The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	151182	190714	3765351	tRNA,transposase	Vibrio_phage(40.0%)	36	NA	NA
WP_012126507.1|151182_151662_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_005428762.1|151728_152247_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005428778.1|152671_154123_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005428800.1|154299_155607_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_021017962.1|155768_157604_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_005428786.1|157799_158435_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005428797.1|158564_159191_+	MarC family protein	NA	NA	NA	NA	NA
WP_005530890.1|159391_159655_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_012126511.1|159667_161395_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_012126512.1|161489_161975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530885.1|162189_162570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126513.1|162586_163972_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_021017961.1|164028_167460_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_021017960.1|167593_168793_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_012126517.1|169033_170860_+	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005428802.1|170895_171528_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_021017959.1|171746_173699_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.5	1.4e-85
WP_005428757.1|174006_174456_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_048813996.1|174516_174993_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005440401.1|175007_176351_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_012126521.1|176481_177369_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_041853441.1|177508_178477_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462885.1|178500_178797_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_021017957.1|179024_180014_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.3	7.4e-22
WP_012126524.1|180151_180640_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_048813997.1|181096_182641_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_011998779.1|182701_183055_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|183051_183363_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012126527.1|183480_185013_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	6.6e-110
WP_012126528.1|185023_185764_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_012126529.1|185847_186174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012126524.1|186446_186935_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157722657.1|186900_187194_+|transposase	transposase	transposase	M4M9P8	Vibrio_phage	77.1	1.3e-14
WP_162471675.1|187244_188279_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_162471675.1|188371_189406_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_162471675.1|189679_190714_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
>prophage 2
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	241273	309936	3765351	tRNA,protease,transposase	Enterobacteria_phage(18.18%)	58	NA	NA
WP_012126556.1|241273_242467_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	3.7e-68
WP_038890960.1|249208_249664_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_012126558.1|249626_250433_-	glutamate racemase	NA	NA	NA	NA	NA
WP_012126561.1|250942_251128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012126562.1|251636_253490_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005451984.1|253933_255043_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_005430908.1|255107_255473_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_005430912.1|255472_256114_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_012126563.1|256375_257806_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_021017946.1|257874_259218_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_009695929.1|259273_260068_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005438488.1|260302_260923_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	43.3	1.4e-10
WP_021017945.1|261291_263718_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_012126569.1|265695_266550_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_005430917.1|266550_267090_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005430919.1|267243_267654_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_012126570.1|267754_268597_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_010650540.1|268596_268917_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_005535656.1|269330_270188_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.0	6.6e-43
WP_005430346.1|270363_271332_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_005535654.1|271321_271996_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.9	6.8e-27
WP_012126572.1|272018_273245_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_012126573.1|273468_274068_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_012126574.1|274093_274360_+	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_005430358.1|274423_275008_-	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_010650549.1|275120_275342_-	DUF2492 family protein	NA	NA	NA	NA	NA
WP_012126576.1|275411_276032_-	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_005430355.1|277052_277418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012126577.1|277610_278372_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_005430363.1|278544_278874_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_012126579.1|278875_279889_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.9	3.7e-08
WP_021017943.1|280139_280520_+	cystatin domain protein	NA	NA	NA	NA	NA
WP_012126581.1|280597_281977_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_012126582.1|282124_283342_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_005430331.1|283600_284095_-	cyclin-dependent kinase inhibitor 3 family protein	NA	NA	NA	NA	NA
WP_012126583.1|284106_285108_-	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_012126584.1|285151_285487_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	55.1	8.1e-21
WP_012126585.1|285589_286813_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005430372.1|286841_287456_-	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_012126586.1|287521_288511_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012126587.1|288682_289495_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005452022.1|289564_290035_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_012126588.1|290076_291627_+	membrane protein	NA	NA	NA	NA	NA
WP_021017942.1|291626_292223_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_012126590.1|292333_294820_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012126591.1|294958_295675_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_012126592.1|295687_296629_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	32.4	9.5e-19
WP_033001370.1|296594_297299_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_012126593.1|297319_298150_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_012126594.1|298160_299414_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012126595.1|299666_299981_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_012126596.1|300056_302585_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_005430387.1|302933_303872_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_012126597.1|303874_304603_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_012126598.1|304620_305802_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012126599.1|305801_306983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162471675.1|307542_308577_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_162471675.1|308901_309936_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
>prophage 3
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	455269	522125	3765351	bacteriocin,transposase,integrase	Indivirus(25.0%)	50	481754:481813	538320:538412
WP_012126680.1|455269_455533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162471675.1|455585_456621_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_041853429.1|456841_457732_-	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_021017933.1|457874_459359_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005427244.1|459766_460018_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_012126683.1|460149_463272_-	multidrug efflux RND transporter permease subunit VmeD	NA	NA	NA	NA	NA
WP_012126684.1|463283_464390_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010650400.1|464408_464993_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012126685.1|465163_467179_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	39.1	3.3e-117
WP_041853263.1|467251_467665_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_041853262.1|468824_469550_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012126689.1|470235_471951_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.4e-20
WP_041853261.1|472056_473610_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012126691.1|473756_474734_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012126692.1|474736_475693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012126693.1|475856_476846_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_012126694.1|478569_480891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095211504.1|480992_481753_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	6.8e-15
481754:481813	attL	GGTATTGGTTATGGTTTTACTTTTGGCGAAGCAAATTATAACTCTTTACCATGTTGTTCA	NA	NA	NA	NA
WP_012126698.1|482019_483564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012126699.1|483568_484141_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021017931.1|484143_485619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012126701.1|485650_487003_-	serine/threonine protein kinase	NA	A0A1V0SDC3	Indivirus	29.8	1.2e-11
WP_012126702.1|487234_488242_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005430035.1|488296_489223_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012126703.1|489426_489804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005429986.1|489806_490136_+	multidrug transporter	NA	NA	NA	NA	NA
WP_012126704.1|490620_491646_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012126705.1|492027_493824_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_012126706.1|493820_494342_-	gluconokinase	NA	NA	NA	NA	NA
WP_012126707.1|494494_495871_+	GntP family permease	NA	NA	NA	NA	NA
WP_012126708.1|495880_496492_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012126710.1|497734_497935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126715.1|499542_499752_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	55.0	4.5e-14
WP_021017930.1|500141_501500_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_041853428.1|501769_502468_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_021017929.1|502619_503459_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_041853259.1|503883_505926_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.4e-45
WP_005430014.1|506011_506476_-	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_012126720.1|506591_509741_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012126721.1|509805_510585_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012126722.1|510791_511391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126723.1|511454_512333_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005430021.1|512403_512829_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_005533534.1|513250_513778_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_012126725.1|513868_514192_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_012126726.1|514346_515540_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021017928.1|515677_516997_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_021017927.1|516989_518735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012126731.1|521575_521836_+	DNA-directed DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	68.4	1.1e-09
WP_012126732.1|521867_522125_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
538320:538412	attR	TGAACAACATGGTAAAGAGTTATAATTTGCTTCGCCAAAAGTAAAACCATAACCAATACCATGCCAAGAACAATGCTAACTGATATTCGATGG	NA	NA	NA	NA
>prophage 4
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	833283	841715	3765351	tRNA,transposase	Leptospira_phage(33.33%)	8	NA	NA
WP_021017903.1|833283_834828_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	9.3e-72
WP_012126950.1|834888_835242_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_021017902.1|835238_835550_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005528793.1|835909_837772_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	4.2e-34
