|1273788_1274394_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012229273.1|1274390_1276028_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
1275438:1275454	attL	CCAGCGATCTTCATGGC	NA	NA	NA	NA
WP_002210046.1|1276046_1277000_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012229276.1|1277001_1277946_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210044.1|1277938_1279435_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
WP_012229279.1|1279638_1280628_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210042.1|1281421_1282342_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
WP_002210041.1|1282493_1283681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215816.1|1283898_1285548_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_002210039.1|1285896_1287252_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
WP_002210038.1|1287705_1287909_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012229280.1|1288516_1289332_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	2.6e-28
WP_012229282.1|1289471_1290947_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002209166.1|1291080_1293144_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_002209167.1|1293140_1294457_+	McrC family protein	NA	NA	NA	NA	NA
WP_002209169.1|1295480_1296806_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002230553.1|1296855_1297578_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002209743.1|1298948_1300157_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215988.1|1301580_1302294_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002208592.1|1302673_1303816_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002208591.1|1305282_1306296_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012229288.1|1307439_1308405_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.6	4.8e-82
WP_002208590.1|1308584_1309991_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	5.4e-50
WP_002208589.1|1309993_1310737_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.8	8.6e-07
WP_002208588.1|1310741_1312115_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.1	8.1e-35
WP_002208587.1|1312162_1313314_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_002208586.1|1313517_1314822_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_012229292.1|1314918_1316607_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002208584.1|1316841_1318056_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208583.1|1320077_1320317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208581.1|1320653_1321133_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|1321397_1322207_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_012229295.1|1322727_1325595_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.7	8.5e-111
WP_002208578.1|1325801_1326221_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|1326329_1326779_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|1326781_1327696_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|1327890_1328760_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|1328836_1329613_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041854772.1|1329999_1330635_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_012229298.1|1330605_1331292_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.0e-30
WP_002208571.1|1331288_1333718_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|1333761_1334826_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|1334822_1335347_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|1335622_1336345_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|1336355_1336850_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|1337060_1338446_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213759.1|1338772_1339231_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|1339377_1339590_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|1339604_1340471_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_041854773.1|1340826_1341009_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|1341267_1341468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229308.1|1341581_1342229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|1342213_1342552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|1342634_1342913_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
1346774:1346790	attR	GCCATGAAGATCGCTGG	NA	NA	NA	NA
>prophage 8
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1358126	1429472	4504254	transposase,tRNA,integrase,protease	Escherichia_phage(10.53%)	60	1364758:1364772	1434732:1434746
WP_002209092.1|1358126_1359164_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_002209093.1|1359679_1359898_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_012228761.1|1360551_1362027_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_071588557.1|1362120_1362729_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002210824.1|1362731_1363385_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_011171779.1|1363452_1366326_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
1364758:1364772	attL	ATTATTCATTGCCGT	NA	NA	NA	NA
WP_012229320.1|1366513_1369171_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	3.9e-102
WP_002210820.1|1369432_1370161_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|1370654_1372943_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|1373105_1374236_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|1374239_1374497_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|1374531_1375041_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|1375098_1376292_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|1376906_1378115_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|1378371_1378914_-	YfaZ family protein	NA	NA	NA	NA	NA
WP_012229321.1|1379274_1380714_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	8.4e-99
WP_002210810.1|1380781_1382962_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|1383231_1384347_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|1384758_1385649_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|1385773_1385977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210805.1|1386077_1388384_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_002210804.1|1388453_1389788_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002210802.1|1391074_1392013_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002210801.1|1392009_1393164_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210799.1|1395092_1395947_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|1396073_1397489_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|1397512_1398370_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_016604820.1|1398484_1399180_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	4.1e-11
WP_002210795.1|1399273_1400110_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_002210794.1|1400106_1401183_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_012229331.1|1401182_1402784_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|1402907_1404176_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|1404617_1405091_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|1405336_1406218_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|1406220_1407081_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210788.1|1407183_1408113_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|1408149_1408986_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|1409193_1409442_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|1409626_1410730_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002214185.1|1411042_1411384_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|1411409_1411949_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_012229332.1|1412158_1413871_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|1413991_1414927_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|1415265_1415445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|1415518_1416457_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|1416648_1417578_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|1417992_1418451_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002215951.1|1418905_1419223_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|1419228_1419543_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|1419891_1420980_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|1420976_1421936_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|1421928_1422471_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|1422470_1422671_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002210710.1|1422663_1423551_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_041854778.1|1423572_1423896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215946.1|1424358_1424586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041854779.1|1424747_1426418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210712.1|1426468_1427557_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002210713.1|1427635_1428835_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_041854780.1|1429058_1429472_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
1434732:1434746	attR	ATTATTCATTGCCGT	NA	NA	NA	NA
>prophage 9
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1469654	1537671	4504254	coat,plate,tail,transposase,protease	Escherichia_phage(13.04%)	62	NA	NA
WP_002210751.1|1469654_1470473_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210753.1|1470689_1472180_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210754.1|1472289_1473081_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002217291.1|1473329_1473482_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210756.1|1473716_1474496_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012229365.1|1474495_1475191_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210758.1|1475184_1476264_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210759.1|1476319_1477141_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002220188.1|1478616_1479897_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210762.1|1479995_1481033_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210763.1|1481032_1482184_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210764.1|1482167_1482971_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002216554.1|1482963_1483686_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210766.1|1483818_1484529_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002210767.1|1485623_1487639_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210768.1|1487930_1488176_+	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210769.1|1488306_1489230_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210771.1|1489761_1490742_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210772.1|1490842_1491322_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210773.1|1491318_1491564_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210774.1|1491566_1492019_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210775.1|1492161_1492872_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002213759.1|1493106_1493565_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_012229373.1|1493966_1495442_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.0e-181
