The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	480892	543945	8982042	integrase,transposase	Planktothrix_phage(50.0%)	45	495833:495865	498897:498929
WP_157472258.1|480892_481963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012157845.1|482036_482705_-	DUF5060 domain-containing protein	NA	NA	NA	NA	NA
WP_012157846.1|482763_483234_-	6,7-dimethyl-8-ribityllumazine synthase	NA	NA	NA	NA	NA
WP_041253613.1|483416_484421_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_157472959.1|484447_485326_+	transketolase	NA	NA	NA	NA	NA
WP_012157849.1|485351_486323_+	transketolase	NA	NA	NA	NA	NA
WP_012157850.1|486306_487827_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_157472260.1|487884_488895_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012157857.1|492136_492259_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012157858.1|492278_493022_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157472262.1|494147_494357_+	hypothetical protein	NA	NA	NA	NA	NA
495833:495865	attL	GTCCGCTTATGCCGAGGGCCGGGTTATGCCGAC	NA	NA	NA	NA
WP_012157862.1|495941_496931_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	2.1e-16
WP_012157863.1|496927_497878_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012157864.1|497856_498771_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	28.4	1.1e-08
WP_041255304.1|500079_501138_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
498897:498929	attR	GTCGGCATAACCCGGCCCTCGGCATAAGCGGAC	NA	NA	NA	NA
WP_157472264.1|501103_502888_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012157868.1|502902_503844_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012157869.1|503840_505589_+	dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	3.3e-17
WP_012157870.1|505590_506400_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.5e-17
WP_012157871.1|506430_508965_+	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
WP_012157872.1|508968_510324_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_012157873.1|510320_512048_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_012157874.1|512057_513767_+	DUF5060 domain-containing protein	NA	NA	NA	NA	NA
WP_012157875.1|513766_514804_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_157472266.1|514779_517170_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_012157877.1|517179_518205_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_012157878.1|518333_519530_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_083788145.1|520477_520738_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_012157881.1|520734_521103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012157882.1|522169_523276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012157883.1|523524_523671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012157884.1|524045_524447_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_041253618.1|524431_524689_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_083788146.1|524833_525511_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_020458104.1|525540_526257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041253621.1|526609_527542_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_020458106.1|527673_528660_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_157472268.1|529023_530640_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020458108.1|530651_531593_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157472270.1|531562_533383_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	1.3e-19
WP_020458110.1|533379_534219_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	2.6e-15
WP_157472960.1|534711_536640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458112.1|536844_537933_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_157472962.1|538301_540581_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_020458115.1|541776_543945_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	553849	580875	8982042	transposase	Mollivirus(100.0%)	27	NA	NA
WP_020458126.1|553849_554917_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157472272.1|554915_555482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157472274.1|555370_555775_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041253622.1|556909_557584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458129.1|557744_558773_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020458130.1|559193_560261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020458131.1|560485_562102_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_041255323.1|562699_563221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458133.1|563375_563564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458134.1|563582_564650_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157472276.1|564781_565081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020458135.1|565190_565814_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157472966.1|565976_566702_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020458137.1|566754_567525_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.7	3.3e-09
WP_020458138.1|567587_568082_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020458139.1|568078_568966_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020458142.1|570420_570762_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041253626.1|570827_571682_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020458145.1|571901_572147_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083788461.1|572362_572665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041255333.1|573104_573650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458149.1|574869_576030_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_041253627.1|577531_577753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472278.1|578014_578215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458152.1|578589_579471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472968.1|579528_580137_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157472280.1|580590_580875_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3235765	3333365	8982042	integrase,transposase	Streptomyces_phage(25.0%)	75	3291428:3291444	3344481:3344497
WP_041254077.1|3235765_3236845_+|integrase	site-specific integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	30.3	7.4e-07
WP_020460133.1|3236841_3237165_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020460134.1|3237171_3238836_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_020460323.1|3238751_3239564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460324.1|3239837_3241226_+|transposase	IS701-like element ISFsp9 family transposase	transposase	NA	NA	NA	NA
