The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010084	Burkholderia multivorans ATCC 17616 chromosome 1, complete sequence	3448466	1984188	2028608	3448466	terminase,head,integrase,transposase	Burkholderia_phage(54.35%)	63	1975059:1975075	1996024:1996040
1975059:1975075	attL	CTGCAGCGCCTGCTCGG	NA	NA	NA	NA
WP_012213493.1|1984188_1985220_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	38.6	1.4e-55
WP_012213494.1|1985180_1985693_-	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	90.3	4.6e-60
WP_012213495.1|1985689_1986235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213496.1|1986231_1986729_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	89.7	1.1e-79
WP_006495243.1|1986721_1986904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213497.1|1987088_1988222_+	acyltransferase	NA	A9YX16	Burkholderia_phage	34.3	2.9e-30
WP_012213498.1|1988169_1988454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213500.1|1989170_1990679_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	37.5	7.5e-74
WP_012213501.1|1990678_1991860_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.9	7.6e-199
WP_012213502.1|1991856_1992210_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	94.0	2.4e-55
WP_012213503.1|1992248_1992761_-	Rha family transcriptional regulator	NA	A0A1D8EX53	Mycobacterium_phage	34.3	6.8e-11
WP_012467598.1|1992903_1993644_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	87.4	2.0e-117
WP_012213505.1|1993654_1994056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012213506.1|1994052_1995021_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	54.9	1.9e-83
WP_012213507.1|1995206_1995440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212527.1|1995657_1996824_+|transposase	IS256-like element IS406 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.3	2.9e-65
1996024:1996040	attR	CTGCAGCGCCTGCTCGG	NA	NA	NA	NA
WP_012213509.1|1997079_1997385_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	49.5	4.9e-17
WP_012467597.1|1997384_1997963_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	44.3	1.1e-25
WP_012213511.1|1997959_1999993_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.8	1.1e-38
WP_012213512.1|2000176_2000740_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	34.2	3.1e-17
WP_012213513.1|2000742_2001186_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.3	2.2e-42
WP_012213514.1|2001198_2002674_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	34.5	5.6e-66
WP_012213515.1|2002683_2003274_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	92.9	7.4e-102
WP_012213516.1|2003278_2003650_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	92.7	1.2e-62
WP_012213517.1|2003711_2004194_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.1	1.9e-71
WP_012213518.1|2004221_2004605_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	91.3	4.1e-61
WP_012213519.1|2004613_2004886_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	72.0	1.2e-14
WP_012213520.1|2004887_2005925_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.7	2.6e-126
WP_012213521.1|2005935_2006424_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	55.6	6.2e-38
WP_012213522.1|2006436_2007720_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	44.0	4.0e-68
WP_146123912.1|2007721_2008366_-|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	68.2	5.1e-72
WP_012213524.1|2008304_2009885_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.7	5.0e-153
WP_012213525.1|2009881_2011477_-	hypothetical protein	NA	A9YWZ6	Burkholderia_phage	90.6	2.9e-294
WP_012213526.1|2011478_2012042_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	66.5	9.6e-59
WP_012213527.1|2012128_2012308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213528.1|2012434_2012866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012467594.1|2012862_2013156_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	62.2	1.3e-22
WP_012213530.1|2013202_2013673_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	81.4	1.4e-63
WP_012213531.1|2013669_2014290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213532.1|2014258_2015119_-	YdaU family protein	NA	NA	NA	NA	NA
WP_012467593.1|2015115_2015319_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	80.6	1.0e-26
WP_012213534.1|2015321_2015696_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	87.1	4.1e-58
WP_012467592.1|2015806_2016283_-	Fis family transcriptional regulator	NA	U5PXM5	Bacillus_phage	38.3	3.5e-17
WP_012467591.1|2016297_2016636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155295605.1|2016632_2016800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012467590.1|2017108_2017849_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	38.7	1.5e-35
WP_146123906.1|2018086_2018425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146123908.1|2019011_2019200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213540.1|2019818_2020115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012213541.1|2020246_2021005_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	89.3	2.1e-53
WP_012467588.1|2021033_2021252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155295604.1|2021281_2021458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012467587.1|2021487_2021757_+	hypothetical protein	NA	A0A2R2YAV1	Pseudomonas_phage	49.4	3.7e-16
WP_012213543.1|2021804_2022167_+	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	93.9	9.0e-18
WP_012213544.1|2022166_2022481_+	hypothetical protein	NA	Q3HQW7	Burkholderia_phage	100.0	3.4e-53
WP_012213545.1|2022480_2022723_+	hypothetical protein	NA	I6NVM7	Burkholderia_virus	62.8	3.2e-19
WP_012213547.1|2023384_2024197_+	exonuclease VIII	NA	G8CLD3	Synechococcus_phage	40.5	4.6e-46
WP_012213548.1|2024202_2025252_+	DNA recombination protein RecT	NA	Q858E1	Salmonella_phage	49.0	1.8e-58
WP_044582615.1|2026071_2026362_+	hypothetical protein	NA	D0Q1A0	Vibrio_phage	41.4	1.3e-11
WP_012213551.1|2026473_2027781_+	hypothetical protein	NA	A9YWU7	Burkholderia_phage	68.4	6.4e-21
WP_012467583.1|2027777_2028008_+	hypothetical protein	NA	A9YWU6	Burkholderia_phage	52.8	1.1e-13
WP_012213552.1|2028000_2028351_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_012213553.1|2028347_2028608_+	hypothetical protein	NA	Q3HQV9	Burkholderia_phage	96.5	4.2e-41
>prophage 2
NC_010084	Burkholderia multivorans ATCC 17616 chromosome 1, complete sequence	3448466	2446675	2496787	3448466	tRNA,integrase,transposase	Acidithiobacillus_phage(25.0%)	52	2491786:2491845	2496782:2498149
WP_006400700.1|2446675_2447470_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_006406230.1|2447471_2448143_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_006400702.1|2448185_2448440_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_012213827.1|2448595_2449735_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006414360.1|2449844_2450312_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_012213829.1|2450349_2451528_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_012213830.1|2451827_2452793_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006400706.1|2452809_2453298_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012213831.1|2453443_2454730_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_012213832.1|2454934_2455870_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_012213833.1|2455885_2456635_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_012213834.1|2456863_2457661_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012213835.1|2457689_2458343_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_006414351.1|2458332_2459367_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.0e-26