WP_002210825.1|1497613_1498768_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1499878_1500994_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002228026.1|1501733_1502900_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1503174_1504701_-	MFS transporter	NA	NA	NA	NA	NA
WP_002230695.1|1505077_1506106_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1506179_1507967_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1508403_1509339_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1509510_1509753_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1509958_1510681_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1510954_1511434_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1511644_1512949_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1513657_1514470_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1514445_1515240_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1515871_1516162_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1516207_1516825_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1516829_1517024_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1517020_1518529_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1518550_1518919_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|1518920_1519220_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1519340_1520834_+|coat	coat protein	coat	NA	NA	NA	NA
WP_012229392.1|1521100_1522507_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1522503_1523559_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_012229395.1|1523574_1524171_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|1524167_1524623_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1524626_1525763_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1525759_1526020_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1526016_1526364_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_012229397.1|1526460_1527240_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	51.9	1.0e-50
WP_002208843.1|1527537_1528278_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012229399.1|1528568_1530005_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|1530130_1530493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|1531192_1531681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|1531693_1532842_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|1533198_1533582_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|1533812_1535609_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|1535636_1535864_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|1536041_1537046_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213759.1|1537212_1537671_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1649736	1681376	4504254	transposase,protease,tRNA	uncultured_Mediterranean_phage(18.18%)	25	NA	NA
WP_002211349.1|1649736_1650057_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002213759.1|1652635_1653094_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211347.1|1653465_1653684_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|1653849_1654560_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|1654778_1656503_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_041854782.1|1656505_1658272_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	6.8e-26
WP_002213759.1|1658752_1659211_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|1659463_1659922_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211341.1|1660152_1661115_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|1661881_1662376_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012229446.1|1662498_1666398_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|1666590_1667199_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|1667209_1668553_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|1668794_1670087_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002211334.1|1671642_1672377_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|1673363_1674038_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002213759.1|1674204_1674663_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211095.1|1675067_1675409_-	YebY family protein	NA	NA	NA	NA	NA
WP_002211094.1|1675505_1676390_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_002211093.1|1676392_1676779_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_042666694.1|1676992_1677223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211092.1|1677255_1677765_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_002211091.1|1678165_1678396_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
WP_002211090.1|1678455_1679406_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_012229373.1|1679900_1681376_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.0e-181
>prophage 11
NC_010159	Yersinia pestis Angola, complete sequence	4504254	1965413	2081782	4504254	transposase,plate,protease,tRNA	Escherichia_phage(20.0%)	78	NA	NA
WP_002209743.1|1965413_1966622_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209757.1|1969272_1969803_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209759.1|1972423_1974052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229524.1|1974524_1975394_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.3e-49
WP_002209763.1|1975409_1976399_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|1976453_1977347_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|1977440_1978463_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1978462_1979242_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211540.1|1979280_1979616_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002211541.1|1979630_1980653_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211542.1|1980762_1981251_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002215917.1|1981498_1982995_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002215918.1|1983049_1983751_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002211545.1|1983910_1985074_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002211546.1|1985085_1987275_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211547.1|1987601_1988933_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002231137.1|1988932_1989544_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.4	1.7e-24
WP_002211550.1|1989583_1991035_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|1991056_1991590_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002209743.1|1997515_1998724_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209688.1|1999903_2000245_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|2000319_2000667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209686.1|2000691_2001171_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012104872.1|2001235_2002042_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2002061_2002904_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2002909_2003170_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012229527.1|2003268_2005893_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.4e-29
WP_002209743.1|2006697_2007906_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_012228761.1|2012230_2013706_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002211286.1|2014339_2014528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|2014793_2015312_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|2015380_2017132_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|2017342_2017798_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_042666681.1|2017966_2018425_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211332.1|2018628_2020911_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
WP_002211331.1|2020966_2021824_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_002211330.1|2022519_2024286_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_002211329.1|2024434_2025472_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_002211328.1|2025740_2026835_+	YadA-like family protein	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_012229530.1|2026855_2028703_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_002211326.1|2029069_2030155_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_002211325.1|2030317_2031604_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002211324.1|2031916_2032609_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_012229531.1|2032782_2034456_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002211322.1|2034516_2034801_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_012229532.1|2036044_2038336_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|2038371_2040120_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
WP_002211319.1|2040116_2041103_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_002226050.1|2041110_2042538_-	VOC family protein	NA	NA	NA	NA	NA
WP_002211317.1|2043256_2043466_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
WP_002211315.1|2044013_2044196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211314.1|2044192_2044945_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002211313.1|2045307_2046201_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_012229535.1|2046973_2047759_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|2047755_2049078_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|2049058_2049787_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|2049783_2054241_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|2054456_2054915_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217987.1|2055198_2057055_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|2057278_2057827_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|2057887_2058535_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211303.1|2058769_2059960_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002213759.1|2060251_2060710_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_054104532.1|2060927_2062007_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.8	1.1e-111