WP_020460325.1|3241627_3242500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460326.1|3242496_3242886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460327.1|3242889_3245040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460328.1|3245049_3246375_+	PrgI family protein	NA	NA	NA	NA	NA
WP_020460329.1|3246371_3248264_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_041255829.1|3248298_3250809_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_020460331.1|3250825_3251842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041255830.1|3251899_3252880_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	39.8	1.2e-11
WP_020460333.1|3252998_3253874_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020460334.1|3253971_3254352_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157472623.1|3255180_3255405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472624.1|3255814_3259900_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_020459004.1|3260252_3260543_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	44.1	1.5e-10
WP_020460337.1|3260539_3261280_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.2	1.2e-16
WP_063748341.1|3262449_3263253_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.2	7.6e-17
WP_020459004.1|3263249_3263540_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	44.1	1.5e-10
WP_083788217.1|3263569_3265306_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020460339.1|3265313_3267140_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_020460340.1|3267243_3268158_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_020460341.1|3268665_3272019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460342.1|3272507_3273770_-|transposase	IS4-like element ISFsp5 family transposase	transposase	NA	NA	NA	NA
WP_020460343.1|3273959_3274964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085950115.1|3275684_3275852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472625.1|3276258_3276795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473254.1|3276887_3277061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460349.1|3278743_3279226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460350.1|3279292_3279853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460351.1|3280276_3281110_+|transposase	IS5-like element ISFsp2 family transposase	transposase	NA	NA	NA	NA
WP_157472626.1|3281186_3281462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460353.1|3281774_3282290_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020460354.1|3282689_3283190_-	DUF3846 domain-containing protein	NA	NA	NA	NA	NA
WP_020460355.1|3283244_3283565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254128.1|3284040_3284967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460358.1|3285130_3286159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460359.1|3286457_3286979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460360.1|3287230_3290674_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_041254130.1|3290710_3292552_-	hypothetical protein	NA	NA	NA	NA	NA
3291428:3291444	attL	GATCTCCACCAGGGCCG	NA	NA	NA	NA
WP_041254131.1|3292747_3293074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460363.1|3293078_3293990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460364.1|3293998_3294553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460365.1|3295071_3295875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472627.1|3296735_3296888_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_020460367.1|3296884_3297205_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	42.4	4.1e-06
WP_020460368.1|3297201_3298068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460369.1|3298229_3299057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472628.1|3299078_3299243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254138.1|3299796_3300048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473256.1|3300413_3301268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041254139.1|3301716_3304701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460374.1|3304956_3306213_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_020460375.1|3306787_3307642_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_020460376.1|3307927_3308305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460377.1|3308358_3309378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157473259.1|3309368_3309929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254141.1|3310917_3311100_+	FxLD family lantipeptide	NA	NA	NA	NA	NA
WP_020460379.1|3311179_3314245_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_157473262.1|3314250_3315441_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_020460381.1|3315504_3316701_+	methyltransferase, FxLD system	NA	A0A1J0MC37	Streptomyces_phage	43.4	8.7e-17
WP_157473264.1|3317009_3318575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460383.1|3318645_3319098_+	dCMP deaminase	NA	NA	NA	NA	NA
WP_083788219.1|3319215_3320388_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_020460386.1|3320814_3322731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472629.1|3323057_3323510_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157472630.1|3323506_3323719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460375.1|3323827_3324682_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_020460389.1|3325510_3326698_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157473267.1|3326785_3327151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473270.1|3328022_3329387_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_020460393.1|3329478_3331239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473273.1|3331349_3333365_+|integrase	integrase	integrase	NA	NA	NA	NA
3344481:3344497	attR	CGGCCCTGGTGGAGATC	NA	NA	NA	NA
>prophage 4
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3366175	3393654	8982042	transposase	Escherichia_phage(33.33%)	27	NA	NA
WP_041255847.1|3366175_3366886_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	39.9	1.5e-37
WP_157472633.1|3366993_3367203_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_020460431.1|3367290_3368235_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460432.1|3368297_3368696_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020458939.1|3368762_3370379_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_020460433.1|3370439_3371216_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460434.1|3371772_3372717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460435.1|3372812_3373727_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_020460436.1|3373859_3374288_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_020460437.1|3374305_3375382_+	amidohydrolase	NA	NA	NA	NA	NA