WP_012213836.1|2459584_2460493_+	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.4	2.1e-15
WP_006413194.1|2460514_2461438_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	33.6	6.7e-41
WP_088931501.1|2461484_2462816_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006413203.1|2462897_2463800_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	4.8e-52
WP_012213838.1|2464010_2464388_-	competence protein ComE	NA	NA	NA	NA	NA
WP_006400719.1|2464463_2465456_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	6.9e-28
WP_006413209.1|2465504_2466455_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	1.2e-16
WP_012213840.1|2466462_2467863_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.7	2.3e-77
WP_006400722.1|2467952_2469125_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_006400723.1|2469179_2469473_-	LapA family protein	NA	NA	NA	NA	NA
WP_006400726.1|2469685_2470009_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_006400727.1|2470031_2471744_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_006400728.1|2471885_2472572_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_012213841.1|2472584_2473889_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012467535.1|2473902_2474829_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006400731.1|2475012_2476095_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_012213843.1|2476130_2477213_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.7	1.0e-85
WP_006413207.1|2477387_2477987_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_012213844.1|2478090_2480694_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.7	2.1e-100
WP_006400736.1|2481217_2481886_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006400737.1|2482040_2482739_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_012213845.1|2482752_2483469_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_012213846.1|2484124_2484460_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.2	5.8e-27
WP_012213847.1|2484462_2484870_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012213848.1|2484912_2485284_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_012213849.1|2485296_2485581_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_012213850.1|2485577_2485799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012213851.1|2485799_2486276_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	45.7	7.4e-28
WP_012213852.1|2486272_2486644_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	68.3	5.4e-42
WP_044055344.1|2487506_2488928_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	67.9	4.3e-188
WP_012213855.1|2488924_2490190_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	83.1	1.9e-208
WP_012213856.1|2490153_2490462_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	73.5	6.0e-39
WP_012213857.1|2490665_2491850_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.9	6.0e-10
2491786:2491845	attL	GATTGTGCAACCTCTTTTCTGTAAATTTCCGGATTGGCGGTCATGACATTCGGGTTACGG	NA	NA	NA	NA
WP_012212527.1|2491839_2493006_-|transposase	IS256-like element IS406 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.3	2.9e-65
WP_146123848.1|2493151_2493628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213858.1|2493566_2494436_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	25.1	7.0e-08
WP_012213859.1|2494432_2495347_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012212527.1|2495620_2496787_+|transposase	IS256-like element IS406 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.3	2.9e-65
2496782:2498149	attR	CCGTAACCCGAATGTCATGACCGCCAATCCGGAAATTTACAGAAAAGAGGTTGCACAATCGTCGAGGAAGCTGACAAAGTCGGAGCAGATGGCTAGAGTCAGAAGCCGGAACACGGCTCCCGAGCTAGCACTCCGTCGTGCTCTTTGGCATCAAGGACTCCGATATCGGCTGACGCCGAAGCTTCCAGGCACACCCGATCTGTGCTTCGTGACTAAACGGGTTGCCATATTCGTGGACGGATGTTTCTGGCACGGTTGTCCGCAGCATTATTCCGCACCTGCCCAGAACGCGGAATTCTGGTCCCATAAGGTTGCCAGTAATATTACCAGGGACAGAAAGGCAGATGCAGCATTAGAAGCTGAAGGCTGGACCGTTATGAGGGTTTGGGAACACGAGCTGAAATCGCACTTGGCCGACGTGGTGGCGCGGATCGAAGCATTACTTGATGCAAAGAATTGAAGTAATCGAGAAAAATAAGAGATCCCGCTCAATAGATTGAAGGAATAAATATTAATGCGTTTCATTGCGGGTCCCCTCAACAAGCAACTACTGCAAAACCTGCTGGCTGAGGTTATCGAACCTTGTACGCGCGTTCGTGCTGCGGTCGCCTATGCCAGCCGCGACAATATGCAGTTGTTCGAAGCCTGCGCGCGGCATTTGAAGCCGCTGGAGTTCTTCGGCCGCTACGACCACACCGTGGCCGTCGACCCAACGGTGTTGAAGTGGTTTCTGGACATGGCCAGCCCGAACTTCGACTGCAAGCTCGTTCCTGACATCCTGCACGCGAAGGTCATCTGGTGGGTGGATGCCGGAGCGTACATCGGTTCTGCCAATCTGTCTGACCGGGCCTGGATCTCAAACATCGAAGCGGGTACCTTTCTGCCACACGATGAGCTGGTCGAGACAGGTATGGAACGAGAGTTGCTGCGCTTTTTCGAGGAAGTGGATGACCGCGCACGGCCACTGACCAAAGAGATCTATCAAGAGCAGGTGCGCTTGGCAGACCGGCGGACAGAACTTTCAAAGCGCGAATACGGGCTTGAACAGCAGTTCGATAAGGATCGCTTGTTGCCGAAGAACCAGGGGCTTGTATTCGTCGACACGAAGCGTTCGTCCGAGAAGCGGTTCCAGAAGTTCGAGCAGGACTGGAACGACACGCTGCAGGTGATGCGATCCATCGCATCCAGAGTTTCGGCGCCGGAAGTAAAGCCGGACTGGATCAACGCTTCGGTAGCCCCAGGCGTTCAAGCGGACCAGTTCCTCCACGCCTACTACTACAAGCAGGTCAAGGACGGTAACCGTCACCCCTATGAAGAGTTCTTCGCCAGGAACTCCAAGAATCCGGAGCTGGCGTTACGAGACGCGTT	NA	NA	NA	NA
>prophage 3
NC_010084	Burkholderia multivorans ATCC 17616 chromosome 1, complete sequence	3448466	2518151	2529528	3448466	protease	Acidithiobacillus_phage(33.33%)	12	NA	NA
WP_012213876.1|2518151_2520959_+	GGDEF and EAL domain-containing protein	NA	G3MA91	Bacillus_virus	38.7	2.1e-29
WP_012213877.1|2521143_2521644_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_012213878.1|2521621_2522587_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_012213879.1|2522611_2523763_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	3.6e-28
WP_012213880.1|2523781_2524246_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	82.0	7.6e-70
WP_012213881.1|2524242_2524719_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	88.6	2.1e-75
WP_012213882.1|2524715_2525018_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	77.3	4.1e-24
WP_080512248.1|2526028_2526790_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	41.4	5.2e-23
WP_006414862.1|2526798_2527521_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.8	3.2e-91
WP_006414858.1|2527513_2527936_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	4.5e-53
WP_006414875.1|2527952_2529029_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012213885.1|2529039_2529528_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.2	9.3e-26
>prophage 4
NC_010084	Burkholderia multivorans ATCC 17616 chromosome 1, complete sequence	3448466	2862117	2871088	3448466		unidentified_phage(16.67%)	7	NA	NA
WP_012214075.1|2862117_2863656_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.7	4.7e-23
WP_006417097.1|2863691_2864231_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006417105.1|2864227_2864914_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	30.1	2.7e-07