WP_002211301.1|2062307_2063708_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_041854876.1|2064182_2065388_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|2066085_2068701_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|2069327_2070338_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|2070520_2071072_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211294.1|2071097_2072210_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|2072309_2074430_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|2074435_2076349_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|2076477_2077764_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|2077750_2079403_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|2079399_2079978_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|2080247_2080415_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213759.1|2080612_2081071_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|2081323_2081782_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2246703	2329326	4504254	tail,holin,transposase,tRNA,lysis,protease	Escherichia_phage(15.0%)	77	NA	NA
WP_002209743.1|2246703_2247912_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210642.1|2247947_2248706_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_002210643.1|2249006_2249303_+	YciI family protein	NA	NA	NA	NA	NA
WP_002217646.1|2249525_2249771_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_002210644.1|2249886_2250150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229564.1|2250370_2250910_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	41.8	1.3e-25
WP_002388651.1|2251338_2251515_-	YciY family protein	NA	NA	NA	NA	NA
WP_001297096.1|2251600_2252380_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2252379_2253402_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_190947803.1|2253705_2253816_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210648.1|2253915_2255376_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002210649.1|2255540_2255864_+	YciU family protein	NA	NA	NA	NA	NA
WP_002210650.1|2256162_2256378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210651.1|2256938_2257940_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	34.7	4.7e-24
WP_002210652.1|2257936_2258938_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
WP_025470761.1|2258949_2259858_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_002210654.1|2259873_2260794_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_002218177.1|2260880_2262518_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_002210656.1|2263317_2263962_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_002210657.1|2264788_2267464_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002210659.1|2268214_2268805_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002223593.1|2269554_2269962_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002213759.1|2270169_2270628_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|2270708_2271917_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_000255944.1|2272206_2273229_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2273228_2274008_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|2274175_2274436_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_002211736.1|2275460_2275907_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|2275980_2276586_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2276586_2276976_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_041854794.1|2276979_2277198_+	ash family protein	NA	NA	NA	NA	NA
WP_002211732.1|2277246_2277810_+	Bro-N domain-containing protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|2278233_2278443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|2278789_2278987_+|holin	phage holin family protein	holin	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|2279017_2279530_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|2279514_2279973_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2280518_2281232_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211724.1|2282184_2282634_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|2282637_2283222_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|2283269_2284478_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|2284482_2285457_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|2285456_2286185_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2286203_2286845_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_012229589.1|2286845_2287958_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.0	3.9e-120
WP_002211720.1|2288079_2288853_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211717.1|2289727_2289982_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|2289983_2290334_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|2290335_2290920_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2290916_2291324_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2291389_2292310_+	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2292322_2292634_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|2292681_2292942_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_012229598.1|2292942_2296446_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	1.1e-117
WP_002211710.1|2296448_2296790_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|2297095_2297554_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210990.1|2297809_2298649_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002222427.1|2298960_2299929_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
WP_002210992.1|2300235_2301177_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	2.1e-130
WP_002210994.1|2305463_2305796_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002210995.1|2305855_2306515_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.6	6.0e-20
WP_079993208.1|2306799_2307123_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_002214605.1|2307180_2307633_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_002210998.1|2307702_2308695_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.2	7.6e-67
WP_002210999.1|2308960_2311657_+	YdbH family protein	NA	NA	NA	NA	NA
WP_002211000.1|2311653_2311848_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_002211001.1|2311857_2312229_+	YdbL family protein	NA	NA	NA	NA	NA
WP_002211002.1|2312428_2313820_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.7e-46
WP_002211003.1|2314029_2314986_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211004.1|2315106_2315712_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_002214609.1|2320360_2320690_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211007.1|2320686_2321010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002224556.1|2321065_2321902_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002229907.1|2322235_2322514_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_012229608.1|2323113_2323668_+	cytochrome b	NA	NA	NA	NA	NA
WP_002211011.1|2323693_2324272_+	YceI family protein	NA	NA	NA	NA	NA
WP_002214618.1|2324652_2324811_+	invertase	NA	NA	NA	NA	NA
WP_002213759.1|2328867_2329326_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2391814	2511174	4504254	transposase,protease,tail,integrase	Escherichia_phage(13.33%)	101	2487602:2487632	2511200:2511230
WP_002213775.1|2391814_2392273_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229644.1|2392362_2394387_+	putative virulence factor	NA	NA	NA	NA	NA
WP_012229646.1|2394555_2395350_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_002232808.1|2395711_2395807_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_041854760.1|2396013_2396472_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5REW8	Helicobacter_phage	24.1	1.7e-08
WP_002230908.1|2398291_2398639_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002211025.1|2398705_2399380_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_002223598.1|2399510_2401907_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211024.1|2402452_2403898_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_002211023.1|2404138_2404657_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.5	1.6e-23
WP_002211022.1|2404729_2405482_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_002211020.1|2406846_2408241_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002211019.1|2408313_2409840_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002211018.1|2410369_2411323_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002211017.1|2411592_2412984_+	amino acid permease	NA	NA	NA	NA	NA
WP_012229654.1|2413007_2413424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211015.1|2413720_2414467_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_012229656.1|2415871_2417371_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_002213759.1|2417492_2417951_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210622.1|2418180_2420796_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.1	1.4e-88
WP_002228458.1|2420822_2421122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210623.1|2421214_2421466_+	YciN family protein	NA	NA	NA	NA	NA
WP_002210624.1|2421584_2422631_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
WP_002210625.1|2422802_2423564_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_002210626.1|2423580_2424171_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012229663.1|2424293_2425328_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_041854882.1|2425657_2426257_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_079993239.1|2426213_2427119_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002227930.1|2427392_2427455_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_002228454.1|2427573_2429136_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_002215981.1|2429135_2429714_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.3	7.4e-30
WP_041854798.1|2429728_2430727_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.8	1.0e-50
WP_012229668.1|2430730_2432158_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.0	2.9e-35
WP_002210633.1|2432314_2433505_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012229670.1|2433504_2434320_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_002210636.1|2434662_2434977_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_041854799.1|2435534_2435714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229672.1|2435713_2436904_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_002230897.1|2437023_2437659_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_002210638.1|2437767_2437983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210639.1|2438144_2438915_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_002215979.1|2439035_2439656_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_041854800.1|2439687_2440716_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	1.1e-07