WP_012126952.1|837871_839632_-	DNA primase	NA	A0A1S5RFN0	Helicobacter_phage	32.0	4.5e-46
WP_012126953.1|839780_840224_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.0	2.3e-23
WP_001145625.1|840252_840468_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_041853246.1|840698_841715_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	3.7e-109
>prophage 5
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1044692	1112869	3765351	tRNA,transposase	uncultured_Mediterranean_phage(17.65%)	56	NA	NA
WP_162471672.1|1044692_1045727_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_012127076.1|1045724_1046495_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_012127077.1|1046561_1047305_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005424820.1|1047580_1048189_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_012127078.1|1048389_1049295_+	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_041853237.1|1049901_1051530_+	malate synthase A	NA	NA	NA	NA	NA
WP_005424793.1|1051678_1052992_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_012127080.1|1053093_1053558_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_080514149.1|1053768_1053990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127082.1|1054363_1055416_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_005424899.1|1055612_1056749_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.9	1.4e-93
WP_005424903.1|1056926_1057256_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.9	1.1e-11
WP_005447728.1|1057277_1059134_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_012127083.1|1059148_1060096_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	49.2	1.5e-56
WP_041853413.1|1060446_1060761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005424885.1|1060832_1061636_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_005424881.1|1061867_1062587_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_012127086.1|1062712_1063219_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_012127087.1|1063247_1064462_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	29.9	4.8e-31
WP_005424883.1|1064499_1064883_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_005424893.1|1064956_1065280_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	1.0e-25
WP_005424897.1|1065335_1065851_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012127088.1|1065872_1067726_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.3	2.7e-110
WP_005424889.1|1067739_1068078_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005424887.1|1068122_1068317_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011999187.1|1068393_1069719_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127089.1|1069929_1071228_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.7	9.1e-36
WP_005532589.1|1071328_1071754_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	40.6	2.1e-21
WP_005532587.1|1071964_1073092_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_012127090.1|1073509_1074475_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_005424674.1|1074480_1075599_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_010648375.1|1075654_1076923_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005424701.1|1077048_1077663_+	YfgM family protein	NA	NA	NA	NA	NA
WP_005424650.1|1077675_1078836_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_012127091.1|1079017_1080514_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_012127092.1|1080599_1081478_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_010446190.1|1082846_1083071_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012127095.1|1083063_1084395_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SC03	Catovirus	35.4	4.6e-35
WP_012127096.1|1084627_1086091_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	2.4e-93
WP_005424749.1|1086217_1087771_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_012127098.1|1088875_1090198_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127100.1|1091094_1092795_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_005424684.1|1092977_1093571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853408.1|1094173_1095484_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012127102.1|1095589_1097137_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_012127103.1|1098808_1099729_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033000220.1|1099789_1100242_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	61.9	2.0e-22
WP_012127105.1|1101165_1102194_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011998872.1|1102365_1102563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017686.1|1102478_1103951_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.1	1.3e-131
WP_086028355.1|1105059_1106183_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.0	7.4e-26
WP_012127110.1|1108073_1108919_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_012127114.1|1110337_1110541_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011999494.1|1110606_1110918_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1110914_1111268_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127115.1|1111327_1112869_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
>prophage 6
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1131920	1175408	3765351	tRNA,transposase,integrase	Enterobacteria_phage(20.0%)	34	1131827:1131886	1175443:1176872
1131827:1131886	attL	CTAATGCCGATCAGTTAAGACTTTAATCGGCAGATCAGTTGAATGATCCTACCTGTATGT	NA	NA	NA	NA
WP_011999187.1|1131920_1133246_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127131.1|1137353_1137608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012127132.1|1138177_1138423_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012127133.1|1138560_1139793_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.9	6.3e-71
WP_005424760.1|1140412_1140898_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.4	3.9e-24
WP_005533750.1|1141016_1141460_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_005533748.1|1141449_1141806_+	RnfH family protein	NA	NA	NA	NA	NA
WP_012126481.1|1141860_1143240_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_005424693.1|1143387_1143747_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_005533738.1|1143994_1144477_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005424702.1|1144498_1146163_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_012127134.1|1146593_1147478_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_021017883.1|1147623_1148220_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010648318.1|1148639_1149914_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012127136.1|1150239_1152156_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.9	1.6e-145
WP_012127137.1|1152357_1153503_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.8	3.0e-22
WP_041853235.1|1153598_1154033_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_041853234.1|1154136_1154652_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_021017882.1|1154661_1155288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127141.1|1155287_1156529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127142.1|1156518_1156929_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010648303.1|1157193_1158753_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_021017880.1|1159131_1159665_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_011999494.1|1159975_1160287_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1160283_1160637_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127146.1|1161353_1162547_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_005533708.1|1163892_1165497_-	membrane-bound lytic murein transglycosylase MltF	NA	A0A0E3M2X9	Enterobacter_phage	30.7	1.1e-06
WP_012127148.1|1165820_1169717_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.9	1.5e-126
WP_005424867.1|1170221_1170530_+	DUF3622 domain-containing protein	NA	NA	NA	NA	NA
WP_041853233.1|1170655_1171417_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	1.2e-14
WP_012127151.1|1171485_1171911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005424857.1|1172080_1173151_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_012127152.1|1173481_1174021_+	DUF3332 domain-containing protein	NA	NA	NA	NA	NA
WP_011999187.1|1174082_1175408_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
1175443:1176872	attR	ACATACAGGTAGGATCATTCAACTGATCTGCCGATTAAAGTCTTAACTGATCGGCATTAGTGCCTCGGCACCCTTTTTCGTATTTATGGAATCTGTTTAGGATTACGCTTTTTCTGGAATTGCTTCTAGAAGTGCAACCATTTGATCCCAGAACAGTTGAACGGTATCAATCTTCACTTTCTCATCTGGAGAGTGAGGGAATTTGATGGTTGGACCGAAAGAAACCATATCCATGTTCGGGTAAGGTTCTTTAAATAGACCACACTCAAGACCCGCGTGGATAACCATGATGTTCGGCTTATGACCGTAGATGCCTTCATACATATCACGGAAGATTGCCATGATCTCTGAATCTGCATCAGGTTTCCAACCAGGGTAAGCGCCAGAGAAAGCGATCTGTGCACCAGCTAGTTCTGCTACTGATTGAAGCATACCTTCAACTTGGCTACGACCTGAGTCGATCAATGAGCGAATTAGGCATAGAACCGTTACTGTGTTCTCTTCTGTTGTGATAACGCCAACGTTAAGTGACGTTTCAACCACACCTTCAACTTCATCACTCATGCGCATTACGCCGTTTGGACAAGCATTCAACGCAGCGATGAAACGTTGCTGGTCTGCAATCGCAAACACTTGTGCTTCTGTTGCTACTTCTTCATTGAAAGTCACGATGTCGGTTTCAACTTTACCAAGCTCAGTTTTTAGTAACTCAGTGTAGTAGTTGAATAGCTCTGCCAACTTATCTTGATTCTCAGCTGGTAGAGCAACGGTAACGAAGGCTTCACGAGGGATAGCGTTACGTAGGCTACCACCACGGAACTCAACAAGACGAAGATCCAATTCTTGTGCGTGACCTGCTAGGAAACGGCCTACAAGTTTGTTCGCGTTGCCACGGCCAGTGTGGATGTCACAACCAGAGTGACCACCTTTTAGGCCTTTCAGCGTTAGCTGACGAGTCACAAAACCTGCTGGGATGGCATCACGTGTAATGTCGAATGTCATTGCGCCGTCGATACCGCCAGCACAACCCATGTACACTTCGCCTTCTTGTTCTGAGTCAGTGTTTAGAAGGATGTCGCCTTCCAACCAGCCCGCTTCAAGACCAAATGCGCCTGTCATGCCAGCTTCTTCATCAATCGTTAACAGTACTTCAATAGGGCCGTGTTTGATTTCAGTAGAAGCGAGAACCGCAAGACAAGAAGCCATACCGATGCCGTTGTCCGCACCAAGCGTTGTGCCTTTTGCTGTTACCCACTCGCCATCGATGTATGGTTGGATAGGATCTTTTGTGAAGTCATGATCAGTATCTTCATTCTTTTGCGGCACCATGTCGATGTGCGCTTGAAGAACGACGCCTTTTTTGTTTTCCATGCCCGGCGTCGCTGGTTTCTTAATGAACACGTTGCCAGTTGGATCGCGGCGTACGTCAA	NA	NA	NA	NA
>prophage 7
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1182162	1188853	3765351		Staphylococcus_phage(66.67%)	7	NA	NA
WP_005424865.1|1182162_1183302_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.4	2.9e-62
WP_041853231.1|1183319_1184570_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.5e-99
WP_005424846.1|1184697_1185147_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012127159.1|1185154_1186279_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.1	1.7e-43
WP_005424876.1|1186290_1186944_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	3.3e-34
WP_012127160.1|1187103_1188213_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	3.0e-64
WP_005440184.1|1188382_1188853_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
>prophage 8
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1434558	1486405	3765351	protease,transposase	Leptospira_phage(44.44%)	48	NA	NA
WP_005430932.1|1434558_1435839_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.6	3.3e-131
WP_012127309.1|1435968_1438320_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.8	2.8e-221
WP_012127310.1|1438511_1438784_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	56.8	1.5e-20
WP_012127311.1|1438998_1440858_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012127312.1|1441003_1441291_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021017861.1|1441437_1441989_-	rhombosortase	NA	NA	NA	NA	NA
WP_021017860.1|1441992_1442610_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_021017859.1|1442629_1443952_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_041853219.1|1443967_1444552_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_012127317.1|1444636_1445851_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_012127318.1|1446067_1447375_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_012127319.1|1447371_1449090_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_012127320.1|1449076_1449871_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_041853218.1|1449897_1450764_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_012127322.1|1450894_1451884_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_012127323.1|1451868_1453320_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	31.1	8.6e-27
WP_012127324.1|1453290_1453473_-	phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific	NA	NA	NA	NA	NA
WP_012127325.1|1453646_1453847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017858.1|1453832_1454738_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_012127327.1|1454900_1456775_-	MFS transporter	NA	NA	NA	NA	NA
WP_012127328.1|1456788_1457379_-	WHG domain-containing protein	NA	NA	NA	NA	NA
WP_012127329.1|1457635_1458508_+	TIM44-like domain-containing protein	NA	NA	NA	NA	NA
WP_041853217.1|1459837_1460935_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012127331.1|1460934_1464048_+	multidrug efflux RND transporter permease subunit VmeF	NA	NA	NA	NA	NA
WP_012127332.1|1464138_1464714_-	porin family protein	NA	NA	NA	NA	NA