WP_020460438.1|3375378_3375843_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_020460439.1|3375845_3376751_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	29.0	2.5e-32
WP_020460440.1|3376782_3378369_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	26.0	6.3e-31
WP_041254158.1|3378558_3379497_+	NADP-dependent oxidoreductase	NA	A0A2K9V7Y5	Bandra_megavirus	28.9	4.0e-09
WP_020460442.1|3379685_3380591_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460443.1|3380710_3381151_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020460444.1|3381161_3382058_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_020460445.1|3382070_3383249_-	MFS transporter	NA	NA	NA	NA	NA
WP_020460446.1|3383398_3383965_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_020458361.1|3384115_3385504_+|transposase	IS1380-like element ISFsp14 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	55.5	6.3e-128
WP_020460447.1|3385635_3386064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460448.1|3386076_3386502_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020460449.1|3386638_3387334_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_020460450.1|3387478_3388363_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_020460451.1|3388571_3389213_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	3.8e-35
WP_020460324.1|3391102_3392491_+|transposase	IS701-like element ISFsp9 family transposase	transposase	NA	NA	NA	NA
WP_020460454.1|3392562_3393654_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3402041	3484643	8982042	transposase	Prochlorococcus_phage(16.67%)	58	NA	NA
WP_157473279.1|3402041_3403133_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157472634.1|3403465_3404068_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083788223.1|3404257_3404785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460463.1|3405295_3405562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460465.1|3406320_3407262_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_157473281.1|3407258_3408947_-	3-(3-hydroxyphenyl)propionate hydroxylase	NA	NA	NA	NA	NA
WP_020460467.1|3408964_3409828_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_083788224.1|3409914_3411366_-	MFS transporter	NA	NA	NA	NA	NA
WP_020460469.1|3411328_3411856_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_020460470.1|3411852_3413514_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083788225.1|3413642_3414470_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_083788226.1|3414444_3414975_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_020460473.1|3414987_3416349_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_020460475.1|3417161_3417908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460476.1|3418233_3419844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460478.1|3421213_3422848_+|transposase	ISAzo13-like element ISFsp12 family transposase	transposase	NA	NA	NA	NA
WP_020460480.1|3423230_3424532_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460482.1|3424925_3425546_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_020460483.1|3425909_3427085_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_020460484.1|3427088_3428108_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_020460485.1|3428393_3429659_-	amidohydrolase	NA	NA	NA	NA	NA
WP_085950160.1|3429839_3430946_-	cytochrome P450	NA	NA	NA	NA	NA
WP_020460487.1|3431769_3432339_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020460488.1|3432361_3433135_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460489.1|3433354_3434005_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460490.1|3434061_3434910_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460491.1|3434911_3435760_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020460492.1|3435756_3436584_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_041254162.1|3436795_3437701_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460494.1|3438094_3438646_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_020460495.1|3438676_3439927_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_020460496.1|3440031_3441168_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_020460497.1|3441416_3442226_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_020460498.1|3442411_3443497_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	7.8e-33
WP_020460501.1|3444630_3444909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460507.1|3451358_3453044_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.0	3.2e-17
WP_083788228.1|3453377_3454619_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085950161.1|3454640_3455414_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_157472635.1|3455632_3455779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460510.1|3455782_3456631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473284.1|3457076_3458615_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020460512.1|3458620_3460942_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.4	3.3e-36
WP_041255875.1|3461076_3462204_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_020460514.1|3462237_3463449_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_020460515.1|3463495_3465670_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_083788516.1|3465689_3466553_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157472636.1|3466465_3468064_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_020460518.1|3468101_3469235_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_020460519.1|3469284_3470448_+	CoA transferase	NA	NA	NA	NA	NA
WP_020460520.1|3470486_3472040_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041254170.1|3472257_3473157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460523.1|3473853_3476646_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	21.1	4.2e-06
WP_020460524.1|3476642_3477392_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	25.5	1.3e-10
WP_157472637.1|3477556_3478816_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460526.1|3479247_3480459_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460527.1|3480621_3481713_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020460528.1|3481825_3482914_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020460529.1|3483191_3484643_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.3	8.3e-30
>prophage 6
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3489517	3548424	8982042	transposase	Prochlorococcus_phage(25.0%)	47	NA	NA