WP_002210640.1|2440946_2441489_+	septation protein A	NA	NA	NA	NA	NA
WP_002210641.1|2441568_2442018_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_002209743.1|2442165_2443374_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210664.1|2443887_2445234_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|2445540_2446557_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002213759.1|2447442_2447901_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210666.1|2448601_2449066_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|2449149_2449998_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|2450598_2451807_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211667.1|2453732_2454539_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2454636_2455023_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2455035_2455326_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2455322_2457248_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|2457309_2458356_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|2458580_2459132_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002230886.1|2459294_2461145_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2461261_2462278_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2462292_2462940_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2463073_2463346_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2463416_2463830_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|2464177_2465173_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|2465486_2466362_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2466434_2467184_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|2467627_2469562_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002211683.1|2471093_2472212_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2472246_2473152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2473349_2474219_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2474483_2475686_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|2475701_2477006_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_012229676.1|2477470_2479006_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2479223_2479943_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_012229677.1|2480186_2481755_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2481990_2482521_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2482937_2483294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2484385_2485126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2485142_2486342_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|2486345_2487518_+	MFS transporter	NA	NA	NA	NA	NA
2487602:2487632	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|2487822_2489031_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211695.1|2489251_2489671_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002211696.1|2489681_2490599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2490615_2491614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2491613_2494817_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211699.1|2495182_2495347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2495388_2496009_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2496064_2496280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2496422_2496974_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2497072_2498080_-	Bro-N domain-containing protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2498153_2498321_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2498444_2498876_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211708.1|2499833_2500544_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|2500546_2501299_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_041854760.1|2501418_2501877_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5REW8	Helicobacter_phage	24.1	1.7e-08
WP_002210985.1|2502794_2503769_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_002210987.1|2504960_2506577_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002227906.1|2506819_2507803_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001297096.1|2508064_2508844_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2508843_2509866_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2509935_2511174_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
2511200:2511230	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
>prophage 14
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2646238	2697194	4504254	transposase,tRNA	Planktothrix_phage(20.0%)	49	NA	NA
WP_000255944.1|2646238_2647261_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213759.1|2647510_2647969_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210983.1|2648115_2649693_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_012229742.1|2650028_2650475_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_002210981.1|2650553_2651012_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_002210980.1|2651021_2652083_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002210979.1|2652079_2653477_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002216375.1|2653457_2653700_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002210977.1|2653784_2654144_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002210976.1|2654143_2654371_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002210975.1|2654532_2655198_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002210974.1|2655442_2656471_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002213775.1|2656635_2657094_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229746.1|2657759_2659406_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002210972.1|2659402_2660368_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002210971.1|2660354_2661245_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_002210970.1|2661244_2662237_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	8.8e-07
WP_012229750.1|2662236_2663052_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.9	6.5e-16
WP_012229752.1|2663441_2664722_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_002215910.1|2665364_2666870_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_002210965.1|2667124_2667715_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_012229762.1|2667960_2668209_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|2668270_2669479_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210962.1|2669791_2670397_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_002210960.1|2671470_2672745_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.4	3.0e-84
WP_002210959.1|2672926_2673580_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_002218323.1|2673670_2673985_-	lipoprotein	NA	NA	NA	NA	NA
WP_002218322.1|2674042_2675155_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_002210956.1|2675710_2676178_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|2676405_2676864_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210955.1|2677031_2677463_-	virulence master transcriptional regulator RovA	NA	NA	NA	NA	NA
WP_002210954.1|2678260_2679157_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_002210953.1|2679288_2679528_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_002210952.1|2679701_2681339_+	phosphoethanolamine transferase EptA	NA	NA	NA	NA	NA
WP_002210951.1|2681561_2682161_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210950.1|2682248_2683346_+	alkene reductase	NA	NA	NA	NA	NA
WP_012229765.1|2683566_2686509_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210948.1|2686781_2687189_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002227904.1|2687300_2687948_+	ribonuclease T	NA	NA	NA	NA	NA
WP_087768161.1|2687962_2688058_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210946.1|2688256_2688607_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_002210945.1|2689046_2689898_+	C40 family peptidase	NA	A0A2H4PI41	Streptomyces_phage	43.9	2.8e-17
WP_002210944.1|2690275_2690854_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.6	4.4e-43
WP_002216285.1|2690957_2691047_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_002210943.1|2691380_2692406_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	5.9e-30
WP_002210942.1|2692494_2693427_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012229766.1|2693716_2694919_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.2	4.1e-14
WP_012229767.1|2695398_2696550_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.0	9.4e-85
WP_002213775.1|2696735_2697194_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2702780	2761298	4504254	transposase,tRNA	Tupanvirus(20.0%)	53	NA	NA
WP_002213759.1|2702780_2703239_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_012229768.1|2703383_2704592_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_000255944.1|2705143_2706166_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2706165_2706945_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211803.1|2706988_2708008_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002211804.1|2708278_2708701_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_012229769.1|2708789_2710010_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	4.8e-87
WP_002211806.1|2710006_2711332_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002211807.1|2711306_2712053_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.3	1.9e-09
WP_002211808.1|2712238_2713750_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002211809.1|2713764_2714136_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.6	1.1e-15
WP_002211810.1|2714751_2715168_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_002211811.1|2715289_2718346_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012229770.1|2718966_2720064_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_002213759.1|2720577_2721036_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211813.1|2721374_2723759_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	4.1e-175
WP_002211815.1|2725086_2726133_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	3.2e-84
WP_002211816.1|2727816_2728833_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_002216102.1|2728957_2729422_-	lipoprotein	NA	A0A217EQL1	Bacillus_phage	37.0	8.9e-10
WP_002211818.1|2729362_2729545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211819.1|2729701_2730088_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF	NA	NA	NA	NA	NA
WP_002211820.1|2730084_2730429_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
WP_002211821.1|2730425_2732090_-	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_002211822.1|2732086_2732992_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_002211823.1|2732988_2734992_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	1.7e-17
