The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	197175	259502	4979619	transposase,protease,plate,tRNA	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_012000909.1|197175_198528_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198557_200990_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|201111_201597_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201600_202626_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202730_203186_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203189_203978_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|203977_205126_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205122_205719_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205755_209238_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209250_210210_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020977.1|210308_212450_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212506_212896_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|212960_214259_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214307_214568_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214554_214755_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185298.1|214920_215466_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215462_215885_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215898_216609_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399635.1|216858_217839_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260701.1|218918_220637_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|220748_221456_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|221452_221857_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|221974_222790_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|222829_223483_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|223475_224507_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|224694_225270_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|231165_231969_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648572.1|231965_232880_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|233120_233921_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|233998_234769_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|234816_236175_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|236246_237002_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012000911.1|237035_237758_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|237754_238222_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|238286_239018_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|239556_240342_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|240478_240958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|240967_241882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|241925_242408_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|242431_243784_-	membrane protein	NA	NA	NA	NA	NA
WP_122986593.1|243794_247229_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|247337_248750_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|248754_249498_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614397.1|249494_252254_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	9.4e-83
WP_000343302.1|252262_253024_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|253028_254360_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080158.1|254362_254887_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113701.1|254883_256164_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348806.1|256188_257271_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393845.1|257234_259085_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|259088_259502_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	826879	857434	4979619	tail,transposase,terminase,lysis,integrase	Enterobacteria_phage(53.85%)	45	826792:826806	855505:855519
826792:826806	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533673.1|826879_827950_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
WP_001303849.1|827927_828146_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|828185_828353_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|828595_829198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|829408_829630_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|829728_830010_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|830020_830212_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|830184_830367_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|830363_831044_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|831040_831826_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|831831_832128_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|832203_832410_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|833007_833763_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|833801_834032_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182905.1|834101_834641_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	4.4e-61
WP_032144743.1|834727_835657_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.3e-110
WP_000788813.1|835653_836355_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000145915.1|836351_836654_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|836721_837054_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001301135.1|837102_837252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998104.1|839145_840684_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
WP_000612591.1|840733_841081_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|841077_841458_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001301145.1|841895_842678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|842772_842874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053031.1|842870_843326_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	3.7e-61
WP_000224914.1|843325_843496_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774484.1|843488_843779_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099708.1|843775_844138_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.0	1.8e-58
WP_001316941.1|844134_844275_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.9e-09
WP_001204780.1|844360_844744_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737263.1|844932_846015_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|846603_846819_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135276.1|846818_847316_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001082750.1|847312_847750_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	7.9e-69
WP_001028465.1|847954_848476_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|848825_849236_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|849292_849526_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453576.1|849914_850460_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027253.1|850434_852024_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.0	0.0e+00
WP_000127647.1|852029_852875_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.5	2.6e-44
WP_000885606.1|852874_853459_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.0e-103
WP_000586344.1|853532_854864_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767389.1|855609_856086_-	kinase inhibitor	NA	NA	NA	NA	NA