WP_020460533.1|3489517_3490351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460534.1|3490374_3492438_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_020460535.1|3492647_3492920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460537.1|3494229_3495678_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020460538.1|3495908_3497198_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_020460539.1|3497194_3497530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460540.1|3497526_3498372_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_020460541.1|3498401_3499025_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460542.1|3499215_3500241_+	ferredoxin--NADP reductase	NA	E3SNZ1	Prochlorococcus_phage	35.8	5.0e-05
WP_041255885.1|3500276_3501020_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.3	1.1e-14
WP_020460544.1|3501016_3501670_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020460545.1|3501694_3502954_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_020460546.1|3502950_3503283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460547.1|3503279_3504569_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020460548.1|3504550_3504871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460549.1|3505135_3506002_+	oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_020460550.1|3506256_3507840_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460551.1|3508484_3509183_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083788230.1|3509626_3509989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460553.1|3509964_3511854_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_020460554.1|3511907_3512390_-	pyridoxamine 5'-phosphate oxidase-like protein	NA	NA	NA	NA	NA
WP_041255890.1|3512386_3514213_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
WP_020460556.1|3514228_3515176_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_041254179.1|3515221_3515461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460558.1|3515641_3516580_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_157472638.1|3516977_3517673_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157473287.1|3521051_3521729_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083788231.1|3521759_3522356_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460564.1|3522400_3523234_-|transposase	IS5-like element ISFsp2 family transposase	transposase	NA	NA	NA	NA
WP_020460565.1|3523510_3524782_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_049795946.1|3525093_3526182_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085950162.1|3526405_3526531_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460567.1|3526759_3529225_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_020460568.1|3529771_3530974_+	2,3-dihydroxybiphenyl 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_020460569.1|3530970_3531321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472639.1|3531502_3532813_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460571.1|3533239_3534331_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020460572.1|3534405_3535563_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_012157514.1|3535847_3536468_-	endonuclease	NA	NA	NA	NA	NA
WP_012157515.1|3536392_3536932_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460574.1|3537764_3538490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460575.1|3538490_3539147_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460576.1|3539260_3544174_-	diguanylate cyclase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	32.8	2.6e-06
WP_157472640.1|3544411_3545038_+	hypothetical protein	NA	A0A222ZN33	Mycobacterium_phage	51.9	7.0e-10
WP_083788232.1|3545188_3545563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041255900.1|3545888_3547238_-	crotonyl-CoA carboxylase/reductase	NA	NA	NA	NA	NA
WP_083788233.1|3547401_3548424_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3563154	3659618	8982042	integrase,transposase	Tupanvirus(18.18%)	54	3555939:3555955	3603430:3603446
3555939:3555955	attL	CATCCGTGACCTGCTGG	NA	NA	NA	NA
WP_020460592.1|3563154_3564657_+|transposase	ISKra4-like element ISFsp17 family transposase	transposase	NA	NA	NA	NA
WP_020460594.1|3566247_3567489_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.1	7.3e-75
WP_020460597.1|3568884_3569952_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460598.1|3569961_3570348_-|integrase	putative integrase/recombinase	integrase	NA	NA	NA	NA
WP_083788240.1|3570280_3570727_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020460599.1|3571322_3572312_-	transporter	NA	NA	NA	NA	NA
WP_083788241.1|3572447_3573518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460602.1|3574247_3574484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460603.1|3574480_3576022_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460604.1|3576190_3578062_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_020460605.1|3578127_3578418_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_020460606.1|3578881_3579868_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041255912.1|3579939_3580908_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	22.0	5.4e-09
WP_083788244.1|3580904_3582014_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_020460608.1|3582010_3582889_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.0	1.6e-07
WP_041255915.1|3582942_3584643_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	22.7	8.9e-07
WP_041254190.1|3584639_3586379_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_083788245.1|3586743_3591147_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.1	9.8e-58
WP_020460614.1|3592018_3592441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460616.1|3593124_3594351_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_020460617.1|3594354_3595803_-	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
WP_020460618.1|3595868_3597494_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_020460619.1|3597626_3598373_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_020460620.1|3598987_3599239_-	MbtH family protein	NA	NA	NA	NA	NA
WP_020460621.1|3599272_3600592_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_020460622.1|3600597_3601440_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_020460623.1|3601512_3601767_-	phosphopantetheine-binding protein	NA	NA	NA	NA	NA
WP_083788246.1|3601750_3618700_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.7	1.7e-118
3603430:3603446	attR	CCAGCAGGTCACGGATG	NA	NA	NA	NA
WP_085950116.1|3623464_3624666_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.3	2.8e-47
WP_012157515.1|3624876_3625416_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012157514.1|3625340_3625961_+	endonuclease	NA	NA	NA	NA	NA
WP_083788247.1|3629137_3629491_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	45.0	3.0e-18
WP_020460632.1|3629893_3630670_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.2	2.0e-14
