The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009997	Shewanella baltica OS195, complete sequence	5347283	676558	756403	5347283	integrase,transposase	Cedratvirus(25.0%)	39	674978:674996	685130:685148
674978:674996	attL	CGCGTTTTTCTTGATGGTG	NA	NA	NA	NA
WP_006083191.1|676558_677881_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_006083190.1|677864_679418_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006083189.1|679410_681492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083188.1|681491_682019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083187.1|682098_682536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083186.1|682532_684686_+	AAA family ATPase	NA	A0A285PXL3	Cedratvirus	27.7	1.3e-26
WP_006083185.1|685450_685729_+	hypothetical protein	NA	NA	NA	NA	NA
685130:685148	attR	CGCGTTTTTCTTGATGGTG	NA	NA	NA	NA
WP_006079577.1|685725_686835_-|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_012196616.1|688635_691668_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_006083183.1|692870_694040_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	41.6	1.6e-79
WP_006083180.1|696057_696735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083179.1|696854_697712_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_006083178.1|697819_698929_+|transposase	ISAs1-like element ISSba2 family transposase	transposase	NA	NA	NA	NA
WP_006083177.1|699386_699641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006083176.1|699982_700384_+	DUF4354 family protein	NA	NA	NA	NA	NA
WP_012196620.1|700757_703046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196621.1|704099_710693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083173.1|710785_715408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083172.1|715712_718589_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_006083171.1|719406_722271_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_006083170.1|722434_722995_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.4	3.8e-31
WP_006083169.1|726406_726853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006083168.1|726839_727463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012196624.1|727797_730740_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_006083166.1|731615_734522_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_006087485.1|735868_736438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083164.1|736501_736951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083163.1|736953_739800_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_006083162.1|739792_740527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083161.1|740528_741536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083160.1|742385_742937_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_006083112.1|743573_744674_-|transposase	ISAs1-like element ISSba1 family transposase	transposase	NA	NA	NA	NA
WP_012088173.1|745400_748325_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_006086140.1|749018_749591_+	porin family protein	NA	NA	NA	NA	NA
WP_006083156.1|751114_751456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_190273458.1|752213_752375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006083154.1|752669_753320_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_006083152.1|754511_754796_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012196627.1|755479_756403_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	81.4	4.8e-148
>prophage 2
NC_009997	Shewanella baltica OS195, complete sequence	5347283	916214	944477	5347283	tail,integrase,portal,protease,terminase	Vibrio_phage(35.29%)	32	913420:913434	924726:924740
913420:913434	attL	AGGTATCGACACCCA	NA	NA	NA	NA
WP_012196670.1|916214_916964_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	45.7	1.6e-32
WP_012196671.1|916960_917647_+	replication protein P	NA	I6PBN0	Cronobacter_phage	28.5	2.6e-10
WP_012196672.1|917636_918893_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	33.7	1.1e-46
WP_012196673.1|918948_919167_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012196674.1|919153_919507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196675.1|919515_920130_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	63.6	2.2e-64
WP_012196676.1|920451_921129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196677.1|921577_922111_+	lysozyme	NA	A0A1S5R1I9	Pseudomonas_phage	39.2	1.6e-23
WP_012196678.1|922091_922595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196679.1|922705_923041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012088279.1|922994_923528_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	49.1	3.1e-35
WP_012196680.1|923502_925500_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	49.8	2.6e-191
924726:924740	attR	AGGTATCGACACCCA	NA	NA	NA	NA
WP_012196681.1|925529_925736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196682.1|925785_927360_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	48.0	1.7e-124
