The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	36845	49232	1815785		Synechococcus_phage(28.57%)	8	NA	NA
WP_044555169.1|36845_40571_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.1	1.6e-40
WP_009880323.1|40804_42259_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_009880322.1|42286_43309_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.7	2.4e-63
WP_009880321.1|43476_44031_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
WP_009880320.1|44214_45762_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_012560364.1|45819_46944_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_044555171.1|47196_48462_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48740_49232_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	336811	342854	1815785		Streptococcus_phage(100.0%)	8	NA	NA
WP_009880727.1|336811_337447_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	62.9	9.2e-66
WP_009880726.1|337464_338340_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	6.1e-68
WP_002985838.1|339003_339327_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_012560474.1|339331_340195_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985833.1|340221_340614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|340660_341290_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|341596_341953_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_044555186.1|342026_342854_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	4.9e-128
>prophage 3
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	364339	372712	1815785		Streptococcus_phage(70.0%)	15	NA	NA
WP_012560490.1|364339_365032_-	DUF3800 domain-containing protein	NA	A0A059T7P7	Listeria_phage	48.9	1.8e-54
WP_012560491.1|365189_365372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009880486.1|365510_365696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560492.1|365739_366108_-	DUF1492 domain-containing protein	NA	A0A2H4J7Z8	uncultured_Caudovirales_phage	37.0	3.0e-08
WP_012560493.1|366618_367032_-	DUF1492 domain-containing protein	NA	A0A1S5S8W3	Streptococcus_phage	30.8	5.1e-09
WP_044555190.1|367137_367545_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	31.6	3.6e-07
WP_009880490.1|367680_368016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009880491.1|367999_368602_-	hypothetical protein	NA	Q9AZG7	Lactococcus_phage	32.4	1.2e-11
WP_011529115.1|368702_368861_-	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_009880492.1|368867_369134_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	46.2	8.9e-15
WP_009880493.1|369314_369488_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	4.3e-10
WP_009880494.1|369775_371464_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	81.8	6.1e-258
WP_012560496.1|371432_372290_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	1.9e-122
WP_009880496.1|372291_372444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009880497.1|372433_372712_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	59.5	2.5e-20
>prophage 4
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	634151	644755	1815785		Streptococcus_phage(57.14%)	9	NA	NA
WP_012560599.1|634151_636362_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	8.5e-268
WP_009880407.1|636469_637633_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.6	1.7e-142
WP_002985140.1|637629_638316_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_009880406.1|638409_639576_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	33.1	2.6e-34
WP_002990260.1|639636_639978_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_012560600.1|640199_641552_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.0e-29
WP_002990257.1|641639_642908_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|642937_643378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560602.1|643612_644755_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	2.4e-24
>prophage 5
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	735285	785704	1815785	integrase,terminase,tail,portal,holin,head,tRNA,capsid	Streptococcus_phage(82.22%)	57	749588:749638	787434:787484
WP_012560634.1|735285_736185_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_012560635.1|736257_737496_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002990114.1|737488_738124_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_009881223.1|738138_739068_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_012560637.1|739829_742040_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.0	2.5e-70
WP_002990109.1|742189_742708_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002984890.1|742788_743472_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_009880671.1|743468_744125_+	endonuclease III	NA	NA	NA	NA	NA
WP_002984888.1|744196_744883_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_012560638.1|744872_745661_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012560639.1|745700_746825_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_009880991.1|746863_747733_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	2.0e-100
WP_012560640.1|747732_748326_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002984881.1|748569_749610_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
749588:749638	attL	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_012560641.1|749692_750832_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.1	5.8e-119
WP_011285632.1|750959_751226_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011888747.1|751237_751624_-	hypothetical protein	NA	M1PFJ2	Streptococcus_phage	55.5	3.3e-34
WP_011888951.1|751626_751977_-	helix-turn-helix transcriptional regulator	NA	M1PKY8	Streptococcus_phage	62.6	1.6e-35
WP_011888950.1|752272_752443_+	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	5.1e-08