855505:855519	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_001389241.1|856144_857434_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 3
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	972263	1074413	4979619	protease,tail,transposase,plate,tRNA,integrase	Escherichia_phage(30.0%)	86	959871:959886	1032942:1032957
959871:959886	attL	TCTTCTTCTTCCGGCG	NA	NA	NA	NA
WP_000520781.1|972263_972584_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|972614_974891_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|975634_975853_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|976137_976842_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202222.1|976883_978605_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	7.1e-20
WP_001043613.1|978605_980372_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|980494_981460_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|982004_982499_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077064.1|982633_986740_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|986894_987506_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|987516_988860_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|988950_990243_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850309.1|990481_992926_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	2.5e-220
WP_000213098.1|992936_993554_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534648.1|993555_994419_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165881.1|994454_995081_-	hydrolase	NA	NA	NA	NA	NA
WP_000109289.1|995395_996544_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|996753_998184_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242676.1|998184_999093_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190375.1|999192_999783_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067979.1|999864_1000662_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|1000693_1001689_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|1001782_1002082_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|1002190_1002547_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217671.1|1002724_1003225_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|1003288_1003513_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277966.1|1003512_1003815_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.7e-46
WP_001113264.1|1003814_1004039_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|1004035_1004311_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_000268592.1|1004300_1006577_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.1	0.0e+00
WP_000427721.1|1007690_1008992_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000335230.1|1009000_1009438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000785970.1|1010220_1010340_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000952425.1|1011491_1012664_+|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000544809.1|1012663_1013458_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_012137920.1|1013529_1014909_+|tail	phage tail tape measure protein	tail	A0A0F7LA40	Escherichia_phage	99.8	1.1e-204
WP_000978880.1|1014923_1015403_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	99.4	1.1e-84
WP_000882989.1|1015402_1016566_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.7	1.8e-205
WP_000468308.1|1016647_1016866_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1017185_1019468_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|1019522_1020380_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001297197.1|1020785_1022546_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|1022675_1023368_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057152.1|1023566_1024655_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	7.8e-81
WP_000445231.1|1024725_1026009_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|1026177_1026942_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|1027114_1027798_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1027908_1029582_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1029741_1030026_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|1030232_1032497_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1032533_1034282_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
1032942:1032957	attR	TCTTCTTCTTCCGGCG	NA	NA	NA	NA
WP_000570542.1|1034278_1035265_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|1035301_1036534_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1036585_1036768_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|1036764_1037511_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|1037664_1038558_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|1038534_1039314_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|1039449_1040235_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|1040231_1041554_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|1041534_1042239_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572634.1|1042238_1046699_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925992.1|1046959_1048807_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1048987_1049536_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1049562_1050210_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1050431_1051622_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|1051806_1052895_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1053496_1054897_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|1055065_1056268_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|1056533_1059146_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090508.1|1059352_1060120_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000235203.1|1060116_1060908_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_000055996.1|1060918_1062064_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000514022.1|1062301_1062997_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	1.6e-132
WP_001300256.1|1062947_1063136_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905065.1|1063230_1063812_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	100.0	4.1e-105
WP_000972133.1|1064833_1065367_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.3	1.2e-95
WP_000972132.1|1065395_1065923_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	82.9	1.3e-78
WP_000499354.1|1065924_1067334_-|tail	tail protein	tail	C9DGQ8	Escherichia_phage	49.7	1.9e-103
WP_000301696.1|1067333_1067876_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331810.1|1067866_1068949_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	99.7	9.1e-207
WP_000130548.1|1068949_1069387_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|1069383_1069977_-|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072829.1|1069964_1071104_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000666029.1|1071485_1073474_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	100.0	0.0e+00
WP_000551058.1|1073481_1073703_-	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	98.6	1.4e-34
WP_000986830.1|1073888_1074413_+	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	90.2	2.3e-83
>prophage 4
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	1262111	1291367	4979619	tail,terminase,holin,lysis,integrase	Enterobacteria_phage(32.14%)	39	1256338:1256352	1263686:1263700
1256338:1256352	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074996.1|1262111_1263230_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	2.5e-82