WP_012196683.1|927331_929338_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	62.7	2.4e-221
WP_012196684.1|929418_929742_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	42.1	5.2e-09
WP_012196685.1|929734_930079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196686.1|930082_930640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012088287.1|930673_931099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196687.1|931095_931815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196688.1|931938_932316_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012196689.1|932327_932633_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012196690.1|932709_933294_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	46.4	5.5e-17
WP_080514246.1|933378_933567_-	ash family protein	NA	NA	NA	NA	NA
WP_012196691.1|933609_933978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012196692.1|934127_938408_+|tail	phage tail tape measure protein	tail	A0A2I7QRW8	Vibrio_phage	45.6	7.2e-223
WP_012196693.1|938445_938817_+	hypothetical protein	NA	A0A2I7QS24	Vibrio_phage	50.5	6.6e-24
WP_012196694.1|938824_941263_+	hypothetical protein	NA	A0A2I7QXQ4	Vibrio_phage	64.2	1.6e-299
WP_012196695.1|941275_942202_+	hypothetical protein	NA	A0A2I7QSN6	Vibrio_phage	34.3	1.9e-32
WP_012196696.1|942194_942482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196697.1|942478_944239_+	hypothetical protein	NA	A0A088C4B7	Shewanella_sp._phage	59.7	2.3e-143
WP_011847761.1|944264_944477_+	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	64.3	3.2e-15
>prophage 3
NC_009997	Shewanella baltica OS195, complete sequence	5347283	2340852	2355340	5347283	integrase	uncultured_Caudovirales_phage(18.18%)	20	2339816:2339831	2357909:2357924
2339816:2339831	attL	GAAGTTGTGATTTAAC	NA	NA	NA	NA
WP_006086442.1|2340852_2342847_+	nitrate- and nitrite sensing domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	7.2e-32
WP_012196961.1|2343173_2344469_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	33.4	1.3e-50
WP_012196962.1|2344468_2344681_-	excisionase family protein	NA	NA	NA	NA	NA
WP_012196963.1|2344787_2345135_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	39.0	2.4e-12
WP_012196964.1|2345143_2346694_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	54.6	4.5e-167
WP_012196965.1|2346681_2346921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012196966.1|2346917_2347196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012089044.1|2347196_2347490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012196967.1|2347486_2348137_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	39.7	4.7e-33
WP_012196968.1|2348133_2348523_-	hypothetical protein	NA	A0A1I9SEY3	Klebsiella_phage	52.5	3.7e-25
WP_012196969.1|2348519_2349149_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.2	3.6e-30
WP_012088961.1|2349179_2349527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012196970.1|2349609_2349972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048908693.1|2350739_2351405_-	helix-turn-helix domain-containing protein	NA	A0A1V0E8B5	Vibrio_phage	54.7	5.6e-58
WP_048908675.1|2351507_2351798_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	41.8	8.0e-09
WP_012196973.1|2351829_2352453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196974.1|2352458_2352785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196975.1|2352947_2353670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012196976.1|2353820_2354657_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	48.6	1.0e-32
WP_012196977.1|2354653_2355340_+	replication protein P	NA	I6PBN0	Cronobacter_phage	28.5	2.0e-10
2357909:2357924	attR	GTTAAATCACAACTTC	NA	NA	NA	NA
>prophage 4
NC_009997	Shewanella baltica OS195, complete sequence	5347283	2533316	2544433	5347283	capsid	Shigella_phage(44.44%)	16	NA	NA
WP_012197064.1|2533316_2533952_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	36.6	1.9e-15
WP_012197065.1|2533944_2534400_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	40.0	4.0e-15
WP_086012281.1|2534481_2535264_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_012197067.1|2535299_2535857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197068.1|2535898_2536354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197069.1|2536445_2536757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197070.1|2536746_2537313_+	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	41.6	1.2e-21
WP_012197071.1|2537309_2537879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197072.1|2537975_2538200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197073.1|2538196_2538535_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_012197074.1|2538534_2538831_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	55.2	1.8e-19
WP_006087223.1|2538833_2539403_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	58.1	3.5e-48
WP_012197075.1|2539402_2541043_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	63.3	1.3e-164
WP_012197076.1|2541042_2542659_+	DUF935 domain-containing protein	NA	A0A076FX05	Pseudomonas_phage	45.6	3.1e-118