WP_012127333.1|1464918_1465236_+	DUF1244 domain-containing protein	NA	NA	NA	NA	NA
WP_012127334.1|1465314_1466409_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_005431675.1|1466554_1467022_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012127335.1|1467077_1467938_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_012127336.1|1468105_1468540_+	YbaY family lipoprotein	NA	NA	NA	NA	NA
WP_005529865.1|1468578_1468881_-	DNA base-flipping protein	NA	NA	NA	NA	NA
WP_012127337.1|1469152_1469896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127338.1|1470330_1472328_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_012127339.1|1472710_1473337_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012127340.1|1473338_1474067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999494.1|1474316_1474628_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1474624_1474978_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_048814088.1|1475038_1476583_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012127343.1|1476595_1476730_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_011999494.1|1477664_1477976_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1477972_1478326_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_048814089.1|1478386_1479931_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	1.2e-71
WP_012127346.1|1480083_1480497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080939.1|1480510_1481215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514111.1|1481534_1481639_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011998813.1|1481659_1482859_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_012127348.1|1483008_1483458_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011999327.1|1485388_1486405_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1591448	1657788	3765351	tRNA,protease,transposase	Leptospira_phage(25.0%)	56	NA	NA
WP_011999187.1|1591448_1592774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127436.1|1592949_1593756_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_012127437.1|1593870_1594662_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_005426221.1|1594664_1596002_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_005532796.1|1595982_1596708_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_041853394.1|1596710_1601174_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_012127439.1|1601659_1602628_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_012127440.1|1602631_1604137_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_005426107.1|1604148_1604895_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_005426262.1|1605116_1606088_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_005426299.1|1606269_1607007_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_012127441.1|1607111_1607978_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_012127442.1|1608250_1610029_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.7	1.4e-10
WP_005426231.1|1610128_1610650_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	1.0e-09
WP_012127443.1|1610772_1612224_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	4.6e-12
WP_041853208.1|1612302_1612917_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005426235.1|1612938_1613943_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.0	1.5e-09
WP_012127445.1|1614404_1615991_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005426257.1|1616008_1617145_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270284.1|1617157_1617265_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012127446.1|1617257_1617560_+	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_005426200.1|1617731_1618151_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005426224.1|1618140_1618839_+	protein TolQ	NA	NA	NA	NA	NA
WP_012127448.1|1618842_1619286_+	ExbD/TolR family protein	NA	NA	NA	NA	NA
WP_012127449.1|1619299_1620328_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_080514114.1|1620338_1621691_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_012127451.1|1621722_1622244_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_021017845.1|1622259_1623015_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_012127454.1|1623311_1624373_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_012127455.1|1624500_1625544_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_005426232.1|1625543_1625960_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_021017844.1|1625968_1626538_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_012127457.1|1626543_1627710_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.8e-83
WP_041853393.1|1627777_1628347_-	YecA family protein	NA	NA	NA	NA	NA
WP_012127459.1|1628442_1630863_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	34.2	1.4e-53
WP_010646956.1|1631303_1631753_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_012127460.1|1632297_1632684_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	47.8	1.4e-05
WP_011999494.1|1632749_1633061_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1633057_1633411_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017843.1|1633471_1635016_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_021017842.1|1637535_1637712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127466.1|1637797_1638985_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_012127467.1|1639041_1639944_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_021017841.1|1639956_1641027_+	butyrate kinase	NA	NA	NA	NA	NA
WP_086028406.1|1641076_1641829_+	acetoacetate decarboxylase	NA	NA	NA	NA	NA
WP_012127470.1|1641873_1643835_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.0	1.3e-81
WP_012127471.1|1644589_1645990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127472.1|1646704_1647418_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012127473.1|1647592_1648354_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012127474.1|1648341_1648866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127475.1|1649299_1650184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080917.1|1650340_1652995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127477.1|1653097_1653694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|1653839_1655033_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_021017838.1|1655192_1656098_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021017837.1|1656243_1657788_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	1.0e-70
>prophage 10
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1665609	1725611	3765351	transposase,integrase	Enterobacteria_phage(30.0%)	50	1662857:1662871	1720109:1720123
1662857:1662871	attL	AGTGGCAGATAAAGA	NA	NA	NA	NA
WP_012127491.1|1665609_1667142_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
WP_012127492.1|1667201_1667366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127493.1|1667340_1667556_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	1.8e-10
WP_011999494.1|1667552_1667864_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127494.1|1667920_1668883_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127495.1|1669182_1670103_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	95.7	7.6e-170
WP_011998813.1|1670317_1671517_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_086028361.1|1672669_1673792_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012127498.1|1675300_1676194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127499.1|1676474_1677596_-|transposase	ISAs1-like element ISVha1 family transposase	transposase	NA	NA	NA	NA
WP_012127501.1|1678526_1679447_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
WP_012127502.1|1679765_1680887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080514117.1|1681171_1686046_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	26.8	8.0e-101
WP_012127504.1|1686042_1686531_+	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
WP_086028364.1|1686675_1687852_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	63.3	6.8e-115
WP_012127146.1|1688226_1689420_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_011999348.1|1689566_1690760_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012127507.1|1691258_1691831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127508.1|1691978_1692362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127511.1|1693421_1694435_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_012127512.1|1694437_1694776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017798.1|1694931_1696254_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127514.1|1696387_1697242_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012127515.1|1697444_1698224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127516.1|1698227_1701167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127517.1|1701159_1702572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127518.1|1702568_1703135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127519.1|1703279_1703579_-	T3SS regulon translocated regulator ExsE2	NA	NA	NA	NA	NA
WP_012127520.1|1703586_1704033_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_021017830.1|1704391_1704799_+	YscW family type III secretion system pilotin	NA	NA	NA	NA	NA
WP_012127524.1|1705396_1706257_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005426156.1|1706400_1707381_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_012127525.1|1707393_1707822_+	YscB family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012127526.1|1707821_1709693_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_012127527.1|1709698_1711000_+	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_005426287.1|1710986_1711193_+	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_005528964.1|1711209_1711458_+	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_012127528.1|1711461_1711818_+	YscG family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012127529.1|1711817_1712480_+	YopR family T3SS polymerization control protein	NA	NA	NA	NA	NA
WP_012127530.1|1712488_1712833_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_010646247.1|1712865_1713597_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_012127531.1|1713589_1714255_+	type III secretion system sorting platform protein VscK	NA	NA	NA	NA	NA
WP_012127532.1|1714233_1714869_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_005426189.1|1715095_1715491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127533.1|1715494_1718398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005426173.1|1718681_1719119_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012127534.1|1719122_1720283_+	VopS family T3SS effector adenosine monophosphate-protein transferase	NA	NA	NA	NA	NA
1720109:1720123	attR	AGTGGCAGATAAAGA	NA	NA	NA	NA
WP_080514118.1|1721826_1722822_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086028365.1|1722868_1724402_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012127538.1|1724567_1725611_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1748919	1818516	3765351	tRNA,transposase	uncultured_Caudovirales_phage(14.29%)	52	NA	NA
WP_011999187.1|1748919_1750245_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012127561.1|1750285_1751416_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	42.4	4.5e-23
WP_012127562.1|1751405_1755098_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_012127563.1|1755164_1756283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005426222.1|1756992_1757328_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_041853205.1|1757501_1757969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127566.1|1758159_1759797_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	6.3e-34
WP_012127568.1|1760152_1761289_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012127569.1|1761291_1764453_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005426166.1|1764748_1765201_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021017823.1|1765230_1765977_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012127571.1|1766185_1767433_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_021017822.1|1767566_1768958_+	YfcC family protein	NA	NA	NA	NA	NA
WP_012127573.1|1768979_1769681_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_012127574.1|1769777_1771922_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012127575.1|1772064_1773024_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012127576.1|1773007_1773991_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012127577.1|1773990_1774953_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	4.5e-08
WP_012127578.1|1774952_1775756_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	6.4e-16
WP_012127579.1|1775755_1776616_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_012127580.1|1776682_1777639_-	AEC family transporter	NA	NA	NA	NA	NA