WP_012560642.1|752468_753257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001112862.1|753307_753499_+	hypothetical protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
WP_012560643.1|753577_753889_+	hypothetical protein	NA	A1EAC3	Streptococcus_phage	84.3	2.1e-47
WP_011888947.1|753890_754061_+	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_012560644.1|754053_754257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012560645.1|754253_754640_+	hypothetical protein	NA	A7J274	Streptococcus_phage	89.0	4.3e-58
WP_002983407.1|754785_754989_+	hypothetical protein	NA	A7J276	Streptococcus_phage	100.0	9.4e-33
WP_002988708.1|755076_755376_+	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_012560646.1|755375_756533_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	97.9	5.7e-215
WP_086934854.1|756541_757105_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888941.1|757147_759070_+	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_011888940.1|759074_761459_+	DNA primase	NA	A7J282	Streptococcus_phage	94.2	1.6e-275
WP_012560647.1|761826_762120_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	1.2e-44
WP_012560648.1|762116_763439_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.0	1.1e-249
WP_164972002.1|763439_763610_+	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_011054882.1|763602_763875_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|764007_764424_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_044555320.1|764513_764966_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	93.3	1.1e-70
WP_012560650.1|764955_766233_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	99.1	6.4e-244
WP_012560651.1|766248_767781_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.4	4.9e-291
WP_044555223.1|767740_769189_+|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.4	2.5e-276
WP_011054876.1|769216_769405_+	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011054874.1|769844_770414_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
WP_002983429.1|770426_771314_+	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_012560654.1|771325_771682_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	6.1e-59
WP_011054872.1|771692_771971_+	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011106640.1|771967_772312_+	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054870.1|772315_772675_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011054869.1|772686_773286_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054867.1|773868_774102_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_012560656.1|774116_778499_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.0	5.7e-223
WP_011054865.1|778510_779353_+	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_011888928.1|779362_781342_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_193325868.1|782181_783582_+	hypothetical protein	NA	A7J2A9	Streptococcus_phage	80.5	1.6e-83
WP_012560658.1|783593_783755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012560659.1|783757_784369_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	90.1	1.1e-81
WP_011184730.1|784378_784834_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
WP_002993615.1|784951_785704_+	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	96.8	7.9e-141
787434:787484	attR	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
>prophage 6
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	1030001	1059740	1815785	integrase,transposase	Staphylococcus_prophage(20.0%)	30	1030924:1030939	1062530:1062545
WP_009880553.1|1030001_1030982_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.1	3.9e-39
1030924:1030939	attL	AAGAACTTGACAATTA	NA	NA	NA	NA
WP_009880554.1|1031495_1032479_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009880555.1|1032509_1033760_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002984216.1|1033752_1033992_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_012560765.1|1034009_1035266_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_012560766.1|1035262_1036801_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	5.0e-41
WP_002984200.1|1036812_1036956_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_002984194.1|1037218_1039210_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_012560767.1|1039402_1041577_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012560768.1|1041576_1042317_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.2e-35
WP_002989558.1|1042464_1042617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560769.1|1042613_1043993_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003060495.1|1044170_1044620_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002989549.1|1044616_1044952_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002984171.1|1044954_1045266_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012560770.1|1045288_1047283_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_009880849.1|1047388_1048483_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_012560771.1|1048491_1049892_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_011054615.1|1050116_1050812_+	nicotinamide riboside transporter PnuC	NA	NA	NA	NA	NA
WP_002984154.1|1050816_1050975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560772.1|1051043_1052357_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002984145.1|1052413_1052542_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_002984145.1|1054190_1054319_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_162484694.1|1054674_1055905_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.7	3.7e-63
WP_002992869.1|1056205_1057078_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_012560777.1|1057302_1058613_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_012560778.1|1058769_1058985_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_136026551.1|1059119_1059314_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_079891374.1|1059389_1059587_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	49.2	3.7e-10