WP_012197077.1|2542651_2543971_+|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	46.1	6.7e-95
WP_012197078.1|2543980_2544433_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	47.6	1.3e-18
>prophage 5
NC_009997	Shewanella baltica OS195, complete sequence	5347283	2731352	2742903	5347283	tRNA	uncultured_Caudovirales_phage(28.57%)	12	NA	NA
WP_012197176.1|2731352_2732624_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.3e-15
WP_012197177.1|2732739_2733642_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006081638.1|2734064_2734724_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	43.9	5.6e-34
WP_006087499.1|2734793_2735183_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.9	6.1e-20
WP_006087498.1|2735197_2735554_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_006081641.1|2735553_2735835_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_006081642.1|2735828_2736167_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_006087497.1|2736454_2737741_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	8.8e-100
WP_006081645.1|2737759_2738134_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.4	7.9e-09
WP_006087496.1|2738126_2739458_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.8	7.5e-78
WP_006087495.1|2739466_2740093_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012197178.1|2740149_2742903_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.5	1.9e-83
>prophage 6
NC_009997	Shewanella baltica OS195, complete sequence	5347283	2943732	2954032	5347283		Yellowstone_lake_phycodnavirus(12.5%)	13	NA	NA
WP_006086837.1|2943732_2945451_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.0	1.2e-56
WP_006081846.1|2945450_2945945_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_006081847.1|2946046_2946490_-	Hsp20 family protein	NA	A0A2L0V0Y9	Agrobacterium_phage	51.5	3.7e-21
WP_006081848.1|2946852_2947284_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	40.2	1.1e-17
WP_006081849.1|2947481_2947649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006081850.1|2947866_2948064_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_006081851.1|2948177_2949083_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	9.4e-40
WP_006081852.1|2949241_2949580_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_006086838.1|2949588_2951451_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.2	6.1e-102
WP_012197239.1|2951517_2952042_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_006081855.1|2952058_2952382_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.3	1.8e-22
WP_006081856.1|2952396_2952780_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	2.2e-51
WP_006081857.1|2952817_2954032_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	31.8	5.7e-32
>prophage 7
NC_009997	Shewanella baltica OS195, complete sequence	5347283	3375477	3498424	5347283	tRNA,tail,integrase,head,portal,capsid,plate,holin,terminase	Burkholderia_phage(15.56%)	115	3464712:3464727	3494911:3494926
WP_006085461.1|3375477_3376263_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_006085462.1|3376365_3379815_-	pilus assembly protein FimV	NA	NA	NA	NA	NA
WP_006085463.1|3379993_3381010_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006085464.1|3381012_3382143_-	4-phosphoerythronate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	23.5	5.0e-14
WP_037391053.1|3382303_3383515_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_006085466.1|3383653_3385780_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_006085467.1|3385875_3386640_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_006085468.1|3386629_3386914_-	YfcL family protein	NA	NA	NA	NA	NA
WP_006085469.1|3386919_3388098_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_006085470.1|3388198_3389374_-	MFS transporter	NA	NA	NA	NA	NA
WP_006082233.1|3389452_3390547_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	44.9	3.2e-82
WP_006082234.1|3390671_3391616_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006085471.1|3391696_3392227_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_006082236.1|3392341_3392812_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_006085472.1|3392981_3395771_+	insulinase family protein	NA	A0A1V0SJA4	Klosneuvirus	27.7	8.6e-92
WP_012197301.1|3396054_3400314_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012197302.1|3400423_3400855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197304.1|3401757_3403878_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_006082247.1|3403883_3405194_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_006082248.1|3405456_3406413_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012197305.1|3406437_3407391_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012197306.1|3407393_3408014_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_012197307.1|3408007_3409027_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_012197308.1|3409026_3411105_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_012197309.1|3411098_3412793_+	protein BatD	NA	NA	NA	NA	NA