WP_012126577.1|1777704_1778466_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	8.8e-15
WP_021017817.1|1778686_1778824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080916.1|1778793_1780224_+	transporter substrate-binding domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	38.2	8.8e-08
WP_012127584.1|1780366_1782547_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_012127585.1|1783344_1784367_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012126704.1|1785112_1786138_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012127586.1|1786452_1787451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853204.1|1787447_1788776_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	32.7	1.6e-27
WP_012127588.1|1789064_1790225_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	29.2	5.3e-19
WP_012127589.1|1790343_1792296_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_012127590.1|1792296_1793433_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_012127592.1|1793446_1794334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017813.1|1794740_1796285_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|1796345_1796699_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1796695_1797007_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127594.1|1797063_1799421_+	collagenase	NA	NA	NA	NA	NA
WP_012127595.1|1799515_1800916_-	guanine deaminase	NA	NA	NA	NA	NA
WP_010646166.1|1801310_1801568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853203.1|1801714_1802743_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012126704.1|1802848_1803874_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021017812.1|1804323_1805103_-|tRNA	tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE	tRNA	NA	NA	NA	NA
WP_012127598.1|1805229_1805994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127599.1|1806332_1807307_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_012127600.1|1807360_1808557_+	methyltransferase	NA	NA	NA	NA	NA
WP_012127601.1|1808650_1809775_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_005528862.1|1809931_1810426_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012127602.1|1810578_1813941_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	2.6e-87
WP_012127603.1|1814002_1814629_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_048814299.1|1814635_1815985_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.4	1.3e-85
WP_012127605.1|1816077_1817385_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	3.8e-90
WP_162471675.1|1817480_1818516_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
>prophage 12
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	1875809	2043000	3765351	tRNA,portal,tail,transposase,integrase,capsid,terminase,head,plate,lysis	Vibrio_phage(29.69%)	158	1940732:1940791	2040652:2041354
WP_086028361.1|1875809_1876932_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012127648.1|1878281_1879064_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.0e-13
WP_005425745.1|1879060_1880056_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005425771.1|1880055_1880943_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012127649.1|1880929_1881892_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005529312.1|1881891_1883511_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_005425749.1|1883793_1884804_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_005425704.1|1885037_1885709_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_005425720.1|1885723_1885957_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_005425740.1|1885949_1886339_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_012127651.1|1886495_1887527_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012127652.1|1887528_1888608_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012127653.1|1888604_1891715_+	efflux RND transporter permease subunit VmeI	NA	S5VL66	Leptospira_phage	20.0	2.2e-27
WP_012127654.1|1891784_1892375_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_012127656.1|1893020_1894064_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005429716.1|1894802_1895279_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021017801.1|1895674_1897246_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.7	4.8e-23
WP_012127658.1|1897473_1899357_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.8	9.2e-21
WP_012127661.1|1899521_1900241_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_005429722.1|1900249_1902139_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005429724.1|1902358_1903000_+	porin family protein	NA	NA	NA	NA	NA
WP_005429727.1|1903114_1904305_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005429731.1|1905068_1905368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005429733.1|1905568_1905799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127666.1|1905978_1907370_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010649555.1|1907468_1907690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127667.1|1907720_1908134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853376.1|1908261_1909662_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.6	5.1e-85
WP_012127669.1|1910552_1910723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005376896.1|1911219_1911582_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	38.6	4.1e-10
WP_012127670.1|1911751_1912537_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012127671.1|1913003_1913471_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012127672.1|1913577_1915293_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012127676.1|1916963_1918325_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_021017797.1|1918421_1919675_-	septum formation initiator	NA	NA	NA	NA	NA
WP_012127678.1|1920021_1920621_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_012127679.1|1920745_1921306_+	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012127682.1|1923166_1924537_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	41.1	1.6e-43
WP_041853198.1|1924830_1926348_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_005433708.1|1926577_1926763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127684.1|1926919_1928296_+	YcjX family protein	NA	NA	NA	NA	NA
WP_012127685.1|1928292_1929333_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_012127686.1|1929433_1930978_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_012127687.1|1931061_1931646_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_012127688.1|1931646_1932234_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_012127689.1|1932247_1932721_+	DUF2947 domain-containing protein	NA	NA	NA	NA	NA
WP_012127690.1|1932976_1933249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017796.1|1933445_1933796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127692.1|1934014_1935214_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.5	7.4e-101
WP_011999463.1|1935388_1936432_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011999494.1|1936653_1936965_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012126950.1|1936961_1937315_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_021017764.1|1937375_1938920_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012127694.1|1939278_1939722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127695.1|1940219_1940615_+	hypothetical protein	NA	NA	NA	NA	NA
1940732:1940791	attL	TTGTAAGCGCTCCATAAAACCCGCATTCTAATCGCCTAGCGCGAAGAATAAGATCAAGTC	NA	NA	NA	NA
WP_011999494.1|1940813_1941125_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127696.1|1941121_1941535_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	8.1e-15
WP_012127697.1|1941664_1943197_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	3.9e-110
WP_012127698.1|1943207_1943948_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_048814106.1|1944132_1945677_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	39.5	3.8e-25
WP_012127700.1|1945717_1945978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127701.1|1946437_1947307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127343.1|1947275_1947410_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_048814088.1|1947422_1948967_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|1949027_1949381_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1949377_1949689_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127702.1|1949740_1950013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853373.1|1950550_1951564_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_086028361.1|1951921_1953045_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012127704.1|1953255_1954491_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	41.4	3.8e-76
WP_010648742.1|1954490_1954721_-	excisionase family protein	NA	NA	NA	NA	NA
WP_012127705.1|1954908_1955121_-	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	43.3	1.4e-10
WP_012127706.1|1955173_1955992_-	DUF2303 family protein	NA	R9TRN9	Vibrio_phage	81.6	2.3e-125
WP_012127707.1|1956032_1956428_-	hypothetical protein	NA	R9TMP0	Vibrio_phage	89.3	1.9e-61
WP_012127709.1|1956743_1957409_-	LexA family transcriptional regulator	NA	A0A1V0E8B5	Vibrio_phage	59.6	1.4e-72
WP_012127710.1|1957518_1957785_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	50.7	3.4e-14
WP_012127711.1|1957774_1958227_+	hypothetical protein	NA	R9TRN6	Vibrio_phage	64.9	1.7e-42
WP_012127712.1|1958223_1958493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127714.1|1958649_1959171_+	hypothetical protein	NA	R9TNL7	Vibrio_phage	91.3	3.8e-94
WP_012127715.1|1959170_1960127_+	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	72.5	2.2e-124
WP_005376941.1|1960137_1960350_+	hypothetical protein	NA	A0A1V0E856	Vibrio_phage	51.8	3.6e-11
WP_021017787.1|1960343_1961039_+	phage antirepressor KilAC domain-containing protein	NA	R9TMN1	Vibrio_phage	68.0	3.0e-78
WP_012127717.1|1961035_1961347_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	89.1	3.6e-47
WP_012127718.1|1961339_1962311_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	43.9	6.1e-61
WP_021017786.1|1962736_1963501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127721.1|1966626_1967976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127722.1|1967984_1968812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017785.1|1969374_1969833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127724.1|1969947_1970712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127727.1|1971741_1972383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127728.1|1972687_1973356_+	hypothetical protein	NA	R9TRM8	Vibrio_phage	65.6	2.1e-81
WP_005376950.1|1973510_1973702_+	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	54.1	1.7e-12
WP_012127729.1|1973688_1974168_+	lysozyme	NA	A0A1U9GSH3	Vibrio_phage	58.7	3.8e-48
WP_012127730.1|1974149_1974632_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.8	2.1e-22
WP_012127731.1|1974746_1975349_+	hypothetical protein	NA	D4HTU0	Vibrio_phage	37.0	1.6e-19
WP_144080913.1|1975236_1977213_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	39.6	2.3e-123
WP_005424556.1|1977209_1977419_+	gpW family protein	NA	NA	NA	NA	NA
WP_012127733.1|1977418_1978975_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	56.0	7.0e-160
WP_012127734.1|1978967_1980320_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	42.6	1.9e-89
WP_012127735.1|1980333_1980675_+|head	head decoration protein	head	NA	NA	NA	NA
WP_012127736.1|1980713_1981751_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.8	1.9e-68
WP_012127737.1|1981816_1982308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017783.1|1982358_1982727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080912.1|1982710_1983367_+	hypothetical protein	NA	D4HTU8	Vibrio_phage	35.2	2.9e-22
WP_012127740.1|1983347_1983914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127741.1|1983879_1984518_+|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	52.6	2.8e-38
WP_012127742.1|1984517_1984868_+|plate	phage baseplate protein	plate	A2I2X7	Vibrio_virus	52.0	2.8e-24
WP_012127743.1|1984877_1985891_+|plate	baseplate J/gp47 family protein	plate	A0A1I9KG27	Aeromonas_phage	33.5	6.0e-43
WP_021017782.1|1985856_1986612_+|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_012127745.1|1986608_1987142_+	hypothetical protein	NA	K7RVY3	Vibrio_phage	47.1	4.4e-37
WP_012127746.1|1987154_1987883_+	hypothetical protein	NA	Q6R4W1	Vibrio_virus	25.7	5.9e-08
WP_012127747.1|1987885_1988119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127748.1|1988205_1988403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127749.1|1988406_1989570_+|tail	tail protein	tail	Q6R4W2	Vibrio_virus	55.6	6.1e-116
WP_137282510.1|1989593_1990076_+|tail	phage major tail tube protein	tail	B0ZSG9	Halomonas_phage	35.5	2.7e-17