WP_000003742.1|1263198_1263468_-	excisionase	NA	NA	NA	NA	NA
WP_001083283.1|1266000_1266192_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
1263686:1263700	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_000449196.1|1266188_1266377_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1266940_1267150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012138129.1|1267150_1267789_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	5.7e-07
WP_001394175.1|1267800_1267953_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	4.6e-08
WP_001303511.1|1268244_1268523_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012138131.1|1268524_1268716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169688.1|1268736_1269108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1269206_1269509_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693838.1|1269505_1269931_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095679.1|1269954_1270902_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	58.3	2.9e-84
WP_000788770.1|1270908_1271655_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.5	2.3e-116
WP_000450664.1|1271676_1272438_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.6e-117
WP_001151247.1|1272453_1272876_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.3	3.2e-67
WP_000160144.1|1273394_1273817_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	44.0	6.2e-18
WP_000018421.1|1274050_1274263_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_032155008.1|1274430_1274709_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001265302.1|1274710_1275766_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	1.1e-87
WP_000140027.1|1275766_1276132_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.9e-39
WP_001064887.1|1276128_1276818_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.8	2.3e-54
WP_000392434.1|1276962_1277727_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.7e-45
WP_000615424.1|1277723_1278467_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	42.3	7.7e-48
WP_000917766.1|1278686_1278884_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	5.2e-28
WP_000185912.1|1279034_1280084_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	6.1e-184
WP_000904532.1|1280562_1280823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294587.1|1280911_1281304_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	1.2e-47
WP_001471414.1|1281293_1281569_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	94.5	5.7e-41
WP_001117824.1|1281571_1281949_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.9e-64
WP_126125481.1|1281963_1282146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958717.1|1282233_1282443_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	58.3	9.1e-15
WP_000867507.1|1283291_1283846_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	77.0	8.8e-73
WP_000279135.1|1284107_1287521_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885577.1|1287520_1288105_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|1288159_1288828_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1288884_1289151_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000798514.1|1289383_1290247_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531602.1|1290230_1291367_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 5
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	1419323	1439074	4979619		Escherichia_phage(31.58%)	28	NA	NA
WP_000048491.1|1419323_1421795_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001093951.1|1421874_1422078_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|1422074_1422263_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935599.1|1422273_1423128_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	68.6	7.5e-71
WP_001353256.1|1423348_1423612_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_001051723.1|1424134_1424419_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000447543.1|1424563_1424719_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.1e-08
WP_001003379.1|1424909_1425317_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|1425394_1425622_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705377.1|1425605_1426157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020534.1|1426128_1427169_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_162749923.1|1427080_1427623_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	93.5	1.6e-79
WP_001353252.1|1427652_1428048_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	53.6	3.5e-31
WP_001353251.1|1428044_1428341_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	2.0e-47
WP_000935426.1|1428721_1428934_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	3.7e-32
WP_001033793.1|1428972_1429527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556393.1|1429523_1430456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184904.1|1430825_1431038_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	2.4e-26
WP_000980990.1|1431254_1431506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041031728.1|1431572_1431851_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.7e-05
WP_001265115.1|1431852_1432902_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.5e-108
WP_001217445.1|1432914_1433274_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	3.7e-40
WP_001064887.1|1433270_1433960_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.8	2.3e-54
WP_000392434.1|1434104_1434869_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.7e-45
WP_000615424.1|1434865_1435609_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	42.3	7.7e-48
WP_000917767.1|1435828_1436026_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_012138278.1|1436176_1437223_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	93.1	5.5e-193
WP_001294580.1|1438723_1439074_+	hypothetical protein	NA	Q9MBZ5	Enterobacteria_phage	98.1	2.0e-14
>prophage 6
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	1750166	1786502	4979619	tail,transposase,terminase,holin,lysis,integrase	Enterobacteria_phage(24.14%)	43	1741863:1741876	1781280:1781293
1741863:1741876	attL	ATTTCATCTTTTGT	NA	NA	NA	NA
WP_000527797.1|1750166_1751627_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000347483.1|1751715_1752999_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1753603_1753717_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1753785_1754019_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086531.1|1754335_1754926_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	1.1e-23
WP_000885587.1|1755023_1755599_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_113684608.1|1755598_1756315_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	100.0	4.2e-91
WP_071819443.1|1756323_1756578_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.8	2.1e-37
WP_000381401.1|1756609_1758181_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|1758200_1758548_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000998104.1|1759034_1760573_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
WP_000612591.1|1760622_1760970_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1760966_1761347_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_012138449.1|1761394_1761637_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.2	7.6e-29