WP_006085483.1|3412865_3413429_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006085484.1|3413421_3414126_+	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_006085485.1|3414283_3415735_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_006085486.1|3416088_3417390_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_006085487.1|3417493_3417880_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_006085488.1|3418026_3418743_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_006085489.1|3418914_3419928_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006085490.1|3419964_3423207_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	26.8	2.1e-09
WP_006082265.1|3423249_3423462_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_006085491.1|3423566_3423998_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_006085492.1|3424337_3424829_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006085494.1|3425841_3428301_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.9	8.3e-22
WP_006085495.1|3428383_3428929_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_006085496.1|3429132_3430044_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_006082272.1|3430063_3430423_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_006082273.1|3430551_3430869_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_006082274.1|3431103_3432051_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	6.0e-45
WP_011847205.1|3432063_3433914_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_006082276.1|3433931_3434264_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	48.1	3.4e-11
WP_006082277.1|3434290_3435415_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.8	1.8e-93
WP_006082278.1|3435577_3436615_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_006085498.1|3436678_3436903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006085499.1|3437113_3437743_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_006085500.1|3437812_3438484_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_006085501.1|3438582_3439023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197311.1|3439391_3439658_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_012197312.1|3439855_3440983_-	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	51.0	3.7e-94
WP_012197314.1|3440979_3441429_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	57.9	2.2e-37
WP_012197315.1|3441431_3445082_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.7	9.4e-139
WP_012197316.1|3445090_3445219_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	60.6	1.6e-06
WP_012197317.1|3445245_3445527_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	54.8	2.0e-17
WP_012197318.1|3445663_3446179_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	64.3	1.4e-59
WP_012197319.1|3446188_3447358_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	70.7	5.5e-157
WP_012197320.1|3447476_3447761_-	hypothetical protein	NA	D4HTW0	Vibrio_phage	63.7	6.4e-27
WP_012197321.1|3447888_3449121_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	Q8H9N0	Vibrio_phage	80.2	8.8e-198
WP_012197322.1|3449123_3449654_-	hypothetical protein	NA	D4HTV6	Vibrio_phage	64.9	3.8e-57
WP_012197323.1|3449653_3450430_-|tail	phage tail protein I	tail	K7R2P6	Vibrio_phage	57.3	2.8e-77
WP_012197324.1|3450422_3451352_-|plate	baseplate J/gp47 family protein	plate	D4HTV3	Vibrio_phage	52.8	2.4e-86
WP_012197325.1|3451344_3451701_-	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	52.9	2.0e-22
WP_012197326.1|3451697_3452306_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	42.4	7.2e-36
WP_012197327.1|3452645_3454007_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	29.5	1.1e-07
WP_012197328.1|3453990_3454821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197329.1|3455034_3455499_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	48.3	1.8e-26
WP_012197330.1|3455480_3455954_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	52.1	9.0e-34
WP_012197331.1|3456079_3456550_-	peptidase	NA	Q7Y4E2	Escherichia_virus	31.7	1.2e-06
WP_012197332.1|3456533_3457355_-	N-acetylmuramidase family protein	NA	Q9ZXL6	Pseudomonas_virus	51.4	5.9e-65
WP_012197333.1|3457360_3457684_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012197334.1|3457680_3458058_-	alkaline phosphatase	NA	A0A1S5NRL1	Burkholderia_phage	39.7	9.7e-15
WP_048908679.1|3458060_3458279_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	50.7	1.1e-13
WP_012197336.1|3458278_3458740_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.4	1.9e-33
WP_012197337.1|3458841_3459546_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	47.4	4.2e-43
WP_012197338.1|3459548_3460553_-|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	66.8	9.9e-123
WP_012197339.1|3460562_3461372_-|capsid	GPO family capsid scaffolding protein	capsid	E5E3S5	Burkholderia_phage	57.8	1.3e-53
WP_012197340.1|3461524_3463294_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	66.2	1.6e-229