WP_020460634.1|3631691_3632432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460635.1|3632609_3633140_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_020460636.1|3633679_3634159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472643.1|3634444_3634747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472644.1|3634926_3635388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041253905.1|3635267_3636491_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_020460639.1|3636724_3637273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460641.1|3638581_3640099_-	propionyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_020460642.1|3640326_3646194_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_085950117.1|3646894_3648071_+|transposase	IS3-like element ISFsp8 family transposase	transposase	U5P429	Shigella_phage	38.5	3.5e-42
WP_020460646.1|3648423_3649527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049795635.1|3650303_3650573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472645.1|3650909_3651056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460648.1|3651397_3653308_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_157472584.1|3653433_3653610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460650.1|3654018_3654369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472646.1|3654673_3654814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460651.1|3655029_3655449_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	27.6	5.7e-08
WP_041255926.1|3655927_3656719_-	amidohydrolase	NA	NA	NA	NA	NA
WP_157472647.1|3656802_3656970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458129.1|3658589_3659618_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3682195	3754928	8982042	integrase,transposase	Staphylococcus_phage(25.0%)	52	3710242:3710262	3756264:3756284
WP_020460679.1|3682195_3682981_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_020460680.1|3683318_3684122_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460681.1|3684169_3684613_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_157472651.1|3684756_3685023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049795948.1|3685106_3685856_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	1.6e-32
WP_020460684.1|3685914_3686760_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020460685.1|3686834_3687554_+	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_020460686.1|3687574_3688279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460687.1|3688412_3689612_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083788253.1|3689463_3690504_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_083788254.1|3690544_3691381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460690.1|3691628_3692447_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_020460691.1|3692443_3693703_+	CoA transferase	NA	NA	NA	NA	NA
WP_020460692.1|3693794_3694544_+	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_049795674.1|3696449_3698156_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.8	2.5e-09
WP_041254213.1|3698795_3699980_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_020460696.1|3700684_3701239_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157473296.1|3701305_3702856_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.5e-34
WP_020460698.1|3702941_3704090_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_020460699.1|3704099_3704909_+	TIGR03084 family protein	NA	NA	NA	NA	NA
WP_020460700.1|3705077_3705695_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157472652.1|3705691_3705922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472653.1|3706063_3706537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460702.1|3706562_3707864_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460703.1|3707965_3710797_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
3710242:3710262	attL	CCTGGAGCCGGGCGAGTTCGG	NA	NA	NA	NA
WP_157472654.1|3710803_3713065_-	MFS transporter	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.1e-12
WP_049795676.1|3713484_3714405_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	30.9	4.2e-27
WP_020460706.1|3714847_3717070_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_020460707.1|3718033_3719410_-	amidase	NA	NA	NA	NA	NA
WP_020460708.1|3719912_3720134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254214.1|3721714_3724198_+	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	34.9	8.7e-19
WP_020460711.1|3724328_3724787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472655.1|3725141_3726437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083788255.1|3726565_3727099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083788256.1|3727183_3727831_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157472656.1|3730054_3730711_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157472657.1|3731507_3732974_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_020460718.1|3733355_3733976_-	endonuclease	NA	NA	NA	NA	NA
WP_012157515.1|3733900_3734440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020460719.1|3734740_3735949_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460720.1|3736210_3736819_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460722.1|3737309_3738344_-	putative amidase protein	NA	NA	NA	NA	NA
WP_020460723.1|3738509_3739247_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	1.8e-20
WP_041254217.1|3739338_3740664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472658.1|3742783_3744391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083788257.1|3744287_3744713_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460730.1|3745901_3748451_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	3.0e-27
WP_020460731.1|3749132_3750065_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_020460732.1|3750061_3750892_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_020460733.1|3750946_3752143_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_020460734.1|3752139_3752811_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_049795681.1|3753434_3754928_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
3756264:3756284	attR	CCTGGAGCCGGGCGAGTTCGG	NA	NA	NA	NA
>prophage 9
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	3970822	4049702	8982042	transposase	Catovirus(20.0%)	59	NA	NA
WP_041255992.1|3970822_3972028_+|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	36.1	2.0e-45
WP_157472666.1|3973287_3973440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460899.1|3973681_3975316_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_041255994.1|3975442_3976159_+	response regulator	NA	W8CYM9	Bacillus_phage	34.6	5.4e-06