WP_002211824.1|2734988_2735972_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.2	6.9e-36
WP_002211825.1|2735958_2737113_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	8.3e-33
WP_002213775.1|2737641_2738100_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229772.1|2738187_2738931_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	28.5	9.2e-09
WP_002211827.1|2738955_2739510_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002220283.1|2739579_2740587_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_002211829.1|2740813_2741272_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|2741671_2742130_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211830.1|2742318_2742615_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_002211831.1|2742619_2745007_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|2745020_2746004_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|2746360_2746408_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|2746502_2746859_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|2746896_2747094_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|2747190_2747742_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|2747745_2749674_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|2750064_2750277_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|2751035_2751287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|2751605_2752289_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|2752410_2753073_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|2753284_2754253_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|2754249_2755140_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|2755139_2756024_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|2756020_2756914_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|2756981_2757194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|2757218_2758094_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|2758222_2758777_-	YniB family protein	NA	NA	NA	NA	NA
WP_002209743.1|2760089_2761298_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 16
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2785661	2826896	4504254	transposase,plate,protease,coat	Escherichia_phage(20.0%)	31	NA	NA
WP_002213759.1|2785661_2786120_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210847.1|2786375_2787257_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012229781.1|2787730_2789800_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.7	3.8e-84
WP_002210849.1|2789819_2790533_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2790628_2791126_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|2791357_2792605_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_012229782.1|2792573_2795225_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002216613.1|2796264_2796795_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|2797404_2798157_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012229783.1|2798242_2800690_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002230846.1|2800879_2801869_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210859.1|2802076_2802316_+	YebV family protein	NA	NA	NA	NA	NA
WP_002215943.1|2802425_2802815_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|2803221_2804244_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2804243_2805023_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210703.1|2805073_2805307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210701.1|2805627_2807112_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_002210700.1|2807357_2808122_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
WP_002210699.1|2808191_2808656_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
WP_002210698.1|2808710_2809430_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002210697.1|2809474_2810230_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002228041.1|2810301_2811690_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
WP_002220059.1|2811732_2812515_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_144405495.1|2813374_2814190_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	28.1	2.1e-22
WP_002209743.1|2814637_2815846_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209743.1|2816332_2817541_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211579.1|2818868_2819630_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2819786_2820332_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012229788.1|2820532_2823208_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2823990_2825871_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012229789.1|2825870_2826896_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 17
NC_010159	Yersinia pestis Angola, complete sequence	4504254	2946964	3021385	4504254	transposase,plate,tRNA	uncultured_virus(15.38%)	60	NA	NA
WP_002213775.1|2946964_2947423_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213087.1|2948813_2949167_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002213088.1|2949201_2949591_+	YcfL family protein	NA	NA	NA	NA	NA
WP_002213089.1|2949631_2950207_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_042666702.1|2950187_2951054_+	thiamine kinase	NA	NA	NA	NA	NA
WP_002215854.1|2951136_2952156_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213095.1|2952283_2952826_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002213097.1|2953200_2954505_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002209743.1|2955561_2956770_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210885.1|2957733_2958231_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_012229814.1|2958393_2960547_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_012229815.1|2960563_2961829_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_002210888.1|2961825_2962713_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_002210889.1|2962917_2963499_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_012229816.1|2965041_2967741_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	1.1e-43
WP_002210891.1|2968141_2968840_-	MgtC family protein	NA	G3MA03	Bacillus_virus	40.0	2.1e-15
WP_002210892.1|2971882_2972074_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|2972288_2972501_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_002214048.1|2973041_2976224_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.3	0.0e+00
WP_002210897.1|2976630_2977641_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_002214045.1|2977923_2978457_+	YlaC family protein	NA	NA	NA	NA	NA
WP_002210900.1|2978962_2979412_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210901.1|2979503_2980403_+	Kdo hydroxylase family protein	NA	NA	NA	NA	NA
WP_002210902.1|2980705_2980909_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
WP_002210903.1|2981210_2982536_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_002210904.1|2982836_2983010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227977.1|2983067_2983451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002210906.1|2983610_2984468_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002210907.1|2985387_2986968_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_002210908.1|2987087_2987348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210909.1|2987607_2988651_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210910.1|2988797_2990051_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_002218214.1|2990181_2990808_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_002210912.1|2990800_2991247_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002210913.1|2991433_2992549_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|2992606_2993233_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002230790.1|2993293_2994664_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	3.4e-110
WP_002210916.1|2994851_2995475_+	porin family protein	NA	NA	NA	NA	NA
WP_002230788.1|2995685_2996357_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|2996362_2997817_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|2997900_2999022_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|2999254_3000490_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|3000819_3001656_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002216178.1|3001704_3001857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216175.1|3001849_3002620_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002210922.1|3002638_3003886_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|3003885_3004590_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|3004582_3005785_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|3006054_3009501_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012229817.1|3009739_3010279_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|3010608_3011817_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|3011841_3013032_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|3013016_3013625_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|3013729_3014254_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|3014277_3015780_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|3016105_3016591_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|3016843_3017383_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|3017386_3018736_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012228761.1|3019414_3020890_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_041854807.1|3020899_3021385_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3048072	3123668	4504254	transposase	Escherichia_phage(30.0%)	54	NA	NA