WP_012214076.1|2864960_2865776_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.9e-37
WP_012214077.1|2865880_2867743_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	38.1	7.6e-60
WP_006417099.1|2867746_2868877_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.0	2.8e-25
WP_006401601.1|2869141_2871088_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	51.2	2.7e-148
>prophage 5
NC_010084	Burkholderia multivorans ATCC 17616 chromosome 1, complete sequence	3448466	3151860	3217232	3448466	tRNA,plate,transposase	Pseudomonas_phage(14.29%)	50	NA	NA
WP_012214219.1|3151860_3153159_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_012214220.1|3153241_3154324_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.3e-06
WP_012214221.1|3154334_3155177_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006400503.1|3155244_3155556_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006414108.1|3155569_3156166_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_012214222.1|3156384_3157176_+	dioxygenase	NA	NA	NA	NA	NA
WP_012214223.1|3157331_3158930_-	APC family permease	NA	NA	NA	NA	NA
WP_006400508.1|3159352_3159556_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_012467454.1|3159667_3160918_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_012467453.1|3161065_3161671_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012214226.1|3161817_3163101_-	MFS transporter	NA	NA	NA	NA	NA
WP_012214227.1|3163313_3163934_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012214228.1|3163989_3164562_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_006414122.1|3164612_3165503_-	methyltransferase	NA	NA	NA	NA	NA
WP_012214229.1|3165592_3166726_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012467452.1|3166835_3167333_-	lipoprotein	NA	NA	NA	NA	NA
WP_012214231.1|3167976_3170148_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.1e-49
WP_012467450.1|3170274_3171303_-	transporter	NA	NA	NA	NA	NA
WP_012214232.1|3171516_3172491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006400523.1|3172612_3173458_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_012214233.1|3173756_3177704_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006400525.1|3177700_3178690_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_012214234.1|3178694_3179645_+	OmpA family protein	NA	NA	NA	NA	NA
WP_044055362.1|3179820_3180669_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_105840172.1|3180817_3181591_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_123791098.1|3181994_3182207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012467447.1|3182971_3183328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044055363.1|3183472_3184306_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012214240.1|3184520_3185336_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012467445.1|3185789_3186557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012214244.1|3189493_3191788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012214245.1|3191780_3192632_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012214246.1|3192876_3193917_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012214247.1|3193916_3196478_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.2	5.9e-55
WP_012214248.1|3196546_3197668_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012214249.1|3197706_3200376_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	30.9	1.7e-89
WP_006400543.1|3200420_3201521_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012214250.1|3201484_3203320_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006400545.1|3203398_3203884_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006400546.1|3203946_3204450_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006400547.1|3204521_3206012_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006406960.1|3206027_3206543_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006400549.1|3206578_3207211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012214251.1|3207586_3208198_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012214252.1|3208300_3209647_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006400552.1|3209643_3210426_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012467443.1|3210512_3210821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012214254.1|3211190_3212450_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_006414323.1|3215142_3215757_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_088931498.1|3215868_3217232_-|transposase	IS3-like element ISBmu5 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.3	7.7e-78
>prophage 1
NC_010086	Burkholderia multivorans ATCC 17616 chromosome 2, complete sequence	2472928	810046	880489	2472928	terminase,tail,capsid,plate,transposase,portal,protease,holin,head	Burkholderia_phage(93.44%)	83	NA	NA
WP_012216670.1|810046_810334_-	hypothetical protein	NA	Q3HQV5	Burkholderia_phage	100.0	2.1e-46
WP_012467997.1|810473_810893_-	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	100.0	4.3e-80
WP_012467996.1|810889_811333_-	hypothetical protein	NA	Q3HQV8	Burkholderia_phage	100.0	2.4e-73
WP_012216673.1|811333_811594_-	hypothetical protein	NA	Q3HQV9	Burkholderia_phage	100.0	4.4e-43
WP_012216674.1|811612_812152_-	hypothetical protein	NA	Q3HQW0	Burkholderia_phage	100.0	1.2e-98
WP_012216675.1|812148_813333_-	hypothetical protein	NA	Q3HQW1	Burkholderia_phage	100.0	3.1e-232
WP_012216676.1|813329_813680_-	hypothetical protein	NA	Q3HQW2	Burkholderia_phage	100.0	3.5e-59
WP_012216677.1|813698_814178_-	DNA methylase	NA	Q3HQW3	Burkholderia_phage	99.4	3.3e-92
WP_012216679.1|814748_815063_-	hypothetical protein	NA	Q3HQW7	Burkholderia_phage	100.0	1.2e-53
WP_012216680.1|815062_815380_-	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	100.0	4.9e-52
WP_012216681.1|815376_815652_-	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	100.0	3.8e-45
WP_012216682.1|815699_816044_-	hypothetical protein	NA	Q3HQX0	Burkholderia_phage	100.0	5.0e-58
WP_012216683.1|816072_816819_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	100.0	2.2e-71
WP_012467991.1|817356_817821_+	hypothetical protein	NA	Q3HQX4	Burkholderia_phage	100.0	8.7e-82
WP_012216686.1|818736_819150_-	hypothetical protein	NA	Q3HQY0	Burkholderia_phage	100.0	1.6e-71
WP_012216687.1|819390_819729_+	hypothetical protein	NA	A4JX41	Burkholderia_virus	69.1	8.1e-37
WP_012216689.1|820139_820676_-	hypothetical protein	NA	Q3HQY5	Burkholderia_phage	100.0	7.9e-95
WP_012467984.1|821281_821749_-	helix-turn-helix transcriptional regulator	NA	Q3HQY7	Burkholderia_phage	100.0	7.2e-84
WP_049942649.1|821807_822005_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012467982.1|822261_822633_-	DUF2513 domain-containing protein	NA	Q3HQY9	Burkholderia_phage	100.0	1.1e-66
WP_012467981.1|822716_823058_-	hypothetical protein	NA	Q3HQZ0	Burkholderia_phage	100.0	3.1e-60
WP_049773223.1|823091_823283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012216693.1|823325_823562_-	hypothetical protein	NA	Q3HQZ2	Burkholderia_phage	100.0	8.7e-38
WP_012216694.1|823750_824197_+	hypothetical protein	NA	Q3HQZ3	Burkholderia_phage	100.0	2.7e-80