WP_012127751.1|1990149_1990743_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012127752.1|1990861_1993855_+|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	44.9	1.5e-70
WP_012127753.1|1993851_1994253_+|tail	phage tail protein	tail	B0ZSH2	Halomonas_phage	40.6	1.4e-19
WP_012127754.1|1994249_1994471_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_012127755.1|1994461_1995475_+	hypothetical protein	NA	A2I2Y5	Vibrio_virus	50.4	5.3e-92
WP_012127756.1|1995701_1996658_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	41.8	4.9e-55
WP_012127757.1|1996895_1997726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999463.1|1998196_1999240_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080514125.1|1999332_1999449_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011999328.1|1999443_2000643_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_012127759.1|2001641_2002859_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	2.6e-101
WP_012127761.1|2003436_2004144_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021017781.1|2004246_2005719_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.6	1.9e-130
WP_048814111.1|2006385_2006772_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_011999494.1|2007208_2007520_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2007516_2007870_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127766.1|2009854_2010724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127767.1|2011143_2012337_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.7e-68
WP_012127769.1|2012715_2013744_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127771.1|2014195_2014549_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	1.6e-14
WP_021018248.1|2015847_2016891_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127773.1|2017402_2018641_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_012127774.1|2018618_2019257_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_041853197.1|2019564_2020401_-	DUF2797 domain-containing protein	NA	NA	NA	NA	NA
WP_012127776.1|2020739_2022086_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	4.4e-17
WP_012127777.1|2022264_2023635_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005533464.1|2023881_2024616_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005533465.1|2024782_2026471_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_012127778.1|2026707_2029062_+	ATP-dependent RNA helicase	NA	A0A2H4UU36	Bodo_saltans_virus	27.2	9.4e-31
WP_012127779.1|2029218_2029938_+	phospholipase A	NA	NA	NA	NA	NA
WP_012127780.1|2030173_2030551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127781.1|2030837_2032511_+	alkaline phosphatase D family protein	NA	A0A2K9KZV0	Tupanvirus	25.9	2.2e-05
WP_012127782.1|2032605_2033709_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_021017777.1|2034556_2034904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127784.1|2035334_2035673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017776.1|2035756_2036104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|2036297_2037832_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012127786.1|2038181_2038514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017774.1|2038530_2038908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017773.1|2038919_2040668_+	hypothetical protein	NA	S5WIG9	Leptospira_phage	31.0	8.2e-16
WP_011999494.1|2040733_2041045_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2041041_2041395_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
2040652:2041354	attR	TTGTAAGCGCTCCATAAAACCCGCATTCTAATCGCCTAGCGCGAAGAATAAGATCAAGTCTCCAACCATGAGGAGATTTGAAATGGGAAAACGACACACTAATCAAGAATGGCAAACGCTCATCGAGCAGTCTGAATCGAGTTCATTGTCAACGCTTGCATTTTGTAAGCTTAATGAACTCAATCCCTCGACGTTTTATGCTAAGCGCCAGCAACTCAAAAAAGCAGATGTCTCTCAAGGCTTTGTACGAGCAGAGGTCGTCGAAAAGACAACGAAATATCAAGCTCAAATAGCCACCGCTAACATGACACTTCTCATCAATGATGTGGAGTTGAGCATTCCTCAAGGCACGCCCGCTGCCTACCTGGCAGAACTCATTGGAGCCTTGTCATGAAACATATGCTCAGCGCACCAGAGATTTATCTGTATCGTGAGAGTGTCGATTTTAGAAAGTCCATCAATGGCCTCGCGGCGATTATCGAAAGTGACACCGATTTACCTCTAGGAAGCGGCGCACTGTTCCTGTTCACCAATAAACAGCGCGACAAAATCAAAGTGCTGTACTGGGATAAAACTGGCTTTGCGCTTTGGTATAAACGCCTTGAAAAAGCCAAGTATAAATGGCCTACAAAAGAGCGAAATGAAGTGTTTACCCTGACTCAATTCGAGCTTGATAGACTGCTTTCTGGCTTCACGATTATCG	NA	NA	NA	NA
WP_021017813.1|2041455_2043000_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
>prophage 13
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2081524	2152935	3765351	tRNA,transposase	Leptospira_phage(33.33%)	59	NA	NA
WP_021017772.1|2081524_2083069_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|2083129_2083483_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012127819.1|2084242_2084527_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_012127820.1|2084545_2084926_+	RidA family protein	NA	NA	NA	NA	NA
WP_012127823.1|2085316_2085631_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012127824.1|2086182_2086992_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012127825.1|2087679_2088663_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.5	1.3e-37
WP_012127826.1|2088681_2091102_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.5	3.9e-08
WP_021017813.1|2091502_2093047_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012127827.1|2093107_2093461_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	5.3e-15
WP_011999494.1|2093457_2093769_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127829.1|2094701_2096375_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	8.1e-21
WP_012127830.1|2096371_2097976_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.4e-14
WP_012127831.1|2098095_2099256_-	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	37.1	2.4e-64
WP_012127832.1|2099847_2102724_+	peptide synthetase	NA	NA	NA	NA	NA
WP_041853194.1|2102840_2104166_+	anguibactin biosynthesis histamine N-monooxygenase AngU	NA	NA	NA	NA	NA
WP_048814115.1|2104269_2105034_-	thioesterase	NA	NA	NA	NA	NA
WP_012127835.1|2105036_2108165_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	2.5e-47
WP_012127836.1|2108240_2110433_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012127837.1|2110571_2111555_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012127838.1|2111611_2112565_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005533415.1|2112561_2113506_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.2	1.5e-59
WP_012127839.1|2113916_2116052_+	peptide synthetase	NA	NA	NA	NA	NA
WP_041853358.1|2116230_2116974_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012127841.1|2117065_2117944_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005427969.1|2118470_2118767_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.1e-12
WP_021017766.1|2118903_2119704_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_005533410.1|2120041_2120692_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_012127843.1|2120778_2121954_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_012127844.1|2122101_2122989_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_009705896.1|2123253_2123931_-	LrgB family protein	NA	NA	NA	NA	NA
WP_012127845.1|2123932_2124307_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005528196.1|2124365_2125787_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_005528198.1|2125948_2126629_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_005528200.1|2126856_2128230_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_012127846.1|2128423_2129119_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_012127849.1|2130415_2131459_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021017765.1|2131458_2132265_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_012127851.1|2132261_2132810_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_005528211.1|2132806_2133421_+	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_012127852.1|2133503_2135303_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_012127853.1|2135541_2136570_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_012127854.1|2136672_2137668_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_012127855.1|2137654_2138422_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.5	2.8e-08
WP_012127656.1|2138435_2139479_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127856.1|2139556_2139973_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_041853192.1|2140055_2140631_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A088C537	Shewanella_sp._phage	43.0	2.4e-33
WP_012127858.1|2140739_2141321_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_012127859.1|2141403_2142615_-	MFS transporter	NA	NA	NA	NA	NA
WP_012127860.1|2142727_2143597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999494.1|2143926_2144238_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998799.1|2144234_2144588_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017764.1|2144648_2146193_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012127861.1|2146236_2146464_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_012127862.1|2146605_2147121_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012127863.1|2147107_2148274_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_012127867.1|2150177_2150579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127868.1|2150606_2151800_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	1.3e-68
WP_012127501.1|2152014_2152935_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
>prophage 14
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2156634	2185344	3765351	transposase	Vibrio_phage(33.33%)	22	NA	NA
WP_086028371.1|2156634_2157431_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012127872.1|2157456_2158305_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.3	1.7e-152
WP_012127874.1|2158446_2159361_+	bacteriorhodopsin	NA	NA	NA	NA	NA
WP_041853191.1|2159448_2160312_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.4	4.2e-05
WP_012127876.1|2160301_2161915_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_012127877.1|2161895_2162810_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_012127878.1|2162796_2163954_+	lycopene cyclase	NA	NA	NA	NA	NA
WP_012127879.1|2163950_2164820_+	Brp/Blh family beta-carotene 15,15'-dioxygenase	NA	NA	NA	NA	NA
WP_012127880.1|2164933_2165362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|2167542_2168736_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_162471672.1|2169588_2170623_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	63.2	1.1e-12
WP_012127885.1|2172109_2173216_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_021017757.1|2173657_2174701_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012127887.1|2174905_2175370_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005427851.1|2175758_2176832_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_012127888.1|2176824_2177955_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012127889.1|2177964_2179002_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012127890.1|2179022_2179691_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_012127891.1|2179889_2180552_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_012127146.1|2181116_2182310_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_009697431.1|2183097_2183436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127024.1|2183964_2185344_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.9	2.9e-48
>prophage 15
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2303680	2313104	3765351		Vibrio_phage(91.67%)	12	NA	NA
WP_012127984.1|2303680_2305411_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.5	3.3e-41
WP_012127985.1|2305580_2305949_-	hypothetical protein	NA	Q858Q3	Vibrio_phage	74.6	1.1e-44
WP_021017735.1|2306126_2306750_+	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	47.6	1.4e-37
WP_005531344.1|2306753_2306969_+	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	87.3	7.2e-31
WP_012127987.1|2306952_2308098_+	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	92.4	1.4e-213
WP_012127988.1|2308101_2308461_+	DUF1293 family protein	NA	Q783U4	Vibrio_phage	95.8	7.2e-60
WP_012127989.1|2308466_2308697_+	hypothetical protein	NA	Q783U3	Vibrio_phage	90.8	8.2e-33
WP_012127990.1|2308702_2308951_+	hypothetical protein	NA	Q783U2	Vibrio_phage	81.7	3.6e-26
WP_012127993.1|2309476_2310574_+	hypothetical protein	NA	Q783U1	Vibrio_phage	61.2	3.1e-85
WP_021017733.1|2310575_2310920_+	DUF2523 domain-containing protein	NA	Q783U0	Vibrio_phage	69.3	1.2e-40
WP_021017732.1|2310924_2312310_+	hypothetical protein	NA	Q783T9	Vibrio_phage	83.3	1.2e-232
WP_005531371.1|2312918_2313104_+	DUF3018 family protein	NA	A0A2I7RE17	Vibrio_phage	37.3	4.0e-06
>prophage 16
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2332616	2498778	3765351	tRNA,transposase	Leptospira_phage(24.24%)	119	NA	NA
WP_080514133.1|2332616_2333984_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.4	1.5e-44