WP_041254260.1|3976251_3977577_+	ketoacyl synthase	NA	NA	NA	NA	NA
WP_020460902.1|3977711_3984374_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	35.8	1.1e-31
WP_041254262.1|3984505_3984775_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_020460904.1|3984976_3986377_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_020460905.1|3986373_3986967_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_020460906.1|3986994_3987774_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_020460907.1|3987892_3989848_-	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	28.1	1.1e-85
WP_041255997.1|3990175_3991060_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020460909.1|3991130_3992345_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157472667.1|3993014_3993185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460910.1|3993442_3993763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460911.1|3993790_3995035_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020460912.1|3995031_3995364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083788524.1|3996229_3997060_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	1.1e-13
WP_020460915.1|3997074_3998184_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_020460916.1|3998374_3999010_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460917.1|3999039_3999885_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_020460918.1|3999881_4000217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020460919.1|4000213_4001503_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_020460920.1|4001734_4003183_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041254268.1|4003360_4004359_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157472668.1|4005209_4005659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473314.1|4006126_4007215_+	TIGR03621 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_020460925.1|4007290_4008241_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460926.1|4008396_4009269_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020460927.1|4009389_4010163_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020460929.1|4010799_4011465_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020460930.1|4011694_4013626_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	32.6	5.2e-104
WP_020460931.1|4014504_4014921_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_020460932.1|4014955_4016098_+	thiolase family protein	NA	NA	NA	NA	NA
WP_020460933.1|4016134_4016815_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_020460934.1|4016717_4018055_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041256004.1|4018171_4020445_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_083788265.1|4020764_4021391_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_020460937.1|4021636_4022860_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460938.1|4022953_4025824_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	1.7e-10
WP_020460939.1|4025830_4026520_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.4	4.8e-12
WP_020460940.1|4026653_4028168_+	MFS transporter	NA	NA	NA	NA	NA
WP_020460941.1|4028175_4029762_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020460942.1|4029789_4031358_-	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	23.2	2.2e-07
WP_020460943.1|4031477_4032566_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_020460944.1|4032562_4033651_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_020460945.1|4033647_4033890_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_020460946.1|4034025_4035228_+	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_020460947.1|4035224_4036946_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_041254272.1|4036948_4037629_+	hydrogenase	NA	NA	NA	NA	NA
WP_020460949.1|4037625_4038201_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_020460950.1|4038193_4038514_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_041254273.1|4038596_4039307_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.3	2.2e-36
WP_041254274.1|4042770_4044030_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_083788266.1|4044348_4045419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083788267.1|4045411_4046086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020460959.1|4046249_4047026_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157472669.1|4048661_4048817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472670.1|4048994_4049702_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	4533892	4560065	8982042	transposase,tail,plate	Bacillus_phage(33.33%)	20	NA	NA
WP_020461345.1|4533892_4535461_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	32.7	9.2e-67
WP_020461346.1|4535507_4535948_+|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	27.3	1.0e-07
WP_157473417.1|4535998_4536391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041254345.1|4536549_4538841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116430129.1|4538951_4539374_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_020461350.1|4539370_4540060_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157472696.1|4540056_4541799_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_020461352.1|4541843_4542236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020461353.1|4542235_4542664_+	GPW/gp25 family protein	NA	A0A2I7QXF4	Vibrio_phage	32.7	6.3e-10
WP_020461354.1|4542660_4544781_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_020461355.1|4544777_4545305_+|tail	tail protein	tail	NA	NA	NA	NA
WP_020461356.1|4545249_4548558_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_157472697.1|4549084_4549849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472698.1|4550559_4551333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041254348.1|4551689_4552121_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020461361.1|4554355_4554607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020461362.1|4554834_4556964_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_020461363.1|4556960_4557614_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_020461364.1|4557831_4558383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020461074.1|4558388_4560065_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	5307802	5335042	8982042	transposase	Mollivirus(28.57%)	20	NA	NA
WP_083788301.1|5307802_5308426_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_020461949.1|5308710_5310381_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.8	5.3e-12
WP_020461950.1|5310429_5310843_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_020461952.1|5312885_5313707_-	mycofactocin-coupled SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020461953.1|5314190_5315387_-	cytochrome P450	NA	NA	NA	NA	NA