WP_012216695.1|824478_825285_+	helix-turn-helix domain-containing protein	NA	Q3HQZ6	Burkholderia_phage	100.0	3.6e-152
WP_012216696.1|825281_825929_+	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	100.0	7.5e-124
WP_012216697.1|826098_826662_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	100.0	4.0e-105
WP_012216698.1|826661_827132_+	hypothetical protein	NA	Q3HR00	Burkholderia_phage	100.0	1.1e-81
WP_012216699.1|827128_827710_+	ArsR family transcriptional regulator	NA	Q3HR01	Burkholderia_phage	100.0	2.2e-106
WP_012216700.1|827706_828150_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	100.0	8.9e-84
WP_012467976.1|828146_828485_+	hypothetical protein	NA	Q3HR03	Burkholderia_phage	100.0	1.3e-58
WP_012216702.1|828481_828730_+	hypothetical protein	NA	Q3HR04	Burkholderia_phage	100.0	3.2e-43
WP_012216703.1|828775_829366_+	hypothetical protein	NA	Q3HR05	Burkholderia_phage	100.0	1.2e-107
WP_012216704.1|829583_829973_+	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	100.0	3.2e-69
WP_012216705.1|830134_830614_+|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	99.3	2.2e-72
WP_012216706.1|830613_832326_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	100.0	0.0e+00
WP_012467974.1|832333_833629_+|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	100.0	3.3e-248
WP_012216708.1|833606_834449_+|protease	Clp protease ClpP	protease	Q3HQS9	Burkholderia_phage	100.0	4.7e-150
WP_012216709.1|834453_835731_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	100.0	4.3e-240
WP_012216711.1|835972_836314_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	100.0	4.3e-54
WP_012216712.1|836316_836646_+|head	phage head closure protein	head	Q3HQT3	Burkholderia_phage	100.0	1.5e-56
WP_012216713.1|836638_837061_+	HK97 gp10 family phage protein	NA	Q3HQT4	Burkholderia_phage	100.0	1.0e-68
WP_012216714.1|837057_837402_+	DUF3168 domain-containing protein	NA	Q3HQT5	Burkholderia_phage	100.0	2.3e-55
WP_012216715.1|837458_837923_+	hypothetical protein	NA	Q3HQT6	Burkholderia_phage	100.0	3.1e-79
WP_012216716.1|837951_838416_+|tail	tail assembly protein	tail	Q3HQT7	Burkholderia_phage	100.0	2.7e-83
WP_012216717.1|838412_838691_+	DUF4035 domain-containing protein	NA	Q3HQT8	Burkholderia_phage	100.0	2.8e-43
WP_012216718.1|838703_842846_+|tail	phage tail tape measure protein	tail	Q3HQT9	Burkholderia_phage	100.0	0.0e+00
WP_012216719.1|842845_843184_+|tail	phage tail protein	tail	Q3HQU0	Burkholderia_phage	100.0	1.0e-60
WP_012216720.1|843192_844200_+	hypothetical protein	NA	Q3HQU1	Burkholderia_phage	100.0	1.8e-188
WP_012216721.1|844242_844926_+|tail	phage minor tail protein L	tail	Q3HQU2	Burkholderia_phage	100.0	1.1e-125
WP_012216722.1|844974_845727_+	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	100.0	3.8e-151
WP_012216723.1|845723_846287_+|tail	tail assembly protein	tail	Q3HQU4	Burkholderia_phage	100.0	3.6e-98
WP_012216724.1|846283_849586_+|tail	phage tail protein	tail	Q3HQU5	Burkholderia_phage	100.0	0.0e+00
WP_012467973.1|849579_849894_+	hypothetical protein	NA	Q3HQU6	Burkholderia_phage	100.0	3.4e-53
WP_012216726.1|849893_850610_+	hypothetical protein	NA	Q3HQU7	Burkholderia_phage	100.0	1.4e-139
WP_012216727.1|850650_850863_+|holin	class II holin gp23	holin	Q3HQU8	Burkholderia_phage	100.0	1.3e-29
WP_012216728.1|850855_851353_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	100.0	2.1e-89
WP_012216729.1|851352_851841_+	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	100.0	5.9e-73
WP_012216730.1|851903_852770_+	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	100.0	1.6e-161
WP_012216731.1|853053_854736_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	100.0	0.0e+00
WP_012216733.1|855247_855781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012216734.1|855799_856861_-	alkene reductase	NA	NA	NA	NA	NA
WP_012216735.1|856941_857250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044055643.1|857439_858693_-	MFS transporter	NA	NA	NA	NA	NA
WP_006403125.1|858840_859719_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012216737.1|859741_860881_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_012216738.1|861001_861343_-	cupredoxin family copper-binding protein	NA	NA	NA	NA	NA
WP_012216739.1|861360_862299_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012216740.1|862584_864336_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012216741.1|864347_865700_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.4e-31
WP_012216742.1|865750_866869_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_012467970.1|866865_867939_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012216744.1|867938_869828_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012216745.1|869863_870430_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012216746.1|870539_871184_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_012216747.1|871722_874404_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.9	1.0e-86
WP_012216748.1|874440_874980_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006396708.1|875007_876501_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006396709.1|876593_877079_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012216749.1|877157_877661_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_080512355.1|877692_877956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088931498.1|877855_879218_+|transposase	IS3-like element ISBmu5 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.3	7.7e-78
WP_012216750.1|879238_880489_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NC_010086	Burkholderia multivorans ATCC 17616 chromosome 2, complete sequence	2472928	1837379	1931147	2472928	integrase,transposase	Acidithiobacillus_phage(25.0%)	78	1849033:1849046	1866823:1866836
WP_111442900.1|1837379_1838500_-|transposase	IS3-like element IS407 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.2e-49
WP_012467853.1|1838751_1839444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881665.1|1839376_1840135_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	1.3e-61
WP_012217371.1|1840612_1840978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217373.1|1841300_1842560_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_012217374.1|1842525_1843479_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_011881662.1|1843557_1844415_+	phage Gp37/Gp68 family protein	NA	M4R142	Tetraselmis_viridis_virus	46.9	4.9e-62
WP_011881661.1|1844445_1845717_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_154817385.1|1846001_1846457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011875599.1|1846814_1848371_+|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_006397350.1|1848387_1849137_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
1849033:1849046	attL	CTCGCCGATGCGAT	NA	NA	NA	NA
WP_012211008.1|1849653_1851168_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011875602.1|1851966_1853328_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012213993.1|1854238_1855027_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_011881659.1|1857233_1857887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131754048.1|1858739_1858997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881658.1|1859659_1859917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881657.1|1860061_1862770_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011881656.1|1862777_1863785_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011881655.1|1863787_1865104_+	TniQ family protein	NA	NA	NA	NA	NA