WP_012128015.1|2334046_2335666_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	7.3e-59
WP_021017726.1|2336070_2340912_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_012128017.1|2341199_2342393_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	3.7e-68
WP_080514134.1|2342505_2342670_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_012128018.1|2342736_2345343_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_012128019.1|2345575_2346241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128020.1|2346449_2348444_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.4	1.0e-86
WP_048814132.1|2348461_2349088_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005532379.1|2349186_2349660_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012128022.1|2349752_2351549_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	1.2e-38
WP_021017723.1|2351597_2352821_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_012128024.1|2352813_2355468_+	MCE family protein	NA	NA	NA	NA	NA
WP_041853343.1|2355602_2357039_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005430978.1|2357386_2358220_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012128027.1|2358403_2359756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128028.1|2359778_2360270_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_005430973.1|2360665_2361718_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	45.9	1.5e-84
WP_005430971.1|2361750_2362233_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_012128029.1|2362343_2363264_-	siroheme synthase	NA	NA	NA	NA	NA
WP_041853185.1|2363724_2364753_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	44.1	2.6e-78
WP_005532389.1|2364833_2366039_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012128033.1|2366040_2367138_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005430960.1|2367161_2367911_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	4.6e-32
WP_005532392.1|2368265_2368928_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	50.0	6.0e-44
WP_012128034.1|2369281_2369611_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_005532394.1|2369658_2369931_-	acylphosphatase	NA	NA	NA	NA	NA
WP_048814134.1|2370021_2371425_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.7	2.9e-19
WP_010647923.1|2371644_2372838_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012128036.1|2372905_2379289_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041853184.1|2379691_2381008_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_010650626.1|2381009_2381636_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011999494.1|2381915_2382227_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2382223_2382577_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_048814135.1|2382637_2384182_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	6.1e-71
WP_012128040.1|2384171_2386616_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_012128041.1|2387012_2388323_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_012128042.1|2388326_2388941_+	OmpA family protein	NA	NA	NA	NA	NA
WP_005426565.1|2389053_2389407_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_012128044.1|2389596_2391564_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.1	4.3e-13
WP_005426624.1|2391520_2392219_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	63.6	4.7e-79
WP_012128045.1|2392233_2392884_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1B0Z0A9	Vibrio_phage	28.9	4.1e-13
WP_012128046.1|2393048_2393855_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005530968.1|2393904_2394414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128048.1|2394427_2396539_-	LruC domain-containing protein	NA	NA	NA	NA	NA
WP_012128049.1|2396875_2398318_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012128052.1|2399182_2399665_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012128053.1|2399824_2401705_-	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.0	8.4e-67
WP_012128054.1|2401766_2402954_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_012128055.1|2402977_2405587_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012128056.1|2405719_2406862_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_012128057.1|2406992_2407889_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_010448100.1|2407901_2408621_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048814136.1|2411847_2413392_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	6.1e-71
WP_011998799.1|2413452_2413806_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|2413802_2414114_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012128063.1|2415086_2418233_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021017713.1|2418547_2418853_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|2418870_2420064_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011998799.1|2420195_2420549_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012128066.1|2420608_2422141_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.0	2.7e-71
WP_012128067.1|2422418_2422841_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_086028361.1|2422855_2423979_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_005426568.1|2424261_2425239_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_012128068.1|2425459_2425954_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_005451899.1|2425974_2427501_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_012128069.1|2427655_2428426_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012128070.1|2428591_2430328_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	3.0e-18
WP_012128071.1|2430418_2431390_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_012128072.1|2431615_2433136_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012128073.1|2433384_2435148_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_021017710.1|2436690_2438211_-	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_041853341.1|2438705_2440016_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_005531010.1|2440666_2442115_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	32.0	4.7e-33
WP_012128079.1|2442155_2442872_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_041853183.1|2442868_2444371_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.7	1.3e-89
WP_012128081.1|2445016_2445703_-	response regulator	NA	NA	NA	NA	NA
WP_041853340.1|2445699_2447319_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012128083.1|2448174_2448402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128084.1|2448554_2449946_+	TolC family protein	NA	NA	NA	NA	NA
WP_005433845.1|2449949_2450930_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_012128085.1|2450948_2452136_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012128086.1|2452132_2453284_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086028378.1|2453416_2454549_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.7e-26
WP_011999494.1|2454616_2454928_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2454924_2455278_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017708.1|2455338_2456883_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	1.0e-70
WP_012128089.1|2457214_2457544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128091.1|2458450_2458708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999114.1|2459088_2460009_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_012128092.1|2460212_2461661_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_021017707.1|2461841_2463434_-	S8 family peptidase	NA	A0A2K9L1P3	Tupanvirus	32.8	4.4e-32
WP_012128095.1|2464831_2466256_-	aspartate kinase	NA	NA	NA	NA	NA
WP_012128096.1|2466344_2466731_-	ectoine synthase	NA	NA	NA	NA	NA
WP_012128097.1|2466744_2468010_-	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_041853181.1|2468043_2468577_-	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_005433884.1|2468920_2470585_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.1	3.2e-25
WP_012128100.1|2470821_2471571_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_012128101.1|2471567_2473448_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_012128103.1|2474541_2475915_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	31.3	1.1e-34
WP_012128104.1|2476249_2478151_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_012128105.1|2478147_2479230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128107.1|2479480_2480509_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012128108.1|2480748_2482686_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_021017704.1|2482799_2483162_+	glyoxalase	NA	NA	NA	NA	NA
WP_021017703.1|2483288_2483672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005434001.1|2483783_2484518_-	chromosome segregation ATPase	NA	NA	NA	NA	NA
WP_005433933.1|2485455_2486832_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_012128111.1|2487274_2488027_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005433926.1|2488023_2488485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128112.1|2488988_2490461_+	aerolysin family beta-barrel pore-forming toxin	NA	NA	NA	NA	NA
WP_012128113.1|2490644_2491313_+	ParA family protein	NA	NA	NA	NA	NA
WP_012128114.1|2491597_2493067_+	aerolysin family beta-barrel pore-forming toxin	NA	NA	NA	NA	NA
WP_012128115.1|2493149_2493716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128116.1|2493715_2494351_-	LysE family translocator	NA	NA	NA	NA	NA
WP_012128117.1|2494767_2496240_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_012128118.1|2496289_2496862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128119.1|2496919_2497441_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011999348.1|2497584_2498778_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
>prophage 17
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2534272	2598745	3765351	transposase	Enterobacteria_phage(18.18%)	55	NA	NA
WP_012128146.1|2534272_2535031_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	40.4	8.4e-42
WP_012128147.1|2535061_2535463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005535753.1|2535599_2535950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128148.1|2535972_2537919_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_012128149.1|2538062_2538503_+	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_005433656.1|2538704_2539235_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_041853331.1|2539317_2540859_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_005442696.1|2541145_2541778_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_012128151.1|2541777_2543742_+	Hsp70 family protein	NA	A0A1V0SG59	Hokovirus	25.8	3.3e-13
WP_012128152.1|2543797_2546623_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	28.4	1.5e-11
WP_005377692.1|2546708_2546903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005533850.1|2546989_2547676_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_012128153.1|2547932_2548424_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_012128154.1|2548684_2550424_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.6	9.6e-49
WP_012128155.1|2550426_2552205_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	23.0	9.2e-23
WP_005433911.1|2552470_2553019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005433984.1|2553202_2553418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128156.1|2553517_2554642_-	c-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_021017694.1|2554900_2556106_-	amino acid permease	NA	NA	NA	NA	NA
WP_012128159.1|2556279_2557473_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012128160.1|2557653_2558286_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005433965.1|2559931_2560534_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_012128162.1|2560702_2561470_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.9	5.4e-36
WP_005434030.1|2561800_2562757_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041853178.1|2562953_2563835_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_012128166.1|2563856_2565401_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_012128168.1|2565896_2567108_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_021017691.1|2567568_2569275_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041853329.1|2569381_2569855_-	response regulator	NA	NA	NA	NA	NA
WP_012128172.1|2570129_2570609_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041853328.1|2570605_2571082_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012128174.1|2571175_2572204_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021017690.1|2572308_2572824_+	YkgB family protein	NA	NA	NA	NA	NA
WP_011999348.1|2572776_2573970_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012128176.1|2574210_2574930_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012128177.1|2574931_2575936_-	cupin	NA	NA	NA	NA	NA
