The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	526718	569936	4629812	integrase,lysis,tail,tRNA,transposase,protease	Enterobacteria_phage(50.0%)	42	536869:536915	561408:561454
WP_000912345.1|526718_528104_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143561.1|528139_528661_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|528768_528981_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|528982_529849_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|530319_530862_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|531081_531774_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001318685.1|531804_534414_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|534392_535433_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255228.1|535443_535959_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|535961_536594_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
536869:536915	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001318654.1|536928_538092_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
WP_000488419.1|538290_538569_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000763373.1|538616_538835_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000188870.1|538933_539149_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000145915.1|539834_540137_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070454.1|540204_540537_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|540584_540734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|540791_542318_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|542782_543334_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|543343_544141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|544257_544359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|544355_544811_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224907.1|544810_544981_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774479.1|544973_545264_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099655.1|545260_545623_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000971071.1|545619_545760_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_001204780.1|545845_546229_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000839596.1|548866_549082_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|549081_549579_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|549795_549978_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|550068_550362_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|550722_550917_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000290529.1|554715_557061_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_000654156.1|557057_557339_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_000235987.1|557348_558053_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
WP_000355602.1|558063_558357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|559032_559782_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|560030_560984_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177481.1|561497_562259_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
561408:561454	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224575.1|562441_563332_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001300620.1|563332_566305_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000420970.1|568799_569936_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	787951	799275	4629812	terminase,integrase,tail	Escherichia_phage(45.45%)	13	785700:785714	791733:791747
785700:785714	attL	CATTAAAGACTGGCC	NA	NA	NA	NA
WP_000533643.1|787951_789022_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|788999_789218_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545729.1|789257_789425_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
WP_000002107.1|789497_789782_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000376718.1|789774_790059_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
WP_000113283.1|790568_790754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472362.1|790886_791501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218995.1|791454_792006_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
791733:791747	attR	CATTAAAGACTGGCC	NA	NA	NA	NA
WP_001130801.1|792008_793631_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_001104982.1|794899_795295_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
WP_000204789.1|795336_796362_-	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
WP_000394418.1|796754_798092_+	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
WP_000603805.1|798129_799275_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
>prophage 3
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	881131	957813	4629812	integrase,portal,lysis,capsid,tail,tRNA,plate,protease,terminase	Salmonella_phage(46.51%)	77	878030:878045	964836:964851
878030:878045	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000290930.1|881131_882148_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
WP_001321204.1|882334_882526_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047321.1|882541_883111_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
WP_001247707.1|883236_883458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|883490_884000_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|884007_884208_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|884171_884513_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|884580_884814_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|884813_885041_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104175.1|885037_885895_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_000017603.1|885891_888306_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
WP_001154431.1|888458_888647_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|888657_888891_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|889083_889419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034589.1|889891_890815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320043.1|890977_891940_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_000520360.1|891957_892983_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_001098413.1|892982_894749_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_000216259.1|894891_895644_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
WP_000196203.1|895780_896209_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	8.1e-58
WP_001039932.1|896304_896736_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
WP_000829156.1|896728_897175_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
WP_000115390.1|897116_897923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993743.1|898026_898605_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_000177591.1|898601_898961_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_000268294.1|898947_899856_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001086815.1|899848_900454_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
WP_000104800.1|900450_902073_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.5	6.2e-151
WP_000280166.1|902074_902512_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
WP_000368077.1|902483_903086_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
WP_012767713.1|903085_903628_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.5	1.9e-56
WP_000972391.1|904386_904605_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|904840_906526_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|906795_907173_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195240.1|907202_907460_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|907619_907907_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|907890_908613_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|908673_909576_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|909663_910140_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126069.1|910490_911603_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|911697_912831_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105444.1|912840_913794_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061667.1|913790_914636_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|914695_915184_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149743.1|915224_916352_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295905.1|916550_917282_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|917572_918241_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|918240_918957_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|918963_919695_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|919712_920441_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|920658_921174_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|921299_921623_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255168.1|921619_922450_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|922446_923460_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136577.1|923558_924989_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566356.1|924999_926001_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815335.1|926037_927756_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|927888_928857_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|928868_930521_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|930664_931564_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|932058_932754_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|933178_934837_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|934833_935790_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746443.1|935940_937056_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|937052_938999_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|939071_939296_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|939618_939939_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001040187.1|943282_943501_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|943785_944490_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202189.1|944531_946253_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043577.1|946253_948020_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|948142_949108_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|949652_950147_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077053.1|950281_954310_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|954464_955076_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|955086_956430_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|956520_957813_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
964836:964851	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 4
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	1403732	1428499	4629812	integrase,tail,tRNA,lysis	Escherichia_phage(38.46%)	32	1398117:1398132	1420728:1420743
1398117:1398132	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001301114.1|1403732_1404965_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
WP_000387388.1|1405219_1406203_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1406680_1408054_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1408182_1409118_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040858.1|1409169_1410405_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|1410406_1410622_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1410700_1410910_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1410902_1411097_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1411153_1411963_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105139.1|1411955_1414556_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