WP_044582768.1|1865213_1865474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217378.1|1865607_1867248_-|transposase	IS66-like element ISBmu30 family transposase	transposase	A0A218MNE7	uncultured_virus	32.7	5.1e-60
1866823:1866836	attR	CTCGCCGATGCGAT	NA	NA	NA	NA
WP_011881652.1|1867338_1867752_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	3.5e-18
WP_080466977.1|1868609_1868843_+	ferredoxin	NA	NA	NA	NA	NA
WP_012467846.1|1868930_1869515_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_080466872.1|1869493_1869649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881650.1|1869816_1871241_-	amino acid permease	NA	NA	NA	NA	NA
WP_011881649.1|1871388_1872228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881648.1|1872247_1872937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881647.1|1872967_1874341_-	amidase	NA	NA	NA	NA	NA
WP_011881646.1|1875619_1876336_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.4	3.7e-15
WP_011881645.1|1876335_1877112_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	9.6e-17
WP_012217380.1|1877132_1878302_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_012467843.1|1878330_1879281_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011881642.1|1879382_1880531_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012467842.1|1880649_1881264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006412423.1|1881466_1882459_-|transposase	IS5-like element ISBmu2 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	5.3e-161
WP_012217382.1|1882502_1882715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881640.1|1882752_1883418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881639.1|1883891_1884815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011881638.1|1885003_1885858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881637.1|1885863_1887192_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011881636.1|1887253_1888522_+	porin	NA	NA	NA	NA	NA
WP_011881635.1|1888571_1889768_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_011881634.1|1890083_1890887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131754044.1|1890885_1891095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881633.1|1891224_1891485_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011881632.1|1891777_1892857_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012467839.1|1892768_1893122_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_011875602.1|1893783_1895145_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012217387.1|1898047_1899568_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.1e-11
WP_011881629.1|1899957_1901292_+	MFS transporter	NA	NA	NA	NA	NA
WP_011881628.1|1901340_1902333_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011881627.1|1902366_1903854_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011881626.1|1903880_1905695_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_011881625.1|1906127_1907111_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011881624.1|1907140_1907953_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011881623.1|1907958_1908741_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	3.8e-13
WP_011881622.1|1908814_1909888_+	porin	NA	NA	NA	NA	NA
WP_012217388.1|1909995_1910370_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012217389.1|1910393_1911653_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_080512330.1|1912434_1912758_-	porin	NA	NA	NA	NA	NA
WP_012217391.1|1912920_1913775_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	66.7	1.9e-45
WP_134163192.1|1913863_1914322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044582753.1|1914741_1915683_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011881614.1|1915759_1916170_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011881613.1|1916437_1916665_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_009687279.1|1917402_1918152_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	2.4e-81
WP_012213865.1|1918167_1919718_-|transposase	IS21-like element ISBmu3 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.4	1.0e-158
WP_080512329.1|1919972_1920569_+	MFS transporter	NA	NA	NA	NA	NA
WP_011881611.1|1920677_1921571_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011881610.1|1921872_1923003_+	MFS transporter	NA	NA	NA	NA	NA
WP_012217396.1|1923028_1924078_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	1.1e-71
WP_011881608.1|1924127_1925117_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011881605.1|1926412_1926889_-	hemerythrin	NA	NA	NA	NA	NA
WP_011881604.1|1927189_1928521_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_011881603.1|1928537_1929713_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_006401211.1|1929887_1931147_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
>prophage 3
NC_010086	Burkholderia multivorans ATCC 17616 chromosome 2, complete sequence	2472928	1944558	1995667	2472928	terminase,tail,capsid,plate,transposase,tRNA,portal,holin,head	Burkholderia_phage(93.75%)	62	NA	NA
WP_006399455.1|1944558_1945599_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.9	1.1e-92
WP_012217400.1|1945703_1946513_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_012467828.1|1946668_1948573_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006399452.1|1948655_1949540_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_006399451.1|1949536_1949818_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_006399450.1|1950088_1951195_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_012217402.1|1951298_1952168_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_006414604.1|1952223_1953099_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_012217403.1|1953327_1954662_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012217404.1|1954944_1957698_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.0	5.2e-73
WP_012217405.1|1957699_1958458_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	38.4	3.0e-23
WP_155295612.1|1958448_1958799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006404136.1|1958812_1959082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217407.1|1959331_1959823_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_012217408.1|1959935_1960499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146122769.1|1961124_1961328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217409.1|1961365_1961689_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	100.0	3.2e-51
WP_012217410.1|1961645_1962665_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	100.0	1.4e-188
WP_012217411.1|1963135_1964188_-|portal	phage portal protein	portal	E5E3S7	Burkholderia_phage	100.0	1.8e-207
WP_012217412.1|1964187_1965954_-|terminase	terminase ATPase subunit family protein	terminase	E5E3S6	Burkholderia_phage	100.0	0.0e+00
WP_012217413.1|1966103_1966925_+|capsid	GPO family capsid scaffolding protein	capsid	E5E3S5	Burkholderia_phage	100.0	5.2e-146