WP_012197341.1|3463293_3464340_+|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	54.7	1.1e-111
3464712:3464727	attL	TCTAAAATTATAAAAT	NA	NA	NA	NA
WP_048908682.1|3464823_3465261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048908683.1|3465380_3465677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197342.1|3466066_3466294_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	58.3	1.6e-17
WP_080514254.1|3466305_3466440_-	rubredoxin-like protein	NA	NA	NA	NA	NA
WP_012197343.1|3467077_3467338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197344.1|3467334_3469614_-	replication endonuclease	NA	A0A2P1CKY6	Pseudoalteromonas_phage	34.7	1.4e-76
WP_012197346.1|3469987_3470227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197347.1|3470223_3470493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197348.1|3470495_3470735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197349.1|3470743_3471103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048908684.1|3471140_3471338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197351.1|3471373_3471619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048908685.1|3471615_3471840_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012197352.1|3472017_3472632_+	helix-turn-helix domain-containing protein	NA	U5P0T5	Shigella_phage	48.8	1.5e-33
WP_012197353.1|3472682_3472892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197354.1|3473163_3473427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197355.1|3473548_3474940_-	NTPase KAP	NA	R9TRQ8	Vibrio_phage	30.9	1.4e-34
WP_052292769.1|3475080_3475638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048908687.1|3475737_3476244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197357.1|3476760_3477717_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	44.3	2.3e-73
WP_006085502.1|3478005_3479385_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_006085503.1|3479577_3480102_-	CIA30 family protein	NA	NA	NA	NA	NA
WP_006082286.1|3480176_3481403_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_006085504.1|3481577_3482474_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	28.6	1.1e-27
WP_006082288.1|3482613_3483084_-	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_006085505.1|3483156_3484440_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.4	9.9e-43
WP_006085506.1|3484487_3485045_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.9	1.3e-20
WP_012197360.1|3485149_3486847_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_006085508.1|3487345_3489175_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	6.1e-30
WP_006087183.1|3489963_3491490_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006087184.1|3491688_3492141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006087185.1|3492398_3493043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006087186.1|3493182_3493986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006087187.1|3494352_3494919_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	42.9	1.7e-26
WP_006082293.1|3497014_3498424_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
3494911:3494926	attR	ATTTTATAATTTTAGA	NA	NA	NA	NA
>prophage 8
NC_009997	Shewanella baltica OS195, complete sequence	5347283	3845235	3856384	5347283	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_012197439.1|3845235_3847860_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.4	2.2e-65
WP_006082605.1|3848230_3848644_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_006082606.1|3848718_3849786_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	3.2e-111
WP_012197440.1|3850170_3852741_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.1	5.1e-30
WP_006086853.1|3852944_3853925_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	32.7	8.4e-34
WP_012197441.1|3854005_3854902_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_012197442.1|3855002_3855638_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	5.4e-34
WP_012197443.1|3855634_3856384_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.1	4.5e-72
>prophage 9
NC_009997	Shewanella baltica OS195, complete sequence	5347283	3890857	3898319	5347283		Staphylococcus_phage(50.0%)	7	NA	NA
WP_006082639.1|3890857_3891337_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	2.7e-30
WP_012197459.1|3891467_3892571_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.7	3.4e-68
WP_012197460.1|3892637_3893294_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.0	1.1e-26
WP_012197461.1|3893305_3894460_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	4.0e-51
WP_006082643.1|3894485_3894935_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_006082644.1|3895208_3896462_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.3	4.1e-102
WP_011847462.1|3896651_3898319_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	28.0	3.9e-39
>prophage 10
NC_009997	Shewanella baltica OS195, complete sequence	5347283	4013603	4024730	5347283	integrase	Vibrio_phage(22.22%)	17	4017455:4017469	4024899:4024913