WP_000066485.1|1762390_1762606_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_001047132.1|1763281_1764034_-	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_001265197.1|1764047_1765097_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_001309521.1|1765098_1765377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1765443_1765695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887486.1|1765911_1766124_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_122985418.1|1766168_1766276_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000084873.1|1766745_1768521_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	30.9	4.1e-63
WP_000169527.1|1769147_1769447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000054480.1|1770570_1771536_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	3.4e-56
WP_000705359.1|1771516_1772038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1772021_1772252_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379970.1|1772335_1772743_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379589.1|1772909_1773065_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344951.1|1773066_1773642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1774128_1774317_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1774313_1774505_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048365.1|1774598_1777076_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	6.5e-59
WP_001296941.1|1777163_1777400_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876978.1|1777434_1778715_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1778734_1778845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1778902_1779922_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1779933_1781148_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1781353_1781680_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1781280:1781293	attR	ACAAAAGATGAAAT	NA	NA	NA	NA
WP_000705197.1|1781814_1782156_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1782190_1782751_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1782753_1783464_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1783571_1783877_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|1784075_1786502_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
>prophage 7
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	2137537	2221208	4979619	tail,transposase,plate,integrase,terminase,capsid,head	Escherichia_phage(17.5%)	98	2172918:2172977	2221278:2221354
WP_000826451.1|2137537_2138701_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
WP_000879833.1|2140089_2140887_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2140896_2141448_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070441.1|2141616_2141949_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274292.1|2142282_2142597_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994404.1|2142811_2144470_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2144462_2145458_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282701.1|2145450_2146137_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213311.1|2146136_2147510_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2147528_2147972_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620118.1|2147968_2149096_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133122.1|2149200_2149665_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2149669_2150674_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282085.1|2150670_2151084_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001299290.1|2151086_2151452_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2151451_2152189_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2152198_2152468_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983976.1|2152476_2153262_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2153551_2154175_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2154218_2154461_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2154569_2154797_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491501.1|2155094_2155910_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077625689.1|2155906_2157601_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.1e-17
WP_000009307.1|2157771_2157954_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2158032_2158950_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2159122_2160043_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785994.1|2160031_2160502_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001157274.1|2160482_2161901_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.3	1.1e-100
WP_000365561.1|2161967_2162663_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|2162702_2163068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|2163635_2164709_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218209.1|2165300_2166152_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826769.1|2166259_2167618_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|2167617_2168289_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|2168421_2168835_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000730130.1|2168943_2169948_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|2169948_2170584_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2170840_2171491_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079063.1|2171833_2172364_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
2172918:2172977	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_000974855.1|2173342_2174353_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_001287093.1|2174358_2175402_-	phage late control protein	NA	R9TNM7	Vibrio_phage	28.7	9.9e-33
WP_000634204.1|2175405_2175618_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|2175634_2175877_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_024184912.1|2175855_2176245_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	39.5	1.5e-15
WP_012138675.1|2176280_2177921_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
WP_000444666.1|2178029_2178311_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001285189.1|2178323_2178836_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000106127.1|2178853_2180359_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	35.8	3.7e-73
WP_000829620.1|2180370_2181519_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	36.9	3.7e-17
WP_000203867.1|2181511_2182138_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	31.2	7.0e-26
WP_000633315.1|2182140_2183061_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.1	3.5e-66
WP_000467660.1|2183057_2183399_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	3.1e-20
WP_000079172.1|2183401_2184307_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	34.7	2.9e-12
WP_000015611.1|2184287_2184824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774515.1|2184820_2185501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122902.1|2185532_2185913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105180.1|2185909_2186323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283999.1|2186357_2187392_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.1	4.6e-107