WP_012217414.1|1966962_1967988_+|capsid	phage major capsid protein, P2 family	capsid	E5E3S4	Burkholderia_phage	100.0	3.2e-193
WP_012217415.1|1967984_1968671_+|terminase	terminase endonuclease subunit	terminase	E5E3S3	Burkholderia_phage	100.0	5.0e-126
WP_012217416.1|1968775_1969252_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	100.0	1.6e-83
WP_012467826.1|1969251_1969494_+	hypothetical protein	NA	E5E3S1	Burkholderia_phage	100.0	3.7e-36
WP_012217418.1|1969493_1969706_+|tail	tail protein	tail	E5E3S0	Burkholderia_phage	100.0	1.4e-34
WP_012217419.1|1969708_1970083_+	membrane protein	NA	E5E3R9	Burkholderia_phage	100.0	9.2e-58
WP_012217420.1|1970082_1970403_+|holin	phage holin family protein	holin	E5E3R8	Burkholderia_phage	100.0	6.0e-50
WP_012217421.1|1970395_1971196_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	100.0	3.3e-145
WP_012217422.1|1971192_1971684_+	hypothetical protein	NA	E5E3R5	Burkholderia_phage	100.0	9.9e-68
WP_012217423.1|1971680_1972091_+|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	100.0	2.2e-73
WP_012217424.1|1972090_1972540_+	phage virion morphogenesis protein	NA	E5E3R3	Burkholderia_phage	100.0	6.0e-72
WP_012217425.1|1972722_1974603_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	100.0	0.0e+00
WP_012217426.1|1974803_1975436_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	100.0	1.2e-118
WP_012217427.1|1975432_1975810_+	hypothetical protein	NA	E5E3R0	Burkholderia_phage	100.0	6.0e-65
WP_012217428.1|1975806_1976712_+|plate	baseplate assembly protein	plate	E5E3Q9	Burkholderia_phage	100.0	8.0e-164
WP_012217429.1|1976704_1977259_+|tail	phage tail protein I	tail	E5E3Q8	Burkholderia_phage	100.0	1.3e-100
WP_012217430.1|1977261_1978872_+|tail	tail protein	tail	E5E3Q7	Burkholderia_phage	100.0	9.9e-266
WP_012217431.1|1978881_1979760_+|tail	tail assembly protein	tail	E5E3Q6	Burkholderia_phage	100.0	5.5e-170
WP_012467825.1|1979906_1980089_+	Com family DNA-binding transcriptional regulator	NA	E5E3Q5	Burkholderia_phage	100.0	9.7e-29
WP_012217432.1|1980066_1980816_+	site-specific DNA-methyltransferase	NA	E5E3Q4	Burkholderia_phage	100.0	3.1e-145
WP_012217433.1|1980926_1982099_+|tail	phage tail sheath protein	tail	E5E3Q3	Burkholderia_phage	100.0	4.5e-228
WP_012217434.1|1982128_1982638_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	100.0	1.2e-92
WP_012217435.1|1982670_1982982_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	100.0	4.6e-47
WP_012217436.1|1982978_1983101_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	97.5	5.3e-15
WP_012217437.1|1983097_1985860_+	hypothetical protein	NA	E5E3P9	Burkholderia_phage	100.0	0.0e+00
WP_006416694.1|1985873_1986302_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	100.0	7.3e-75
WP_012217438.1|1986298_1987450_+	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	100.0	7.9e-201
WP_044055797.1|1987462_1987708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007182917.1|1987753_1988746_-|transposase	IS5-like element ISBmu23 family transposase	transposase	E5E3P6	Burkholderia_phage	100.0	1.3e-186
WP_012217439.1|1988775_1989342_-	hypothetical protein	NA	A0A089FKT7	Burkholderia_phage	41.3	7.5e-11
WP_012217440.1|1989402_1990149_-	alpha/beta hydrolase	NA	E5E3P5	Burkholderia_phage	100.0	3.7e-135
WP_044055800.1|1990205_1990661_-	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	100.0	4.8e-77
WP_088931528.1|1990785_1990980_+	hypothetical protein	NA	E5E3P3	Burkholderia_phage	98.4	3.7e-26
WP_006416695.1|1990983_1991262_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	100.0	2.4e-47
WP_012217442.1|1991271_1991520_+	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	100.0	8.8e-41
WP_012217443.1|1991609_1991804_+	hypothetical protein	NA	E5E3P0	Burkholderia_phage	100.0	2.1e-29
WP_012217444.1|1991807_1992011_+	hypothetical protein	NA	E5E3N9	Burkholderia_phage	100.0	2.4e-28
WP_012217445.1|1992053_1992248_+	hypothetical protein	NA	E5E3N8	Burkholderia_phage	100.0	9.7e-27
WP_006416680.1|1992252_1992612_+	hypothetical protein	NA	E5E3N7	Burkholderia_phage	100.0	3.6e-59
WP_012217446.1|1992608_1992869_+	hypothetical protein	NA	E5E3N6	Burkholderia_phage	100.0	1.3e-39
WP_012217447.1|1992871_1995667_+	zinc finger CHC2-family protein	NA	E5E3N5	Burkholderia_phage	100.0	0.0e+00
>prophage 1
NC_010087	Burkholderia multivorans ATCC 17616 chromosome 3, complete sequence	919806	293053	344729	919806	transposase	Burkholderia_phage(18.18%)	52	NA	NA
WP_006412423.1|293053_294046_-|transposase	IS5-like element ISBmu2 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	5.3e-161
WP_012217980.1|294172_294754_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_012217981.1|294839_295511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012217982.1|295621_296041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012217983.1|296109_297342_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_105796414.1|297338_297851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044582786.1|298202_298658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012217986.1|299134_300136_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	4.9e-21
WP_012217987.1|300409_302089_+	PRTRC system ParB family protein	NA	NA	NA	NA	NA
WP_012217988.1|302164_302602_+	PRTRC system protein E	NA	NA	NA	NA	NA
WP_012217989.1|302613_302832_+	PRTRC system protein C	NA	NA	NA	NA	NA
WP_012217990.1|302931_304074_+	PRTRC system protein F	NA	NA	NA	NA	NA
WP_012217991.1|304086_304815_+	PRTRC system protein B	NA	NA	NA	NA	NA
WP_012217992.1|304811_305447_+	PRTRC system protein A	NA	NA	NA	NA	NA
WP_012217993.1|305446_306274_+	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_012217994.1|306542_307004_+	membrane protein	NA	NA	NA	NA	NA
WP_012217995.1|307090_307483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217996.1|307492_307966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217997.1|308181_308577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217998.1|308653_310174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217999.1|310188_310656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012218000.1|310910_311162_+	DUF3717 domain-containing protein	NA	NA	NA	NA	NA
WP_012218001.1|311279_312305_+	ATP-binding protein	NA	A0A2I7RB11	Vibrio_phage	31.0	2.0e-30
WP_012218002.1|312408_313338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012218003.1|313345_314554_+	hypothetical protein	NA	A0A0A0YU59	Escherichia_phage	29.5	6.9e-38
WP_012218004.1|314828_315875_+	CpaF family protein	NA	NA	NA	NA	NA
WP_012218005.1|315893_316274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080512404.1|316266_316578_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_012218007.1|316574_319052_+	type IV secretory pathway VirB4 components-like protein	NA	NA	NA	NA	NA
WP_012464924.1|319284_320025_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_012218009.1|320021_321032_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_012218010.1|321031_322372_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_012218011.1|322368_324237_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_012218012.1|324247_324763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012218014.1|324972_325578_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_012218015.1|325932_326826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006412423.1|327193_328186_+|transposase	IS5-like element ISBmu2 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	5.3e-161