WP_002209743.1|3048072_3049281_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_000255944.1|3052118_3053141_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3053140_3053920_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3054259_3054646_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3054755_3057470_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3057547_3058081_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3058109_3058634_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3058800_3059721_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3059820_3060972_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3061044_3062301_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3062327_3063155_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3063156_3064077_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3064069_3065545_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3065682_3066753_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_012229821.1|3066749_3067952_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3067951_3069268_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_012229822.1|3069270_3070353_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3070346_3071723_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3071719_3073207_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|3073193_3074957_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3075022_3075340_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3075336_3076299_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3076301_3076760_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3077314_3077404_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3077862_3078303_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3078433_3079444_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|3079949_3080408_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210448.1|3080606_3081101_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|3081103_3082831_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|3083290_3085096_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3085622_3086579_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3087256_3087472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|3087900_3088359_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|3088505_3090068_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3090070_3091162_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3091163_3092594_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3092608_3093211_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|3093451_3094633_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|3095296_3096958_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3097897_3098890_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3098865_3100473_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3100459_3101170_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3101238_3102006_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3102201_3104571_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3104995_3107902_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002213759.1|3108283_3108742_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210468.1|3108868_3109222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229833.1|3112746_3114354_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002210471.1|3115815_3116307_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3116299_3116665_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3116670_3117288_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3117280_3118384_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|3118409_3120629_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|3122645_3123668_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 19
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3160712	3203453	4504254	transposase,plate,lysis	Tupanvirus(16.67%)	33	NA	NA
WP_012229860.1|3160712_3162476_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|3162439_3163525_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|3163499_3164081_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|3164080_3164533_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012229861.1|3164557_3165925_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041854811.1|3166136_3166760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|3167442_3169038_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|3169265_3169919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211948.1|3169983_3170754_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_012229863.1|3170755_3172030_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211950.1|3172564_3173875_-	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211951.1|3173884_3174553_-	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_012229864.1|3174554_3175817_-	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002209743.1|3176276_3177485_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002227980.1|3179585_3179798_-	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002211956.1|3180054_3180897_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002224699.1|3180917_3182057_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211958.1|3182330_3183200_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211960.1|3184440_3185103_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_012229866.1|3185157_3186324_+	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211963.1|3187071_3188064_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211964.1|3188293_3189814_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_012229868.1|3189834_3190845_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002213775.1|3191066_3191525_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211966.1|3191965_3192703_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211969.1|3195023_3195908_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211970.1|3196233_3196929_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211971.1|3196925_3197333_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211973.1|3197574_3198756_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211974.1|3199069_3200323_-	LVIVD repeat-containing protein	NA	NA	NA	NA	NA
WP_002211975.1|3200340_3201417_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002228565.1|3202114_3202777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3202994_3203453_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3310167	3353980	4504254	transposase,tRNA	Escherichia_phage(22.22%)	44	NA	NA
WP_100067904.1|3310167_3311522_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002213775.1|3311672_3312131_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228401.1|3312318_3313026_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002208565.1|3313237_3313594_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.3	6.1e-19
WP_002217569.1|3313700_3315185_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002208563.1|3315515_3316580_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012229890.1|3317162_3317858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224836.1|3318524_3318995_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002227068.1|3318997_3319567_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002227834.1|3319731_3320613_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002208557.1|3320630_3321689_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002213759.1|3321863_3322322_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208555.1|3322469_3323183_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	34.8	2.9e-36
WP_002208554.1|3323401_3324268_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002208553.1|3324361_3324814_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002231050.1|3324815_3326867_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002208551.1|3327120_3327315_-	YpfN family protein	NA	NA	NA	NA	NA
WP_002208550.1|3327382_3328060_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_002208549.1|3328056_3329184_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_002208548.1|3329185_3329584_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_002208547.1|3329743_3330217_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002208546.1|3330527_3331616_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002231049.1|3331710_3333480_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012229891.1|3333472_3334543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.5e-31
WP_002214539.1|3334556_3334763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041854899.1|3335023_3336694_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002208542.1|3336751_3337927_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002208541.1|3338686_3339235_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002208540.1|3339523_3340108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|3340221_3341001_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3341000_3342023_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002212121.1|3342965_3344330_-	LOG family protein	NA	NA	NA	NA	NA
WP_002212122.1|3344482_3345328_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	1.2e-41
WP_002212123.1|3345459_3346011_+	SecY-interacting protein	NA	NA	NA	NA	NA
WP_002213759.1|3346700_3347159_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002217139.1|3347456_3348152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217141.1|3348184_3348778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208668.1|3348848_3349298_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_002208667.1|3349447_3350557_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.2	1.5e-50
WP_002208666.1|3350692_3351163_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	3.5e-30
WP_002208665.1|3351183_3351600_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002208664.1|3351840_3352830_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_002208663.1|3352822_3353308_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_002213759.1|3353521_3353980_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 21
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3550922	3606341	4504254	transposase,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	50	NA	NA
WP_012228761.1|3550922_3552398_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002209980.1|3553145_3554261_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|3554264_3555149_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|3555328_3555751_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|3555750_3556314_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|3556429_3557389_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|3557414_3558146_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012229925.1|3558254_3558437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209973.1|3558415_3559123_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|3559220_3559733_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3559925_3561080_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3562268_3564248_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|3564407_3564728_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|3564761_3564872_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|3565017_3565770_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|3566260_3568255_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|3568562_3569021_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_012229926.1|3569110_3569275_+	Beta-galactosidase C-terminal domain	NA	NA	NA	NA	NA
WP_002209896.1|3569386_3569698_+	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	39.2	3.3e-08
WP_002215759.1|3570054_3571314_-	maltoporin	NA	NA	NA	NA	NA