WP_000206291.1|2187453_2187783_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|2187782_2189093_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_000544809.1|2190087_2190882_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952425.1|2190881_2192054_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_012565126.1|2192789_2193023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|2193019_2194885_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|2194871_2195438_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|2195810_2196056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004432.1|2196341_2196812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125258.1|2196885_2197134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000734932.1|2197235_2197427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131874.1|2197434_2197914_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
WP_001294589.1|2198097_2198481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064385.1|2198593_2199265_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	30.9	2.3e-14
WP_000717782.1|2199264_2199558_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_000057009.1|2199554_2200151_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	3.0e-71
WP_001025459.1|2200228_2200408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000855416.1|2200559_2201201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066090.1|2201710_2202490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582583.1|2202968_2203631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282641.1|2203953_2205333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353907.1|2205658_2206465_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.8	4.9e-40
WP_000166883.1|2206545_2207781_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001013409.1|2207912_2208473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237643.1|2208925_2209849_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000211984.1|2210026_2210821_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	73.8	1.4e-47
WP_000466604.1|2211093_2211315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002789.1|2211502_2211727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192614.1|2211956_2212358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067617.1|2212396_2213788_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	46.5	1.9e-103
WP_000088681.1|2213784_2214849_-	hypothetical protein	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_000943913.1|2214851_2215076_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_000431150.1|2215115_2215592_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	8.5e-24
WP_000846364.1|2215651_2215849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184914.1|2215923_2216331_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	68.1	9.1e-43
WP_000423305.1|2216510_2216735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000100755.1|2219003_2219573_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.0	1.7e-34
WP_000916333.1|2219572_2219755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998966.1|2219964_2220180_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	69.0	6.1e-22
WP_000091778.1|2220179_2221208_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.7	2.1e-96
2221278:2221354	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 8
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	2292511	2298819	4979619		Escherichia_phage(33.33%)	6	NA	NA
WP_001100787.1|2292511_2293060_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.4	5.5e-51
WP_000857521.1|2293064_2293943_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023620.1|2294000_2294900_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.8e-28
WP_000699436.1|2294899_2295985_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	2.1e-102
WP_000183032.1|2296356_2297250_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116032.1|2297424_2298819_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.4	9.8e-20
>prophage 9
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	2391478	2399787	4979619		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001371026.1|2391478_2393479_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001295429.1|2393603_2394065_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2394105_2394576_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2394622_2395342_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2395338_2397024_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2397245_2397977_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2398036_2398144_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2398124_2398856_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|2398860_2399787_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	3028074	3040113	4979619	integrase	Escherichia_phage(62.5%)	8	3027047:3027060	3046722:3046735
3027047:3027060	attL	GACTGAGGGCAAAG	NA	NA	NA	NA
WP_000695422.1|3028074_3030093_-	RNA-directed DNA polymerase	NA	A0A0H4TEY7	Erysipelothrix_phage	25.9	2.0e-29
WP_000858985.1|3031347_3032808_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.2	5.4e-21
WP_001696757.1|3032967_3035535_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.0e-30
WP_001141325.1|3035640_3036297_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001272549.1|3036347_3037145_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3037310_3038219_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590385.1|3038215_3039478_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001278994.1|3039474_3040113_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
3046722:3046735	attR	CTTTGCCCTCAGTC	NA	NA	NA	NA
>prophage 11
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	3288735	3362993	4979619	transposase,protease,integrase,tRNA	Pseudomonas_phage(18.18%)	59	3280947:3280961	3329018:3329032
3280947:3280961	attL	TTGCGCCCTACCAGT	NA	NA	NA	NA
WP_001297457.1|3288735_3289494_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|3289549_3290293_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000193113.1|3290279_3291389_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160370941.1|3291392_3292253_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|3292249_3292999_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|3293024_3293510_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|3293520_3293949_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252649.1|3294067_3296866_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|3297124_3298045_-	agmatinase	NA	NA	NA	NA	NA