WP_012128178.1|2576018_2576753_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005374756.1|2576754_2578047_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_012128179.1|2578336_2579086_+	aldolase	NA	NA	NA	NA	NA
WP_012128180.1|2579236_2580193_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012128183.1|2581513_2582077_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_012128184.1|2582073_2583354_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_012128186.1|2583885_2584860_+	ester cyclase	NA	NA	NA	NA	NA
WP_012128187.1|2584909_2585905_+	ester cyclase	NA	NA	NA	NA	NA
WP_012128188.1|2585897_2587643_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	23.3	5.7e-17
WP_012127098.1|2587759_2589082_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128189.1|2589151_2589520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853176.1|2590504_2591167_-	peptidase E	NA	NA	NA	NA	NA
WP_144080902.1|2591181_2591343_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_012128194.1|2591633_2591864_+	PAS factor family protein	NA	NA	NA	NA	NA
WP_011999494.1|2592108_2592420_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2592416_2592770_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_012128195.1|2592829_2594362_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.0	4.6e-71
WP_021017687.1|2596550_2597342_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012128200.1|2597545_2598745_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.1	3.3e-101
>prophage 18
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2826594	2916023	3765351	protease,transposase	Enterobacteria_phage(23.53%)	71	NA	NA
WP_086028385.1|2826594_2828128_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012126704.1|2829405_2830431_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041853311.1|2830844_2831873_-	methionine synthase	NA	NA	NA	NA	NA
WP_012128378.1|2831903_2832878_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_012128380.1|2833352_2833613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128382.1|2833983_2838213_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012128383.1|2838212_2838968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018048.1|2840192_2840876_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012128385.1|2841031_2842231_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_011999327.1|2842341_2843358_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086028361.1|2843483_2844607_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012128387.1|2845180_2846374_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	37.6	3.5e-66
WP_162600500.1|2847691_2847928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028371.1|2848285_2849082_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021018044.1|2850865_2851147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128395.1|2851133_2851340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128396.1|2851423_2851855_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_012128398.1|2852355_2852970_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	36.7	1.9e-20
WP_012128399.1|2853034_2853463_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_012128402.1|2854735_2855455_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.0e-40
WP_012128403.1|2855447_2856731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012128404.1|2856733_2857978_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012128405.1|2857974_2859246_-	TolC family protein	NA	NA	NA	NA	NA
WP_012128406.1|2859238_2860375_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012128408.1|2860751_2861276_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086028387.1|2861320_2862091_-	phospholipase A	NA	NA	NA	NA	NA
WP_012127146.1|2862218_2863412_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012128411.1|2863957_2864677_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021018038.1|2864738_2865368_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012128413.1|2865473_2865986_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012128414.1|2865982_2868094_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_048814324.1|2868156_2868465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128416.1|2868694_2869600_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012128418.1|2871104_2872751_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_012128419.1|2872750_2873320_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_012128420.1|2873426_2873909_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_012128421.1|2874057_2874297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128422.1|2874422_2876270_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010645640.1|2876693_2877395_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012128423.1|2877478_2878654_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_005431104.1|2878672_2878966_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_005431133.1|2879106_2879391_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	36.7	3.2e-10
WP_005533588.1|2879604_2881275_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005533590.1|2881385_2882066_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_012128425.1|2882276_2883338_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	34.8	3.3e-20
WP_012128427.1|2883616_2884363_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_012128428.1|2884494_2885187_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_012128429.1|2885191_2886595_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_012128430.1|2886622_2889697_+	error-prone DNA polymerase	NA	A0A0K1Y9G6	Streptomyces_phage	28.3	9.2e-79
WP_012128431.1|2889796_2890738_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.2	2.7e-29
WP_041853309.1|2890967_2892185_-	ROK family protein	NA	NA	NA	NA	NA
WP_011999494.1|2892436_2892748_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2892744_2893098_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021018259.1|2893158_2894703_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.3e-70
WP_038863406.1|2894892_2896335_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_012128435.1|2896429_2896960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514143.1|2896922_2897600_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012127501.1|2897696_2898617_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	3.6e-172
WP_012128437.1|2898699_2898912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128438.1|2898998_2900648_-	carboxylesterase family protein	NA	M1PNU1	Moumouvirus	28.2	2.2e-18
WP_012128439.1|2900733_2903319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|2903873_2905407_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012128441.1|2906363_2907098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028361.1|2908704_2909828_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_021017813.1|2910892_2912437_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|2912497_2912851_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|2912847_2913159_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012128444.1|2913210_2914356_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_021018032.1|2914374_2914467_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_021018031.1|2914617_2915202_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_086028389.1|2915227_2916023_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	2933980	3061675	3765351	tRNA,transposase,integrase	Leptospira_phage(21.43%)	104	2980605:2980620	3008266:3008345
WP_012126704.1|2933980_2935006_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041853308.1|2935255_2936200_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_012128463.1|2936836_2939944_+	ribonuclease E	NA	NA	NA	NA	NA
WP_005436634.1|2940018_2941398_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.9	3.8e-48
WP_010645684.1|2941784_2943344_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.9	5.9e-90
WP_012128464.1|2943404_2943854_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012128465.1|2943971_2944577_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012128466.1|2944700_2946788_-	AsmA family protein	NA	NA	NA	NA	NA
WP_005433235.1|2946977_2947619_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	4.6e-33
WP_041853307.1|2947800_2948877_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_021018027.1|2949034_2951095_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	30.5	7.6e-61
WP_012128470.1|2951308_2952115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005531443.1|2952199_2953039_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_012128471.1|2953678_2955265_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_012128472.1|2955350_2955887_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_012128473.1|2955963_2956572_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_012128474.1|2957008_2957968_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_012128475.1|2958056_2959517_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005531430.1|2960463_2961258_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_021018026.1|2961254_2962190_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041853306.1|2962245_2963211_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012128481.1|2963520_2963973_-	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_012128482.1|2964319_2965516_+	acetate kinase	NA	NA	NA	NA	NA
WP_005433245.1|2965654_2967820_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012128484.1|2967940_2968885_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_041853305.1|2969095_2970088_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.5	5.3e-20
WP_010449362.1|2970084_2971056_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.1e-14
WP_005531413.1|2971086_2971989_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_012128487.1|2972004_2972925_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_041853304.1|2973031_2974666_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012128489.1|2975227_2975683_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_012128490.1|2975684_2975942_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_005433216.1|2975941_2976418_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_005433210.1|2976444_2976957_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_005531402.1|2977056_2978046_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_012128491.1|2978343_2979249_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	31.3	1.2e-26
WP_021018019.1|2979267_2980812_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
2980605:2980620	attL	CACCTTGAGATTCATC	NA	NA	NA	NA
WP_011998779.1|2980872_2981226_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
2980605:2980620	attL	CACCTTGAGATTCATC	NA	NA	NA	NA
WP_012128493.1|2981727_2982072_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_012128494.1|2982068_2983472_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	7.3e-07
WP_005531398.1|2983814_2985845_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_012128495.1|2986851_2989149_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.1	7.4e-158
WP_012128496.1|2989461_2990040_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_012128497.1|2990043_2990637_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_012128498.1|2990645_2993384_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_005425207.1|2993383_2994430_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_012128500.1|2994437_2995076_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_012128501.1|2995068_2995761_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_012128502.1|2995840_2996494_+	endonuclease III	NA	NA	NA	NA	NA
WP_012128503.1|2996648_2997209_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012128504.1|2997161_2997491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048814159.1|2997494_2998295_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	37.1	7.8e-46
WP_012128506.1|2998257_2999565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041853317.1|2999612_3000923_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012128508.1|3001717_3002161_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012128510.1|3002475_3004020_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	2.7e-71
WP_012128511.1|3004079_3004322_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.2	3.5e-10
WP_021018023.1|3004452_3004743_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|3006956_3008150_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_021018022.1|3008788_3010003_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.7e-20
3008266:3008345	attR	GCGACAGACCCTCTTAATACAGTGCTTTACCTTAGTTTTGGTATTTTTCATCCCTCGACCAAGCCCGGTCAAGGTTAATG	NA	NA	NA	NA