WP_012197506.1|4013603_4014287_-	replication protein P	NA	I6PBN0	Cronobacter_phage	28.5	2.6e-10
WP_012197507.1|4014283_4015141_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	46.2	1.7e-35
WP_012197508.1|4015285_4016023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012088966.1|4016186_4016513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012088965.1|4016518_4017142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012088964.1|4017173_4017464_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	64.2	8.5e-19
4017455:4017469	attL	TGTTTGTCATATCGA	NA	NA	NA	NA
WP_012088963.1|4017576_4018242_+	LexA family transcriptional regulator	NA	A0A1V0E8B5	Vibrio_phage	55.6	7.3e-66
WP_012197509.1|4018897_4019260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012088961.1|4019386_4019734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012088960.1|4019764_4020394_+	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.8	1.4e-29
WP_012197510.1|4020390_4021455_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	38.2	6.7e-29
WP_012197511.1|4021451_4021745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197512.1|4021745_4022024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006083885.1|4022020_4022251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197513.1|4022247_4022856_+	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	37.9	8.3e-08
WP_012197514.1|4022852_4023173_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	38.3	1.1e-11
WP_012197515.1|4023524_4024730_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	50.4	3.9e-118
4024899:4024913	attR	TGTTTGTCATATCGA	NA	NA	NA	NA
>prophage 11
NC_009997	Shewanella baltica OS195, complete sequence	5347283	4109131	4115189	5347283	integrase	Vibrio_phage(66.67%)	9	4101898:4101910	4111277:4111289
4101898:4101910	attL	AACCAAAATGCGA	NA	NA	NA	NA
WP_012197547.1|4109131_4110400_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC5	Vibrio_phage	33.3	5.2e-44
WP_012088970.1|4110400_4110625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197548.1|4110614_4111298_-	replication protein P	NA	I6PBN0	Cronobacter_phage	28.5	2.0e-10
4111277:4111289	attR	TCGCATTTTGGTT	NA	NA	NA	NA
WP_012197549.1|4111294_4112131_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	48.6	4.6e-33
WP_012197550.1|4112282_4113050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014358090.1|4113200_4113527_-	hypothetical protein	NA	G8CTB7	Vibrio_phage	38.4	1.1e-06
WP_012197552.1|4113532_4114156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197553.1|4114199_4114394_-	Cro/Cl family transcriptional regulator	NA	R9TPV3	Vibrio_phage	48.9	8.0e-05
WP_012197554.1|4114499_4115189_+	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	48.5	4.5e-58
>prophage 12
NC_009997	Shewanella baltica OS195, complete sequence	5347283	4120136	4125796	5347283	integrase	Sinorhizobium_phage(16.67%)	10	4116792:4116803	4125881:4125892
4116792:4116803	attL	CCAAATAAAACA	NA	NA	NA	NA
WP_012197559.1|4120136_4120766_+	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.8	6.1e-30
WP_012197560.1|4120762_4121152_+	hypothetical protein	NA	A0A1I9SEY3	Klebsiella_phage	52.5	3.7e-25
WP_012197561.1|4121148_4121841_+	hypothetical protein	NA	R9VWB9	Serratia_phage	40.7	4.2e-32
WP_012197562.1|4121837_4122131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197563.1|4122131_4122410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197564.1|4122406_4122646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197565.1|4122633_4124184_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	55.1	8.3e-169
WP_006082045.1|4124192_4124513_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	38.3	1.7e-12
WP_006083887.1|4124571_4124787_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_012197566.1|4124779_4125796_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	47.4	9.5e-81
4125881:4125892	attR	TGTTTTATTTGG	NA	NA	NA	NA
>prophage 13
NC_009997	Shewanella baltica OS195, complete sequence	5347283	5122402	5136139	5347283		Bacillus_phage(42.86%)	9	NA	NA
WP_012197805.1|5122402_5127292_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.4	8.1e-69
WP_006079507.1|5127650_5128376_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	1.7e-31
WP_006084637.1|5128418_5129735_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.0	6.6e-10
WP_006084638.1|5129864_5131847_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.8	6.7e-14
WP_006079504.1|5131924_5132398_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	47.4	5.5e-23
WP_006084639.1|5132478_5133435_-	choice-of-anchor H family protein	NA	NA	NA	NA	NA
WP_006079501.1|5133793_5134084_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_006079500.1|5134086_5134782_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	25.7	4.0e-06
WP_006084640.1|5134774_5136139_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	23.3	6.4e-08
>prophage 1