WP_000758912.1|3298180_3298912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3299057_3301034_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3301042_3301174_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3301309_3301525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3301828_3302983_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3303418_3304813_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001495390.1|3304889_3305387_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3305481_3306189_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3306268_3307000_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3307012_3307963_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3307999_3308635_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3308634_3309051_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055627.1|3309243_3310224_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3310241_3310946_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3310963_3311530_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3311526_3311817_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|3311824_3312418_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239931.1|3312410_3313547_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|3313701_3314709_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394128.1|3314825_3315872_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3316047_3316767_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3316950_3317277_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3317276_3317996_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001295382.1|3318156_3319209_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3319236_3319512_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3319576_3320656_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_012139157.1|3320857_3322114_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839764.1|3322163_3324299_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3324696_3325404_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218767.1|3325782_3327045_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	6.9e-81
WP_000286652.1|3330028_3332878_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
3329018:3329032	attR	TTGCGCCCTACCAGT	NA	NA	NA	NA
WP_001273465.1|3332903_3333884_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|3333893_3336281_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|3336290_3337919_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|3337921_3340792_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|3340880_3341174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189107.1|3341748_3343257_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.1e-43
WP_000005572.1|3345109_3346396_-	McrC family protein	NA	NA	NA	NA	NA
WP_000366615.1|3346388_3348446_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	2.9e-36
WP_001013333.1|3349218_3349644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077625696.1|3349640_3350030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860848.1|3350394_3350994_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072146520.1|3351225_3351375_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001367564.1|3352443_3353235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371489.1|3353619_3353826_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804439.1|3353919_3354522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255956.1|3356791_3357814_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000544809.1|3358161_3358956_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|3358955_3360128_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_000998104.1|3361454_3362993_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
>prophage 12
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	3373400	3408159	4979619	transposase,integrase	Stx2-converting_phage(36.36%)	26	3378189:3378203	3408597:3408611
WP_000534925.1|3373400_3374459_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000934715.1|3374500_3376156_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000060046.1|3376148_3377678_-	ATP-binding domain-containing protein	NA	A0A1Q1N983	Escherichia_phage	29.6	1.2e-42
WP_000241214.1|3377802_3381057_-	invasin	NA	NA	NA	NA	NA
3378189:3378203	attL	TGACATTGCCATTGA	NA	NA	NA	NA
WP_000423968.1|3381236_3381629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184924.1|3381635_3382178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184925.1|3382304_3382775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054266.1|3383222_3385115_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.6	3.7e-46
WP_001023219.1|3385116_3386940_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_000088805.1|3387411_3388104_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.5	1.2e-29
WP_001704819.1|3388144_3388822_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3388821_3389169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|3389188_3390760_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000544812.1|3390925_3391753_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.4	1.7e-80
WP_000952425.1|3391752_3392925_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_000852651.1|3393099_3394467_-	replicative DNA helicase	NA	O80281	Escherichia_phage	54.6	1.6e-120
WP_001095318.1|3395666_3396095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240585.1|3396169_3396430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023820.1|3396423_3397302_-	ParA family protein	NA	NA	NA	NA	NA
WP_001218737.1|3397618_3398803_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	1.7e-121
WP_000053333.1|3398952_3399963_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000253907.1|3400058_3402185_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_001083367.1|3402247_3403525_+	MFS transporter	NA	NA	NA	NA	NA
WP_000813679.1|3403524_3404955_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001037798.1|3405149_3406544_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000998104.1|3406620_3408159_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
3408597:3408611	attR	TGACATTGCCATTGA	NA	NA	NA	NA
>prophage 13
NC_009801	Escherichia coli O139:H28 str. E24377A, complete sequence	4979619	4797211	4856442	4979619	transposase,protease,tRNA	Stx2-converting_phage(15.0%)	49	NA	NA
WP_001162171.1|4797211_4798564_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|4798746_4799133_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106238.1|4799177_4799642_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187795.1|4799800_4801939_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001349991.1|4802332_4803988_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|4804037_4805459_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181332.1|4805577_4806525_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|4806709_4806763_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471863.1|4806903_4809600_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.2	1.2e-45
WP_000399648.1|4809827_4810808_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_012139797.1|4811084_4811471_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4811543_4812005_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4812017_4812953_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4812956_4813091_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|4813371_4813767_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500727.1|4813897_4814611_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|4814681_4815275_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4815419_4815872_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001594700.1|4815994_4817404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012927.1|4817650_4818664_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4818825_4819242_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|4819287_4819791_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079661.1|4819983_4821180_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416400.1|4821235_4824091_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4824090_4824534_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4824887_4826399_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584111.1|4826665_4827766_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4827765_4828848_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|4829008_4830511_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001594701.1|4830638_4831658_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_001189112.1|4833843_4835352_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_049828170.1|4836842_4837232_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|4837282_4837501_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000169527.1|4837567_4837867_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878230.1|4837863_4838730_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