WP_079891392.1|1059626_1059740_+|transposase	transposase	transposase	NA	NA	NA	NA
1062530:1062545	attR	TAATTGTCAAGTTCTT	NA	NA	NA	NA
>prophage 7
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	1416093	1508534	1815785	terminase,integrase,tail,portal,holin,transposase,head,capsid	Streptococcus_phage(27.54%)	111	1404951:1404966	1509928:1509943
1404951:1404966	attL	ATAAGTCTTTTTTAGA	NA	NA	NA	NA
WP_009880712.1|1416093_1417227_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002983189.1|1417388_1418342_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_044555267.1|1418388_1419321_-	ROK family protein	NA	NA	NA	NA	NA
WP_012560921.1|1419561_1422093_-	endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_012560922.1|1422323_1424207_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_012560923.1|1424448_1425888_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_012560924.1|1425892_1426858_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.4	5.2e-20
WP_012560925.1|1426998_1427451_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002983163.1|1427443_1427833_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_012560926.1|1427878_1428436_-	elongation factor P	NA	NA	NA	NA	NA
WP_002988493.1|1428531_1428993_-	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_012560927.1|1429027_1430101_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.8	6.0e-17
WP_044555268.1|1430215_1433044_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	4.5e-306
WP_002983147.1|1433246_1434191_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_012560929.1|1434322_1434979_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_012560930.1|1435111_1435351_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983122.1|1435515_1436007_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
WP_002983117.1|1436028_1436319_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002983113.1|1436491_1436785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044555340.1|1436982_1438107_+	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	1.3e-22
WP_012560932.1|1438283_1438871_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001162959.1|1438922_1439237_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.3	8.6e-17
WP_021299043.1|1439317_1439818_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012560934.1|1439821_1442161_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	46.8	4.8e-19
WP_012560935.1|1442309_1442855_-	CvpA family protein	NA	NA	NA	NA	NA
WP_002993251.1|1442857_1443166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560936.1|1443322_1444225_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_009880473.1|1444235_1444829_+	signal peptidase I	NA	NA	NA	NA	NA
WP_009880472.1|1444886_1447340_+	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	28.5	4.2e-58
WP_012560937.1|1447430_1447913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012560938.1|1448005_1449100_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_012560939.1|1449308_1451636_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	5.5e-116
WP_012560941.1|1452097_1452850_-	CppA family protein	NA	NA	NA	NA	NA
WP_044555271.1|1453147_1454044_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_009880787.1|1454379_1455228_-	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	33.3	3.3e-26
WP_002988223.1|1455397_1455544_-	universal stress protein	NA	NA	NA	NA	NA
WP_009880786.1|1455729_1456926_-	MFS transporter	NA	NA	NA	NA	NA
WP_014635687.1|1457091_1457751_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_009880785.1|1457772_1460055_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_002988211.1|1460134_1460356_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	41.2	4.8e-06
WP_002988207.1|1460525_1460900_+	helix-turn-helix transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	51.6	2.7e-17
WP_012560944.1|1461244_1461424_-	hypothetical protein	NA	A3F673	Streptococcus_phage	75.9	1.1e-16
WP_011285611.1|1461661_1462462_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_012560946.1|1463217_1464084_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.3	1.8e-133
WP_012560947.1|1464071_1464596_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	99.4	1.2e-98
WP_012560948.1|1464735_1465944_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	85.6	1.5e-210
WP_011017843.1|1466059_1466287_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_002987582.1|1466283_1466559_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_012560949.1|1466568_1467186_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	86.3	1.0e-74
WP_002987333.1|1467188_1467350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560950.1|1467363_1469274_-	gp58-like family protein	NA	Q938J9	Temperate_phage	71.0	2.5e-119
WP_012560951.1|1469289_1470294_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	60.3	1.9e-102
WP_012560952.1|1470290_1472342_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	85.2	0.0e+00
WP_011184914.1|1472338_1473118_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	54.8	1.7e-66
WP_012560953.1|1473150_1476786_-	tape measure protein	NA	U6E979	Streptococcus_phage	28.0	4.0e-04
WP_002988428.1|1476800_1477130_-	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_012560954.1|1477171_1477531_-|tail	tail assembly chaperone	tail	D7RWD6	Brochothrix_phage	44.5	2.5e-20
WP_044555274.1|1477583_1478192_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	51.4	9.8e-41
WP_002988420.1|1478246_1478636_-	hypothetical protein	NA	B5SP36	Lactococcus_phage	66.7	2.3e-43
WP_002988417.1|1478632_1478998_-	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	45.5	6.5e-16