WP_012218017.1|328223_329360_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012218018.1|329789_330668_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_012218021.1|331946_333068_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_146122784.1|333104_333509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105795672.1|333840_334560_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.8	3.4e-40
WP_011875599.1|335021_336578_+|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_006397350.1|336594_337344_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_012218025.1|337421_337580_-	excinuclease ABC subunit A2 UvrA	NA	NA	NA	NA	NA
WP_012218026.1|337638_338973_-	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_012218027.1|339158_339557_-	VOC family protein	NA	NA	NA	NA	NA
WP_003291553.1|339600_340710_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.6	1.7e-35
WP_012218028.1|340769_340994_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_012218029.1|341054_341798_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.7	6.6e-07
WP_012213101.1|341840_343046_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_105796968.1|343609_344729_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	1.6e-49
>prophage 2
NC_010087	Burkholderia multivorans ATCC 17616 chromosome 3, complete sequence	919806	347940	402745	919806	integrase,transposase	uncultured_Caudovirales_phage(41.67%)	52	359060:359076	378904:378920
WP_105796968.1|347940_349061_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	1.6e-49
WP_012464918.1|349196_350321_-	alkene reductase	NA	NA	NA	NA	NA
WP_105797467.1|350513_350771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218036.1|350815_351826_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012218037.1|351937_352861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012218038.1|352916_353210_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012218039.1|353292_354255_+|transposase	IS5-like element ISBmu20 family transposase	transposase	A0A077K814	Ralstonia_phage	67.4	1.4e-118
WP_012218040.1|355102_356116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007182542.1|356179_356482_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012218041.1|356879_358418_-|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
359060:359076	attL	AGGTCGACTTCGGCGCG	NA	NA	NA	NA
WP_012213993.1|360160_360949_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_144245473.1|361222_361540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012464917.1|361918_362215_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_038442260.1|363046_363265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218045.1|363325_363613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012464916.1|363605_363920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105796824.1|364718_366686_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_155295623.1|366954_367281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038442266.1|367560_367761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007180368.1|367974_369060_-|transposase	IS630-like element ISBmu8 family transposase	transposase	NA	NA	NA	NA
WP_012464914.1|369157_369388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218049.1|369959_370910_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_012218050.1|370952_372425_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012464913.1|372421_372589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044582784.1|372800_373070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012218051.1|373049_374159_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	52.5	3.7e-78
WP_012218052.1|374177_374588_-	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_012218053.1|374607_376371_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_012218054.1|376380_376749_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_012464912.1|376917_377640_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	1.8e-97
WP_012218056.1|377632_378055_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	4.4e-48
WP_012464911.1|378075_379146_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
378904:378920	attR	CGCGCCGAAGTCGACCT	NA	NA	NA	NA
WP_012218058.1|379220_379715_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.6	3.2e-26
WP_012218059.1|379725_380220_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	40.6	6.7e-24
WP_012218060.1|380429_380771_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012464910.1|380958_381321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012218062.1|381532_382318_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012218063.1|382430_384920_-	arsenate reductase (azurin) large subunit	NA	NA	NA	NA	NA
WP_012464909.1|384931_385438_-	arsenate reductase (azurin) small subunit	NA	NA	NA	NA	NA
WP_012218065.1|386455_386842_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_012464908.1|386910_387606_-	cytochrome c4	NA	NA	NA	NA	NA
WP_012218067.1|387783_388314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218068.1|388628_391568_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	20.5	8.9e-31
WP_012218069.1|391873_392200_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012218070.1|392374_392725_-	copper-binding protein	NA	NA	NA	NA	NA
WP_012218071.1|392721_395928_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.9	6.9e-61
WP_012218072.1|395924_397454_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012218073.1|397465_398758_-	TolC family protein	NA	NA	NA	NA	NA
WP_012218074.1|398849_399218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038442271.1|399585_399906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954470.1|399951_400769_-|transposase	IS5-like element ISBcen20 family transposase	transposase	NA	NA	NA	NA
WP_006412423.1|401752_402745_+|transposase	IS5-like element ISBmu2 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	5.3e-161
>prophage 3
NC_010087	Burkholderia multivorans ATCC 17616 chromosome 3, complete sequence	919806	408657	446622	919806	integrase,transposase	uncultured_Caudovirales_phage(54.55%)	39	422115:422129	430412:430426
WP_012218083.1|408657_409338_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012464905.1|409502_409829_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012218085.1|409959_410751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012464904.1|410923_411118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218086.1|412010_412517_+	arsenate reductase (azurin) small subunit	NA	NA	NA	NA	NA
WP_012218087.1|412528_415018_+	arsenate reductase (azurin) large subunit	NA	NA	NA	NA	NA
WP_012218088.1|415162_415504_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012218089.1|415500_415980_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_012218090.1|415989_416484_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	41.9	3.0e-24