WP_000625670.1|4839009_4840287_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_041031764.1|4840349_4842347_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|4842500_4843640_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_012139822.1|4843820_4844765_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001300030.1|4844829_4845780_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_012139824.1|4845784_4846873_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_160503820.1|4846875_4847718_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001189123.1|4849293_4850802_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000998104.1|4851404_4852943_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
WP_000612591.1|4852992_4853340_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4853336_4853717_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000177057.1|4853902_4854160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4854717_4855485_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4855485_4856442_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 1
NC_009788	Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence	70609	0	1721	70609		Xanthomonas_phage(100.0%)	2	NA	NA
WP_000006012.1|902_1136_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001276114.1|1193_1721_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
>prophage 2
NC_009788	Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence	70609	5474	68293	70609	transposase,integrase	Stx2-converting_phage(33.33%)	56	6354:6368	58031:58045
WP_000086174.1|5474_6158_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	8.7e-30
6354:6368	attL	TGGCGTACACTGTCA	NA	NA	NA	NA
WP_001394936.1|6541_7444_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000272015.1|8124_8517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217833.1|8520_9495_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	5.3e-73
WP_001394937.1|9733_9937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|10107_10740_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_001164207.1|11341_12127_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000465043.1|12128_12542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|13100_13331_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044769.1|13327_13744_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350636.1|13905_16044_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000998104.1|16359_17898_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
WP_000612591.1|17947_18295_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|18291_18672_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_012000738.1|19096_19687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142434.1|19704_20052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762576.1|20170_20554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000588732.1|20995_21856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011387711.1|22171_23368_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071595697.1|26415_26619_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947917.1|28794_30067_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000718015.1|30755_31847_-	CS19 fimbria tip adhesin CsdD	NA	NA	NA	NA	NA
WP_000579073.1|31843_34462_-	CS19 fimbria usher CsdC	NA	NA	NA	NA	NA
WP_000768757.1|34543_35059_-	CS1 fimbrial subunit A	NA	NA	NA	NA	NA
WP_001393302.1|35109_35826_-	CS1 fimbrial subunit B	NA	NA	NA	NA	NA
WP_001039240.1|36082_36262_+	hypothetical protein	NA	Q9ETV7	Enterobacteria_phage	62.0	2.1e-07
WP_000544809.1|38757_39552_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|39551_40724_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_000195512.1|41551_41821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162749922.1|41893_42034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000907853.1|42731_43763_-	replication initiation protein	NA	NA	NA	NA	NA
WP_024184884.1|44735_44999_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	4.7e-08
WP_000483804.1|44967_45204_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_012000741.1|45645_46179_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000213856.1|46431_47115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041031712.1|47286_47541_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000163752.1|47801_48098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685263.1|48743_49811_+	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000539811.1|49810_50248_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001189123.1|51888_53397_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_113684605.1|54024_55716_+	traM recognition site of TraD and TraG family protein	NA	NA	NA	NA	NA
WP_001545749.1|55752_58452_-	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
58031:58045	attR	TGGCGTACACTGTCA	NA	NA	NA	NA
WP_001283947.1|58462_58795_-	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_000157095.1|59028_59364_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001077015.1|59449_60298_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_042838869.1|60541_60820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381401.1|61000_62572_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|62591_62939_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|62938_63616_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_014358130.1|63867_64089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000038342.1|64088_64979_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.8	2.2e-65
WP_000833767.1|64975_65365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|65541_65808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218866.1|65901_66336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012000743.1|67064_67625_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_000978012.1|67696_68293_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
>prophage 1
NC_009790	Escherichia coli O139:H28 str. E24377A plasmid pETEC_74, complete sequence	74224	3513	66795	74224	transposase,protease	Stx2-converting_phage(41.67%)	50	NA	NA
WP_001704819.1|3513_4191_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4190_4538_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|4557_6129_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000124102.1|7136_7502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845924.1|9966_10401_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001312861.1|11387_11546_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001189123.1|13382_14891_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000544809.1|15817_16612_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952425.1|16611_17784_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.8	1.2e-215