WP_020461955.1|5316688_5318449_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_020461956.1|5318448_5319591_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	4.5e-23
WP_020461957.1|5319628_5320699_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_041254570.1|5320989_5322162_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020461960.1|5322918_5324346_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020461961.1|5324475_5325240_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	33.3	1.0e-07
WP_020461962.1|5325236_5326145_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020461963.1|5326187_5327006_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.7	4.4e-12
WP_083788302.1|5327165_5327402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020461964.1|5328031_5328838_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_020461965.1|5329336_5330425_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_085950123.1|5330469_5331421_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_020461970.1|5332669_5332984_-|transposase	transposase	transposase	U5P429	Shigella_phage	46.7	1.2e-15
WP_157472747.1|5332964_5334164_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.7	5.6e-32
WP_020461972.1|5334238_5335042_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	29.2	7.6e-17
>prophage 12
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	6686577	6717918	8982042	integrase,protease,transposase	uncultured_Caudovirales_phage(25.0%)	35	6703044:6703080	6718678:6718714
WP_049796030.1|6686577_6687801_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.9	2.1e-42
WP_020462981.1|6688259_6688559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049795772.1|6688724_6688913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020462983.1|6688919_6689117_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020462984.1|6689147_6690857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049795773.1|6690834_6691092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020462985.1|6691088_6692660_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_035752633.1|6692809_6693085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020462986.1|6693096_6693507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020458361.1|6693903_6695292_-|transposase	IS1380-like element ISFsp14 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	55.5	6.3e-128
WP_020462987.1|6695444_6695840_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083788340.1|6695897_6696362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020462989.1|6696719_6697703_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020462990.1|6697689_6698886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083788341.1|6698770_6699259_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_020462991.1|6699467_6700640_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.1	8.0e-15
WP_157472816.1|6700623_6701187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020460342.1|6701578_6702841_+|transposase	IS4-like element ISFsp5 family transposase	transposase	NA	NA	NA	NA
6703044:6703080	attL	GGGTTCAAGTCCCTGGCGGCGCACCCGTATCTACCAG	NA	NA	NA	NA
WP_020462993.1|6703154_6704435_-|integrase	site-specific integrase	integrase	A0A162E140	Gordonia_phage	31.3	8.9e-36
WP_020462994.1|6704434_6704644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041253905.1|6705061_6706285_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_020462995.1|6706495_6706795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020462996.1|6706917_6707112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020462997.1|6707140_6708862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041254851.1|6708858_6709071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020462998.1|6709067_6710621_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_020462999.1|6710745_6711150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020463000.1|6711372_6711753_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049796031.1|6711822_6712224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020463002.1|6712274_6712559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020463003.1|6712759_6714091_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041256590.1|6714145_6714820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157472817.1|6715023_6715929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083788342.1|6716162_6716576_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_157472818.1|6716514_6717918_-|protease	serine protease	protease	NA	NA	NA	NA
6718678:6718714	attR	GGGTTCAAGTCCCTGGCGGCGCACCCGTATCTACCAG	NA	NA	NA	NA
>prophage 13
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	8097946	8174752	8982042	integrase,holin,transposase	Mycobacterium_phage(37.5%)	49	8155257:8155273	8177080:8177096
WP_020464074.1|8097946_8098528_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_020464075.1|8098663_8099188_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_049795818.1|8099188_8100532_-	DUF4407 domain-containing protein	NA	NA	NA	NA	NA
WP_020464077.1|8100849_8101299_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_083788384.1|8101347_8102445_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041255057.1|8102811_8105535_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_157473737.1|8105711_8106563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157473739.1|8106820_8108935_-	acyltransferase family protein	NA	A0A166XZF2	Gordonia_phage	31.0	1.4e-70
WP_157472889.1|8108984_8110436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464083.1|8110546_8111881_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041256810.1|8113726_8115058_-	AAA family ATPase	NA	B5LJN2	Mycobacterium_phage	37.4	1.0e-34
WP_020464087.1|8115977_8117111_+	ATPase	NA	NA	NA	NA	NA
WP_157472890.1|8117236_8117677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464089.1|8117673_8118555_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_020464090.1|8119024_8119648_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020464091.1|8119736_8120216_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_020464092.1|8121451_8122777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020464093.1|8124438_8125608_+	HAF repeat-containing protein	NA	NA	NA	NA	NA
WP_157473741.1|8125610_8126360_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157473743.1|8126461_8127067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041255060.1|8128293_8129022_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_020464100.1|8131987_8133079_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_020464101.1|8133078_8134458_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020464102.1|8134793_8135669_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157472891.1|8135665_8135872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157472892.1|8136122_8138003_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041256815.1|8138032_8138773_+	response regulator	NA	NA	NA	NA	NA