WP_002209894.1|3571585_3572659_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.9e-72
WP_002213775.1|3572839_3573298_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229927.1|3573681_3576051_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_002209891.1|3576201_3577509_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209890.1|3577902_3578985_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209889.1|3579207_3579786_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_002209888.1|3579809_3580664_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_002209887.1|3580773_3582261_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002209886.1|3582383_3583991_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_012229928.1|3584011_3585238_-	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	33.1	5.4e-06
WP_002209884.1|3585668_3586727_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_002230627.1|3586742_3587498_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.7e-15
WP_002209882.1|3587693_3588860_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002209881.1|3588862_3589303_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002209880.1|3589388_3590279_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012229929.1|3590268_3591057_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002209878.1|3591103_3591601_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_012229932.1|3591618_3592785_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002209876.1|3592781_3594080_-	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_002209875.1|3594129_3594906_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002209873.1|3595745_3597299_+	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
WP_002213759.1|3597750_3598209_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208669.1|3598415_3599384_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	1.9e-46
WP_002208670.1|3599394_3601242_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208671.1|3601269_3601605_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002208672.1|3601716_3602841_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
WP_002208673.1|3602933_3604004_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002216927.1|3604206_3604788_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208675.1|3605066_3605669_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_041854826.1|3605882_3606341_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 22
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3645324	3705009	4504254	transposase,protease,tRNA	Escherichia_phage(44.44%)	50	NA	NA
WP_012229943.1|3645324_3646680_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_002212137.1|3646708_3647557_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002212136.1|3647566_3648325_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
WP_002212135.1|3648548_3649745_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002212134.1|3649958_3650516_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_012229944.1|3650651_3651377_-	UMP kinase	NA	NA	NA	NA	NA
WP_002212132.1|3651585_3652443_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002221800.1|3652570_3653296_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002212129.1|3654504_3657186_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_002212128.1|3657360_3658185_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_002212127.1|3658308_3658698_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_002212126.1|3658787_3659237_-	flavodoxin	NA	NA	NA	NA	NA
WP_002212125.1|3659264_3660038_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_002212124.1|3660037_3660370_-	YqcC family protein	NA	NA	NA	NA	NA
WP_002209872.1|3660619_3661054_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|3661110_3662133_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3662132_3662912_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_012229945.1|3662962_3664483_-	aminotransferase class V-fold PLP-dependent enzyme	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-35
WP_002208733.1|3664463_3665117_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208734.1|3665113_3665782_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012229946.1|3665794_3666583_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002208736.1|3666910_3667744_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208738.1|3668053_3668257_+	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
WP_002208739.1|3668253_3669651_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_002264506.1|3669760_3670147_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_002208741.1|3670383_3671583_+	MFS transporter	NA	NA	NA	NA	NA
WP_002208742.1|3671742_3672516_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002208743.1|3672512_3672854_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002208744.1|3673025_3673538_+	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002208745.1|3673921_3675094_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_002208746.1|3675132_3676668_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_012229947.1|3676790_3677957_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002216643.1|3678208_3678646_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
WP_002208749.1|3678815_3679565_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002223249.1|3679607_3682250_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002208751.1|3682425_3683781_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002208752.1|3683842_3684184_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002217405.1|3690094_3692668_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002209471.1|3692797_3693529_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002231132.1|3693530_3694508_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209469.1|3694643_3695375_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002209468.1|3695729_3696092_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_041854827.1|3696423_3696882_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228330.1|3697164_3698322_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002209465.1|3698426_3699548_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228238.1|3699560_3700631_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002223245.1|3700863_3701580_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001297096.1|3701733_3702513_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3702512_3703535_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213759.1|3704550_3705009_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 23
NC_010159	Yersinia pestis Angola, complete sequence	4504254	3984779	4048024	4504254	transposase,protease,tRNA	Bacillus_phage(22.22%)	51	NA	NA
WP_002216348.1|3984779_3985616_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|3985650_3986409_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067904.1|3986601_3987955_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002215753.1|3988317_3989547_+	MFS transporter	NA	NA	NA	NA	NA
WP_002209605.1|3989695_3989899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215752.1|3990019_3990178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215751.1|3990256_3990838_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002215750.1|3990851_3991184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012230118.1|3993892_3995281_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_002209609.1|3995464_3996394_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_002209610.1|3996393_3997068_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002209611.1|3997064_3998036_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002228725.1|3998048_4001096_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_002209612.1|4001292_4002117_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_002209614.1|4002552_4003176_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	2.4e-63
WP_002209615.1|4003519_4005469_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_002217114.1|4005658_4005991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209617.1|4006522_4006999_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_002209618.1|4007167_4007524_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_002209619.1|4007772_4008327_-	mannitol operon repressor	NA	NA	NA	NA	NA
WP_002209620.1|4008533_4009697_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209621.1|4009833_4011765_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_002209622.1|4012414_4013134_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_012303322.1|4013228_4013459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209623.1|4013606_4015676_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002209624.1|4015685_4016600_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002209626.1|4016927_4017500_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002209627.1|4017496_4017952_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.2	1.4e-15
WP_002209628.1|4018309_4018969_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_002209629.1|4019099_4019744_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002209630.1|4020243_4021224_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.3	9.3e-25
WP_012230123.1|4021493_4023557_+	alpha-amylase	NA	NA	NA	NA	NA
WP_002209632.1|4023971_4024415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228155.1|4024869_4026135_+	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002209634.1|4026247_4027906_-	putative transporter	NA	NA	NA	NA	NA
WP_002209635.1|4028278_4028743_-	heat shock chaperone IbpB	NA	A0A0E3FB97	Synechococcus_phage	32.2	3.3e-12
WP_002209636.1|4029023_4029437_-	heat shock chaperone IbpA	NA	A0A127KM93	Cyanophage	36.8	7.1e-19
WP_002209637.1|4029804_4030143_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_002209638.1|4031005_4031968_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_000255944.1|4032731_4033754_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4033753_4034533_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_100067904.1|4035072_4036426_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208933.1|4036588_4037473_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002208934.1|4037705_4040141_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_012230127.1|4040143_4041304_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002208935.1|4041681_4041999_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208936.1|4042347_4042803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042666681.1|4043408_4043867_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002216737.1|4044055_4044271_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_012230129.1|4044523_4046722_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_042666681.1|4047565_4048024_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_010157	Yersinia pestis Angola plasmid new_pCD, complete sequence	68190	10375	62775	68190	protease,transposase	Wolbachia_phage(33.33%)	55	NA	NA