WP_012218091.1|416500_416995_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	47.1	6.5e-27
WP_012218092.1|417059_418133_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012218093.1|418154_418577_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	3.8e-52
WP_012218094.1|418554_419292_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.1	5.6e-99
WP_012218095.1|419314_419743_+	GNAT family N-acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	36.8	1.1e-09
WP_012218096.1|419882_420320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218097.1|420316_422269_-|integrase	integrase	integrase	NA	NA	NA	NA
422115:422129	attL	TCAGCCGGCGGGATG	NA	NA	NA	NA
WP_012211008.1|423421_424936_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_012211009.1|424932_425784_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.6	5.8e-31
WP_012218100.1|427074_428253_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_048803595.1|428249_428480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157047539.1|428643_428790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155295621.1|428792_429215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143331196.1|429338_429938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146123885.1|429912_430266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086558246.1|430350_431582_-|transposase	IS3-like element IS401 family transposase	transposase	Q8W6R2	Burkholderia_virus	80.7	2.8e-127
430412:430426	attR	TCAGCCGGCGGGATG	NA	NA	NA	NA
WP_044056130.1|431594_431858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007180368.1|431929_433015_+|transposase	IS630-like element ISBmu8 family transposase	transposase	NA	NA	NA	NA
WP_012212527.1|433655_434822_+|transposase	IS256-like element IS406 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	40.3	2.9e-65
WP_012218108.1|434852_437459_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	1.2e-50
WP_012218109.1|437739_438159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049773231.1|439053_439239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012218112.1|439376_440240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218113.1|440329_440581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143331197.1|440543_441131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218114.1|441127_441796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218115.1|441828_442362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012218119.1|443810_444272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217389.1|444478_445738_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_012218120.1|445707_446622_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.2	3.0e-54
>prophage 4
NC_010087	Burkholderia multivorans ATCC 17616 chromosome 3, complete sequence	919806	465327	527450	919806	integrase,transposase	Bacillus_phage(14.29%)	43	461840:461856	510198:510214
461840:461856	attL	GCGCCGCGCGGCCGGCC	NA	NA	NA	NA
WP_012218041.1|465327_466866_-|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
WP_141717005.1|466856_467123_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	48.1	2.0e-06
WP_007182911.1|467377_468178_-	cytochrome c4	NA	NA	NA	NA	NA
WP_007182912.1|468174_469800_-	b(o/a)3-type cytochrome-c oxidase subunit 1	NA	NA	NA	NA	NA
WP_011880240.1|469789_470377_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_007182914.1|470387_470588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007182915.1|470597_471941_-	cytochrome c	NA	NA	NA	NA	NA
WP_007182916.1|471937_472645_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_011880238.1|473532_474171_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011880236.1|474830_475130_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012218130.1|475231_475726_+	response regulator	NA	NA	NA	NA	NA
WP_012218131.1|476172_476595_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_012218132.1|476687_477761_-	membrane protein	NA	NA	NA	NA	NA
WP_012218134.1|478870_479206_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012218135.1|479235_479943_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_085954470.1|480977_481795_-|transposase	IS5-like element ISBcen20 family transposase	transposase	NA	NA	NA	NA
WP_012218137.1|482050_482602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218138.1|482669_483647_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012464889.1|483673_485659_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012218140.1|485658_486291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218142.1|487800_490737_-	DEAD/DEAH box helicase family protein	NA	A7WKN6	Acidianus_filamentous_virus	25.3	3.9e-10
WP_006397350.1|491279_492029_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_085954470.1|493078_493896_-|transposase	IS5-like element ISBcen20 family transposase	transposase	NA	NA	NA	NA
WP_044582782.1|496675_497842_-	porin	NA	NA	NA	NA	NA
WP_012218148.1|497869_498532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012218149.1|498675_499875_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	27.5	2.0e-05
WP_012218150.1|499904_502952_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	69.7	0.0e+00
WP_012218151.1|503061_503772_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_012218152.1|504062_504719_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_012218153.1|504755_506144_-	cytosine permease	NA	NA	NA	NA	NA
WP_012218154.1|506275_506926_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012218155.1|507548_508700_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_012218156.1|508740_510402_-	L-lactate permease	NA	NA	NA	NA	NA
510198:510214	attR	GCGCCGCGCGGCCGGCC	NA	NA	NA	NA
WP_012218157.1|510524_511412_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012218160.1|515253_516720_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012464884.1|516854_518192_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_012218162.1|518232_519828_+	MCE family protein	NA	NA	NA	NA	NA
WP_012218163.1|519824_520535_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_012218164.1|520598_521363_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012218165.1|521542_523186_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_012218166.1|523199_524270_+	glyoxalase	NA	NA	NA	NA	NA
WP_012218167.1|524302_525259_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012218169.1|526484_527450_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	34.0	1.8e-17
>prophage 1
NC_010070	Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence	167422	161906	166193	167422		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_012211083.1|161906_162578_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	2.5e-29
WP_009693503.1|162574_163969_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	1.6e-17
WP_012211084.1|164120_164516_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	42.1	1.4e-11
WP_009693505.1|164605_165034_-	GCN5 family acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	32.0	1.8e-09
WP_012211085.1|165055_165793_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.5	3.0e-100
WP_009693508.1|165770_166193_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	2.6e-53