WP_083788385.1|8138664_8139048_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	7.1e-05
WP_041255061.1|8139168_8139672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473745.1|8139668_8140340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020464107.1|8140336_8140963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020464108.1|8141079_8141922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020464109.1|8141932_8142727_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_020464110.1|8142723_8144190_+	phosphotransferase	NA	NA	NA	NA	NA
WP_157473747.1|8144198_8147513_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.1	5.3e-32
WP_020464112.1|8147946_8148984_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	72.5	2.1e-131
WP_157473749.1|8149941_8150919_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041255062.1|8151354_8152545_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	1.3e-12
WP_020464115.1|8152573_8153539_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_020464116.1|8153555_8154269_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020464117.1|8154280_8155348_+|transposase	transposase	transposase	NA	NA	NA	NA
8155257:8155273	attL	CCGACCACCCCATCGCC	NA	NA	NA	NA
WP_157472893.1|8155322_8156066_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_083788388.1|8156311_8157223_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041255065.1|8161157_8161340_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020464122.1|8161442_8163413_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F6YRM4	Mycobacterium_phage	24.9	3.8e-17
WP_157472894.1|8164059_8164683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464123.1|8165207_8167730_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_157473751.1|8168398_8171344_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_157473753.1|8173309_8174752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	22.6	9.8e-15
8177080:8177096	attR	CCGACCACCCCATCGCC	NA	NA	NA	NA
>prophage 14
NC_009921	Frankia sp. EAN1pec, complete genome	8982042	8595189	8679396	8982042	transposase	Cyanophage(50.0%)	53	NA	NA
WP_020464441.1|8595189_8595486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020464442.1|8595571_8596594_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_157472915.1|8597110_8597293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020464443.1|8597398_8598604_+	fructotransferase	NA	NA	NA	NA	NA
WP_041255139.1|8598645_8601081_+	glycosyl hydrolase family 32	NA	NA	NA	NA	NA
WP_049795845.1|8603109_8604372_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041256909.1|8604454_8605342_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_020464448.1|8605338_8606178_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_020464449.1|8606293_8607415_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_020464450.1|8607485_8608538_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020464451.1|8608573_8609617_+	glycosyl hydrolase family 32	NA	NA	NA	NA	NA
WP_020464452.1|8609710_8610160_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020464453.1|8610226_8610535_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_020464454.1|8612041_8612860_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_020464455.1|8613324_8613807_+	resolvase	NA	NA	NA	NA	NA
WP_049795846.1|8614357_8616565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464457.1|8616627_8616987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464458.1|8617487_8617976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464459.1|8618726_8620721_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_083788433.1|8621277_8622729_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_020464462.1|8622637_8623294_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_020464418.1|8623290_8625123_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_020464463.1|8625119_8626598_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	2.0e-71
WP_041255142.1|8627240_8627600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083788596.1|8627886_8629794_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_020464465.1|8630051_8631092_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_041255144.1|8631088_8631535_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_020464469.1|8633197_8634148_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_020464470.1|8634144_8634906_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_049795848.1|8635215_8636391_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020464473.1|8636986_8637658_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_020464474.1|8638104_8643036_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_020464475.1|8643258_8643729_+	protein kinase	NA	NA	NA	NA	NA
WP_041255145.1|8644124_8644433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464477.1|8645497_8646679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020464478.1|8646708_8647020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083788437.1|8648759_8652791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157473798.1|8652878_8655071_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.4	3.8e-18
WP_020464482.1|8655966_8656896_+	TIGR03564 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_020464483.1|8657125_8657683_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_157472916.1|8657720_8658299_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020464485.1|8659009_8659480_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_020464486.1|8660846_8661938_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020460528.1|8662006_8663095_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_020464487.1|8663347_8664106_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020464488.1|8664102_8664873_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020464489.1|8665264_8665885_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020464491.1|8667259_8668450_+	cytochrome P450	NA	NA	NA	NA	NA
WP_020464492.1|8668597_8669887_+	amidohydrolase	NA	NA	NA	NA	NA
WP_157472917.1|8669976_8671605_-	histidine kinase	NA	NA	NA	NA	NA
WP_020464494.1|8674446_8675067_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020464495.1|8675280_8676117_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_020460324.1|8678007_8679396_+|transposase	IS701-like element ISFsp9 family transposase	transposase	NA	NA	NA	NA