WP_002213006.1|10375_11344_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213004.1|11343_11742_+	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002222515.1|12446_12866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116442925.1|13614_13860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002353322.1|14101_15205_-	type III secretion system effector YopM	NA	NA	NA	NA	NA
WP_002229781.1|15598_15808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212987.1|16933_17854_-	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002212985.1|17872_19078_-	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002222758.1|19055_19562_-	type III secretion system chaperone SycD/LcrH	NA	NA	NA	NA	NA
WP_012228705.1|19574_20555_-	type III secretion system needle tip protein LcrV	NA	NA	NA	NA	NA
WP_012228713.1|20556_20844_-	type III secretion system chaperone LcrG	NA	NA	NA	NA	NA
WP_002220918.1|20885_21326_-	type III secretion system chaperone LcrR	NA	NA	NA	NA	NA
WP_002212971.1|21322_23437_-	SctV family type III secretion system export apparatus subunit LcrD	NA	NA	NA	NA	NA
WP_002229791.1|23423_23768_-	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212969.1|23764_24133_-	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229794.1|24129_24501_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212965.1|24487_24766_-	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002212958.1|24746_25628_-	SctW family type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212955.1|25825_27145_+	SctN family type III secretion system ATPase YscN	NA	NA	NA	NA	NA
WP_002212952.1|27141_27606_+	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212950.1|27605_28973_+	type III secretion system needle length determinant YscP	NA	NA	NA	NA	NA
WP_002212948.1|28969_29893_+	SctQ family type III secretion system cytoplasmic ring protein YscQ	NA	NA	NA	NA	NA
WP_002212947.1|29889_30543_+	SctR family type III secretion system export apparatus subunit YscR	NA	NA	NA	NA	NA
WP_002212945.1|30544_30811_+	SctS family type III secretion system export apparatus subunit YscS	NA	NA	NA	NA	NA
WP_002212938.1|30807_31593_+	SctT family type III secretion system export apparatus subunit YscT	NA	NA	NA	NA	NA
WP_012228726.1|31592_32657_+	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002222527.1|33231_33627_+	type III secretion system pilotin YscW	NA	NA	NA	NA	NA
WP_002212931.1|33750_34566_+	virulence regulon transcriptional activator VirF	NA	NA	NA	NA	NA
WP_002229797.1|34644_34743_+	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212925.1|34968_35382_+	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002212923.1|35387_37211_+	SctC family type III secretion system outer membrane ring subunit YscC	NA	NA	NA	NA	NA
WP_002212919.1|37207_38467_+	SctD family type III secretion system inner membrane ring subunit YscD	NA	NA	NA	NA	NA
WP_002212917.1|38463_38664_+	type III secretion system co-chaperone YscE	NA	NA	NA	NA	NA
WP_002212916.1|38664_38928_+	type III secretion system needle filament protein YscF	NA	NA	NA	NA	NA
WP_002229801.1|38929_39277_+	type III secretion system chaperone YscG	NA	NA	NA	NA	NA
WP_002212915.1|39273_39771_+	T3SS polymerization control protein YopR	NA	NA	NA	NA	NA
WP_002212914.1|39771_40119_+	SctI family type III secretion system inner rod subunit LcrO	NA	NA	NA	NA	NA
WP_002212912.1|40125_40860_+	SctJ family type III secretion inner membrane ring lipoprotein YscJ	NA	NA	NA	NA	NA
WP_002361471.1|40859_41489_+	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_010981371.1|41434_42100_+	SctL family type III secretion system stator protein YscL	NA	NA	NA	NA	NA
WP_002212907.1|42324_42672_+	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002213278.1|44760_46167_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|47849_48716_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002397022.1|49111_51301_-	type III secretion system effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002229809.1|51308_51758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|52488_52728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|53899_54778_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|54758_54833_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|55074_55329_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|55466_55715_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|56131_56539_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213008.1|56562_56880_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|57051_57510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|57578_57848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213256.1|60459_62775_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
>prophage 1
NC_010158	Yersinia pestis Angola plasmid pMT-pPCP, complete sequence	114570	9694	90277	114570	transposase,terminase,tail	Salmonella_phage(84.85%)	74	NA	NA
WP_000255944.1|9694_10717_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|10716_11496_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213433.1|12532_12727_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_002218512.1|13962_14388_+	pesticin immunity protein	NA	NA	NA	NA	NA
WP_002218509.1|14422_15496_-	pesticin	NA	M4PYB4	Vibrio_phage	31.6	6.6e-16
WP_002221218.1|15722_16028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002231174.1|16270_17209_+	omptin family plasminogen activator Pla	NA	NA	NA	NA	NA
WP_002213446.1|17395_17695_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_002225538.1|17694_18036_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000255944.1|19302_20325_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_012228794.1|20324_21104_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.9e-138
WP_000920226.1|21602_21869_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002213303.1|25402_26149_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_012228795.1|26138_28055_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.4	0.0e+00
WP_002213300.1|28284_29370_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214160.1|31168_31813_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_012228763.1|32567_33632_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.3	5.4e-188
WP_002222711.1|34200_34413_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|34412_34748_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|34744_34924_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|34964_35240_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|35307_35718_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|35701_36073_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|36226_37057_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002231164.1|37894_39037_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_011901832.1|39235_39991_+	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002213759.1|40229_40688_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|40887_41169_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002211801.1|41374_41857_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002214137.1|42495_42723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|42807_43458_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|43780_44308_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|44312_44735_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|44794_45073_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_012228815.1|45075_46635_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.8	1.4e-293
WP_002418921.1|46744_47398_+	ParB/RepB/Spo0J family partition protein	NA	J9Q756	Salmonella_phage	98.6	6.9e-117
WP_002211792.1|47397_48066_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|48062_48701_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|48693_48948_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|48953_49844_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|49853_50120_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|50315_50957_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|50959_52216_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_012228810.1|52249_53824_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	9.2e-301
WP_002231160.1|53846_54743_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_012228823.1|54769_55576_+	hypothetical protein	NA	J9Q710	Salmonella_phage	91.4	5.6e-145
WP_002211783.1|55650_56313_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|56356_56791_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|56790_57624_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|57721_58066_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|58056_58530_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|58531_58915_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|58989_59736_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_000163862.1|59795_60113_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|60238_60463_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_012228764.1|60470_65036_+	tape measure protein	NA	J9Q712	Salmonella_phage	89.9	0.0e+00
WP_000440566.1|65077_65413_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011901831.1|65502_66201_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_002211774.1|66193_66991_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|66978_67566_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002214118.1|67587_72219_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211771.1|72275_72854_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_012228802.1|72934_75823_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|76124_76733_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_012228761.1|76866_78342_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002213132.1|79005_80034_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|80153_80585_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|80805_81057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228774.1|81129_81693_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002213759.1|81866_82325_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002213143.1|82433_82877_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
WP_012228814.1|82873_86398_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.0	0.0e+00
WP_002211767.1|86578_87814_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|87910_90277_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