WP_032178760.1|18276_18519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001365320.1|18515_19418_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|20026_20998_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|20997_22164_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_001189123.1|23259_24768_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000086139.1|27396_28182_+	DUF1380 family protein	NA	A0A2I7RE86	Vibrio_phage	35.5	4.7e-11
WP_000218642.1|29360_29591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170659.1|29642_31004_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001365958.1|31050_31614_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	35.4	2.3e-20
WP_001337416.1|32131_32368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272251.1|32430_32727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234441.1|32837_33659_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_000544809.1|34346_35141_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	94.3	1.3e-138
WP_000952428.1|35140_36313_-|transposase	IS21-like element ISEc62 family transposase	transposase	U5N3F9	Enterobacteria_phage	93.1	8.9e-216
WP_001706493.1|36399_36750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137411.1|37060_37444_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000234737.1|38060_38336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998104.1|38652_40191_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
WP_000612591.1|40240_40588_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|40584_40965_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000957858.1|41064_41256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994480.1|41411_41603_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|41743_43022_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|43188_43882_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
WP_140159966.1|43971_44199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001704819.1|44239_44917_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|44916_45264_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|45283_46855_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_001355715.1|47838_48078_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001045022.1|49305_53406_+|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.8	6.6e-274
WP_001119661.1|53748_54453_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000452091.1|54700_55381_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000470631.1|55820_56462_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001159871.1|57505_57811_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|57812_58031_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343092.1|58475_58733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011387704.1|58732_59263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160371899.1|59506_60349_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004100285.1|60351_61440_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_012000752.1|61444_62395_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_000998104.1|65256_66795_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	1.5e-292
>prophage 1
NC_009786	Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence	79237	4145	44444	79237	transposase,integrase	Stx2-converting_phage(19.05%)	47	28776:28793	56166:56183
WP_044307862.1|4145_4319_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
WP_000343720.1|4315_5524_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_000219392.1|5639_6656_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000959870.1|7122_8085_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001393279.1|8087_8438_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_000710536.1|8504_9449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780221.1|9771_10053_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000471255.1|10033_10363_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
WP_013188501.1|11351_11570_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_001189123.1|13920_15429_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_012131086.1|16129_16333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001378495.1|16648_17425_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	80.2	6.5e-122
WP_013188479.1|17421_17796_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	3.7e-51
WP_162749920.1|18116_18971_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	2.7e-68
WP_001254933.1|19019_20171_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000117112.1|20661_22626_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.9	1.0e-22
WP_000845921.1|22680_23058_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276222.1|23111_23873_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000872086.1|23814_24129_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.3	1.5e-13
WP_000775238.1|24336_24498_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_012000721.1|25397_25568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205710.1|25621_26368_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.3	9.3e-09
WP_000704511.1|26426_27287_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840475.1|27389_27950_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001297500.1|28080_28290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393151.1|28701_29328_+	hypothetical protein	NA	NA	NA	NA	NA
28776:28793	attL	TATATCGCTTGCTGATTA	NA	NA	NA	NA
WP_001393319.1|29479_30070_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083830.1|30309_30564_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|30800_30875_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130971.1|30867_31725_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001393354.1|32426_32567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483538.1|32695_33007_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	93.1	3.6e-47
WP_000865086.1|33006_33294_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	87.4	5.1e-40
WP_000115001.1|33670_34180_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	8.8e-19
WP_001395279.1|36106_37057_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_012131088.1|37061_38150_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_162749921.1|38152_38995_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000194543.1|39238_39781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343095.1|39780_40038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829078.1|40559_40778_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|40779_41085_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016959.1|41085_41892_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_001144037.1|42069_42714_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030204.1|42800_43109_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000897157.1|43330_43708_+	protein encoded within IS	NA	A0A0P0ZEB3	Stx2-converting_phage	49.2	5.3e-21
WP_001355605.1|43731_43989_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	64.7	3.2e-25
WP_024184877.1|44108_44444_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.6	5.2e-28
56166:56183	attR	TAATCAGCAAGCGATATA	NA	NA	NA	NA