NC_009999	Shewanella baltica OS195 plasmid pS19502, complete sequence	75508	5058	64192	75508	integrase,transposase	uncultured_Caudovirales_phage(15.38%)	58	6078:6137	59075:59139
WP_086012318.1|5058_6217_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.2	7.1e-48
6078:6137	attL	CAACCAACAAGGGAGTTTATGAAGCAAGATGTGACGGCTTACATGAAATATTACAACTTG	NA	NA	NA	NA
WP_006087354.1|6436_7693_+	Y-family DNA polymerase	NA	A0A218MNF2	uncultured_virus	41.2	1.4e-86
WP_011979505.1|8212_8944_+	endonuclease	NA	NA	NA	NA	NA
WP_011979506.1|8958_9192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979507.1|9582_11463_+	ParB N-terminal domain-containing protein	NA	A0A0F7L836	uncultured_marine_virus	34.9	2.0e-12
WP_011979508.1|11587_12043_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_011979509.1|12044_12533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979510.1|12563_12785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012589009.1|13460_14084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979512.1|14085_14487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979513.1|14856_15150_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011979514.1|15130_15640_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011979515.1|15752_15980_+	hypothetical protein	NA	K7P880	Enterobacteria_phage	41.1	5.6e-10
WP_011979516.1|16554_17553_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	3.1e-52
WP_011979517.1|17601_17901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006087379.1|18458_18818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012197956.1|18838_24799_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_006087381.1|24857_25037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197957.1|25050_27177_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_012197958.1|27196_27892_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012197959.1|27894_28428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197960.1|28465_31285_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_012197961.1|31287_32676_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_014358133.1|32672_32849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197893.1|32860_33298_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_012197962.1|33311_34187_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_012197963.1|34183_35998_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_012197964.1|35994_36735_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_012197965.1|36757_37771_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_012197898.1|37757_38462_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_012592943.1|38458_38830_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_012197967.1|38831_41420_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_012197968.1|41423_41867_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_012197969.1|41899_43429_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_012197970.1|43425_44241_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_012197971.1|44240_44807_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_012197972.1|44847_45150_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_012197973.1|45153_45525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197974.1|45579_45756_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_012197975.1|45917_46562_+	LexA family transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	28.1	9.4e-18
WP_012197976.1|47004_47739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012592954.1|48484_48640_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_011979484.1|48974_49244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080514264.1|49332_49752_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_011979485.1|50036_50411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011839979.1|50407_50977_-	ParA family protein	NA	A0A1B3B0Z9	Gordonia_phage	45.1	3.5e-08
WP_012197978.1|51701_52835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012197979.1|52844_54035_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012197980.1|54525_55485_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.6	7.1e-54
WP_150102380.1|55640_55919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979489.1|56065_56686_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011979490.1|56778_57051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979491.1|57377_57620_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	60.0	8.4e-20
WP_011979492.1|57609_57894_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	67.0	6.2e-30
WP_011979493.1|58092_59016_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	81.8	1.3e-148
WP_011979494.1|59219_60248_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
59075:59139	attR	CAAGTTGTAATATTTCATGTAAGCCGTCACATCTTGCTTCATAAACTCCCTTGTTGGTTGTAGTG	NA	NA	NA	NA
WP_086012321.1|60471_61649_-|transposase	IS3-like element ISSba5 family transposase	transposase	Q716C2	Shigella_phage	65.5	1.2e-119
WP_011979497.1|63319_64192_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.1	1.4e-40