WP_000632297.1|1414657_1414933_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1415007_1415178_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1415177_1415399_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1415840_1416329_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1416325_1416481_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_012775985.1|1416624_1416837_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	96.9	3.0e-29
WP_000193293.1|1416841_1417186_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370546.1|1417151_1417424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|1417529_1418063_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001228696.1|1418279_1418465_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097897.1|1418661_1420119_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291101.1|1420256_1420688_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
WP_000770037.1|1420792_1421557_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
1420728:1420743	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_024182056.1|1421856_1423881_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
WP_000654171.1|1423877_1424156_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
WP_000355360.1|1424168_1424462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078178.1|1424689_1425280_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1425596_1425830_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1425898_1426012_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|1426351_1426525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|1426790_1427225_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837924.1|1427365_1428499_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 5
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	1597219	1649976	4629812	tail,protease,transposase,lysis	Escherichia_phage(26.47%)	63	NA	NA
WP_000527826.1|1597219_1598680_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
WP_120795384.1|1600655_1600769_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1600837_1601071_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1601386_1601977_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355603.1|1602204_1602498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235975.1|1602508_1603213_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_001205170.1|1603222_1603504_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
WP_000741760.1|1603503_1605882_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
WP_001230558.1|1605946_1606546_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
WP_085947771.1|1607981_1609143_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000548593.1|1609297_1609504_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1609799_1609973_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1610145_1610301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|1610448_1610637_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1610647_1610860_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071781.1|1611223_1611721_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|1611717_1612251_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|1612364_1612625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189920.1|1612572_1613124_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	49.4	3.3e-35
WP_000839587.1|1613128_1613344_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_001146314.1|1613534_1614248_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947598.1|1615535_1616697_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000780584.1|1617067_1617592_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1617747_1618125_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265279.1|1618142_1618793_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
WP_012775982.1|1618794_1619073_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000981003.1|1619139_1619391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1619607_1619820_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_021568046.1|1620375_1621041_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001366387.1|1621094_1621328_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001151183.1|1621324_1621747_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_000054497.1|1621787_1622753_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705360.1|1622733_1623255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1623238_1623466_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1623546_1623954_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|1624122_1624275_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241299.1|1624274_1624652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|1624620_1624821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854560.1|1625323_1625512_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083270.1|1625508_1625700_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048322.1|1625793_1628265_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
WP_000005552.1|1628337_1628589_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001531709.1|1629928_1630033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836067.1|1630090_1631110_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1631121_1632336_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1632541_1632868_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1633002_1633344_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1633378_1633939_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1633941_1634652_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1634759_1635065_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041695.1|1635263_1637690_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
WP_001340362.1|1637750_1640174_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1640184_1640802_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1640803_1641658_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1641700_1642315_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_001315626.1|1642473_1643766_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1643718_1644414_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1644538_1645759_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1645893_1646787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1646893_1648147_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743942.1|1648543_1648879_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|1648971_1649055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|1649154_1649976_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	2040270	2049127	4629812		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000998544.1|2040270_2041383_-	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
WP_001060533.1|2041392_2042817_-	O7 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100801.1|2042820_2043366_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
WP_000857508.1|2043370_2044249_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001023616.1|2044307_2045207_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000699450.1|2045206_2046292_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_000183060.1|2046664_2047558_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|2047732_2049127_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 7
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	2095983	2110535	4629812	tail,tRNA,plate	Escherichia_phage(36.36%)	14	NA	NA
WP_000675150.1|2095983_2097387_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2097383_2098106_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2098296_2098629_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2098774_2100136_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|2100408_2100627_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001251411.1|2100708_2101488_-|tail	phage major tail tube protein	tail	A0A0F7LDR0	Escherichia_phage	98.8	1.9e-73
WP_001286736.1|2101500_2102691_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	98.2	2.6e-223
WP_015833292.1|2103733_2103949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348282.1|2103926_2105039_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000104717.1|2105250_2108109_-|tail	phage tail protein	tail	A0A0A0YPY9	Escherichia_phage	76.7	0.0e+00
WP_001285323.1|2108119_2108650_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001121455.1|2108642_2109551_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
WP_000127144.1|2109555_2109903_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
WP_001093750.1|2109899_2110535_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
>prophage 8
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	2116485	2124234	4629812	integrase	Salmonella_phage(36.36%)	12	2108978:2108991	2128702:2128715
2108978:2108991	attL	CGTTACGCACCACC	NA	NA	NA	NA
WP_000268610.1|2116485_2118768_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.2	0.0e+00
WP_000027664.1|2118757_2119033_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113266.1|2119029_2119254_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_001277898.1|2119256_2119556_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557697.1|2119555_2119780_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
WP_000217677.1|2119843_2120344_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|2120340_2120511_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2120521_2120797_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2120918_2121218_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985265.1|2121333_2122347_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	1.2e-192
WP_001318299.1|2122612_2122930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807361.1|2123334_2124234_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
2128702:2128715	attR	GGTGGTGCGTAACG	NA	NA	NA	NA
>prophage 9
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	2159162	2168604	4629812		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001300968.1|2159162_2160299_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001300967.1|2160295_2162296_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001296231.1|2162420_2162882_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2162922_2163393_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2163439_2164159_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_015833303.1|2164155_2165841_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	2.8e-303
WP_001240403.1|2166062_2166794_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216966.1|2166853_2166961_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2166941_2167673_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569344.1|2167677_2168604_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 10
NC_012967	Escherichia coli B str. REL606, complete sequence	4629812	2751952	2765135	4629812		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|2751952_2754514_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141307.1|2754619_2755276_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001295181.1|2755326_2756094_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847971.1|2756289_2757198_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590371.1|2757194_2758457_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
WP_001278994.1|2758453_2759092_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|2759096_2759873_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104459.1|2759961_2761326_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2761419_2762412_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|2762474_2763614_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2763753_2764380_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2764373_2765135_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