WP_002988415.1|1478978_1479287_-	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	41.2	3.3e-13
WP_002988412.1|1479283_1479637_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_002988409.1|1479650_1479893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988406.1|1479902_1480985_-|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	57.1	4.5e-105
WP_002988404.1|1480987_1481368_-|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	2.4e-05
WP_002988401.1|1481377_1481911_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_012560957.1|1482054_1482321_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	72.7	1.0e-26
WP_011284859.1|1482323_1482638_-	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
WP_002988389.1|1482707_1482893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560958.1|1482896_1484459_-|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	2.5e-48
WP_002988384.1|1484439_1485942_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.6e-140
WP_012560959.1|1485953_1487243_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.9	1.7e-183
WP_002990047.1|1487220_1487703_-|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
WP_011017866.1|1488534_1488975_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_012560960.1|1489414_1489936_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	76.3	5.6e-69
WP_012560961.1|1489932_1490226_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	97.9	8.0e-49
WP_011054812.1|1490222_1490408_-	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
WP_012560962.1|1490505_1490991_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	99.4	3.6e-94
WP_038432520.1|1490994_1491279_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	91.5	5.0e-40
WP_012560963.1|1491275_1491680_-	hypothetical protein	NA	Q938M1	Temperate_phage	94.0	3.4e-66
WP_044555277.1|1491663_1491951_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	72.7	3.6e-30
WP_012560965.1|1492192_1492549_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	98.3	5.5e-60
WP_011106686.1|1492986_1493190_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_012560967.1|1493195_1493621_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	81.6	8.3e-55
WP_012560968.1|1493613_1494288_-	ERF family protein	NA	A0A097PBE8	Streptococcus_pyogenes_phage	99.1	7.6e-119
WP_012560970.1|1494792_1495047_-	hypothetical protein	NA	Q938N0	Temperate_phage	96.4	1.8e-41
WP_012560971.1|1495033_1495381_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	47.7	4.6e-11
WP_021341158.1|1495521_1496304_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	98.1	2.7e-144
WP_012560973.1|1497208_1497652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568478.1|1497707_1498088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370473.1|1498077_1498350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560974.1|1498522_1498702_-	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
WP_012560976.1|1499248_1499608_-	hypothetical protein	NA	Q9AZZ9	Lactococcus_phage	50.0	2.2e-08
WP_012560977.1|1499681_1499939_-	hypothetical protein	NA	X2KPF2	Streptococcus_phage	36.8	3.3e-06
WP_012560978.1|1500141_1500483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988329.1|1500557_1500758_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	75.4	3.3e-22
WP_002988326.1|1500754_1500904_-	hypothetical protein	NA	Q938N4	Temperate_phage	98.0	2.3e-20
WP_002988323.1|1500935_1501664_-	phage antirepressor KilAC domain-containing protein	NA	Q938N5	Temperate_phage	81.8	9.7e-112
WP_002988320.1|1501696_1501885_-	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	65.6	1.8e-14
WP_038432530.1|1501945_1502359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019418745.1|1502360_1502519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988317.1|1502531_1503293_-	phage repressor protein/antirepressor Ant	NA	Q6SEF4	Lactobacillus_prophage	63.2	3.3e-86
WP_002988313.1|1503459_1503732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988309.1|1503720_1503921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164463.1|1503956_1504172_-	helix-turn-helix transcriptional regulator	NA	J7KK54	Streptococcus_phage	98.6	5.0e-32
WP_002988305.1|1504245_1504473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988299.1|1504588_1505368_+	hypothetical protein	NA	A0A1S5S7L0	Streptococcus_phage	57.4	6.2e-48
WP_002988291.1|1505501_1505660_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	1.7e-21
WP_002988288.1|1506023_1506782_+	helix-turn-helix transcriptional regulator	NA	J7KJ52	Streptococcus_phage	88.0	1.2e-120
WP_002988284.1|1506854_1507277_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_012560981.1|1507397_1508534_+|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	35.4	3.7e-57
1509928:1509943	attR	TCTAAAAAAGACTTAT	NA	NA	NA	NA
>prophage 8
NC_011375	Streptococcus pyogenes NZ131, complete sequence	1815785	1627692	1635966	1815785	transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_012561028.1|1627692_1627983_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFG6	Staphylococcus_phage	56.0	6.3e-22
WP_193325867.1|1628037_1629380_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.1	4.0e-63
WP_012561030.1|1629498_1629813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561031.1|1630201_1630438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561033.1|1630829_1632587_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	30.7	3.3e-41
WP_012561034.1|1632619_1633186_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	1.2e-32
WP_012561035.1|1633218_1634487_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	2.0e-96
WP_012561036.1|1634984_1635425_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011529046.1|1635459_1635966_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	40.7	4.2e-29