WP_012128517.1|3010748_3012221_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
3008266:3008345	attR	GCGACAGACCCTCTTAATACAGTGCTTTACCTTAGTTTTGGTATTTTTCATCCCTCGACCAAGCCCGGTCAAGGTTAATG	NA	NA	NA	NA
WP_021018021.1|3012805_3013222_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_005536418.1|3013359_3013794_+	DUF2753 domain-containing protein	NA	NA	NA	NA	NA
WP_012128519.1|3013915_3014797_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005439693.1|3015103_3015748_+	ribonuclease T	NA	L0N6K9	Acaryochloris_phage	24.7	8.3e-06
WP_041853303.1|3015776_3017102_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_041853302.1|3017191_3017821_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005430724.1|3018829_3019012_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_041853301.1|3019408_3020011_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_012128526.1|3020025_3020343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128527.1|3020345_3020717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128529.1|3021325_3022195_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.1	3.0e-160
WP_021018019.1|3022213_3023758_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_012126950.1|3023818_3024172_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.6e-14
WP_011999494.1|3024168_3024480_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012128530.1|3024774_3026337_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.7	1.5e-21
WP_041853483.1|3026561_3026768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128532.1|3026837_3027674_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012128533.1|3027775_3028669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128534.1|3028795_3029659_-	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	30.8	4.3e-26
WP_012128536.1|3030292_3031213_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.1	2.3e-171
WP_009707292.1|3031430_3031766_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_005536241.1|3032009_3032594_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	43.7	4.2e-41
WP_012128538.1|3032750_3033254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128539.1|3033388_3034132_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041853639.1|3034219_3035530_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012128541.1|3036168_3038871_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005433169.1|3039520_3040159_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_012128542.1|3040221_3041070_+	ion transporter	NA	NA	NA	NA	NA
WP_010644047.1|3041409_3042540_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005439709.1|3042977_3044414_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_041853300.1|3044515_3045679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514144.1|3045790_3047071_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_011999187.1|3047245_3048571_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005432897.1|3048688_3049687_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	58.3	1.1e-105
WP_005432983.1|3049772_3050000_+	YejL family protein	NA	NA	NA	NA	NA
WP_012128546.1|3050022_3051831_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_048814332.1|3052382_3053693_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012127098.1|3054284_3055607_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012128548.1|3055734_3056730_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012128549.1|3056729_3057905_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_012128550.1|3058408_3058708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012128551.1|3058676_3059600_-	histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	27.8	1.4e-14
WP_012128553.1|3060577_3061675_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	38.8	4.6e-65
>prophage 20
NC_009783	Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence	3765351	3557434	3576151	3765351	tRNA,transposase	uncultured_Mediterranean_phage(18.18%)	16	NA	NA
WP_012128902.1|3557434_3560032_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.5	1.2e-76
WP_012128903.1|3560174_3560642_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005425359.1|3560848_3561892_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	1.1e-111
WP_012128905.1|3562092_3562575_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.5	2.4e-26
WP_012128906.1|3562660_3565222_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	3.4e-34
WP_041853460.1|3565287_3566610_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005425361.1|3566746_3567733_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
WP_012128908.1|3567813_3568737_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	36.4	2.4e-06
WP_012128909.1|3568751_3569378_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	1.8e-37
WP_012128910.1|3569377_3570154_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	5.4e-68
WP_012128911.1|3570153_3571197_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005425365.1|3571242_3571719_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_041853277.1|3571733_3572444_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	23.1	1.4e-06
WP_005452106.1|3572445_3572727_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005425372.1|3573130_3574432_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	3.5e-136
WP_005531665.1|3574510_3576151_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	3.6e-154
>prophage 1
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	4287	65454	2204018	transposase,integrase	Escherichia_phage(36.36%)	51	29886:29900	66202:66216
WP_011999046.1|4287_5217_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.0	2.4e-70
WP_086028385.1|6765_8300_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157722659.1|8492_8963_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_021018346.1|10172_10718_-	cytochrome b	NA	NA	NA	NA	NA
WP_011999056.1|10869_12333_-	N-acetylglucosamine-binding protein GbpA	NA	NA	NA	NA	NA
WP_011999057.1|12544_13465_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	94.8	1.1e-168
WP_144080964.1|13567_13783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999060.1|13883_14366_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999061.1|14486_15086_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011999064.1|16228_17314_-	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.0	4.9e-11
WP_005533925.1|17580_18276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018345.1|18496_19261_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	49.0	1.4e-57
WP_005429064.1|19537_20446_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	68.7	3.0e-102
WP_011999066.1|20471_21728_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	56.7	1.5e-131
WP_041853694.1|21754_22387_+	aldolase	NA	A0A077SK32	Escherichia_phage	61.7	9.7e-68
WP_011999068.1|22386_23163_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_011999069.1|23276_24734_+	gluconate permease	NA	NA	NA	NA	NA
WP_011999070.1|24842_25262_-	VOC family protein	NA	NA	NA	NA	NA
WP_011999076.1|27944_29513_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.4	3.3e-40
WP_005374632.1|29685_30243_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
29886:29900	attL	TTGCACGGTCTGCAA	NA	NA	NA	NA
WP_021018343.1|30548_31007_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005374640.1|31144_31567_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_005383516.1|31831_32074_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011999078.1|32087_32423_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011999079.1|32476_33574_-	YdcF family protein	NA	NA	NA	NA	NA
WP_004746427.1|33916_34183_-	DUF2999 family protein	NA	NA	NA	NA	NA
WP_080514187.1|34486_35839_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_011999081.1|35933_37043_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011999082.1|37042_39553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011999083.1|39539_40274_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	3.2e-22
WP_021018342.1|40582_41146_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_005374689.1|41249_41495_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_011999088.1|42118_42787_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011999089.1|42837_43140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018341.1|43384_43771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999092.1|43813_45805_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_011999093.1|45988_46927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999095.1|47161_49048_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.0	3.4e-15
WP_011999096.1|49366_52117_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011999097.1|52180_52507_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_011999098.1|52713_53142_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_021018339.1|53669_54470_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_021018338.1|54860_55595_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086028444.1|55981_56449_+	fimbrial protein	NA	NA	NA	NA	NA
WP_011999105.1|56517_58980_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_041853571.1|58993_59749_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011999107.1|59748_60786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999108.1|60798_61791_+	OmpA family protein	NA	NA	NA	NA	NA
WP_041853385.1|62400_63711_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_011999112.1|63795_64182_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_011999114.1|64533_65454_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
66202:66216	attR	TTGCAGACCGTGCAA	NA	NA	NA	NA
>prophage 2
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	236085	321887	2204018	integrase,portal,transposase,protease,terminase,tail,head,plate,capsid	Vibrio_phage(65.85%)	88	249509:249524	272527:272542
WP_011999262.1|236085_237087_-|protease	trypsin-like serine protease	protease	V5LS29	Emiliania_huxleyi_virus	28.8	6.6e-18
WP_021018323.1|237238_238141_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999264.1|238283_239207_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011999265.1|239315_239756_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_048814362.1|239843_240596_+	phosphatase	NA	NA	NA	NA	NA
WP_041853688.1|240696_241086_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_080514159.1|241263_241623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999269.1|241778_243218_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005432290.1|243684_244614_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999270.1|244691_245165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999271.1|245452_246136_+	spondin domain-containing protein	NA	NA	NA	NA	NA
WP_011999272.1|246145_246841_+	spondin domain-containing protein	NA	NA	NA	NA	NA
WP_041853563.1|246983_247715_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011999274.1|247788_249162_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
249509:249524	attL	ATTTGTGATTTATATT	NA	NA	NA	NA
WP_021018318.1|250016_251417_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011999278.1|251541_252873_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011999279.1|252922_253855_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011999280.1|253851_256179_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005432273.1|256391_257585_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.9	8.6e-41
WP_038891494.1|257788_258820_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	88.5	6.5e-21
WP_011999282.1|258931_259969_-|integrase	tyrosine-type recombinase/integrase	integrase	R9TMQ4	Vibrio_phage	63.3	2.8e-128
WP_011999285.1|260785_261775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999286.1|261764_262256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999287.1|262256_264140_+	exonuclease	NA	NA	NA	NA	NA
WP_011999288.1|264365_266342_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011999289.1|266341_266968_-	phage repressor protein CI	NA	A0A2I7RNF9	Vibrio_phage	42.9	1.9e-39
WP_005530092.1|267064_267277_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	54.3	1.3e-13
WP_011999291.1|267390_267930_+	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	55.3	3.5e-50
WP_010645271.1|267958_268159_+	hypothetical protein	NA	A0A2I7RNH0	Vibrio_phage	41.3	2.6e-06
WP_011999292.1|268158_268386_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	49.3	9.9e-15
WP_011999293.1|268382_268619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999294.1|268624_270511_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	38.4	1.5e-63
WP_011999295.1|270561_270825_+	hypothetical protein	NA	Q8HA64	Vibrio_phage	56.9	2.2e-13
WP_011999296.1|270819_271071_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	75.9	1.2e-29
WP_011999297.1|271170_271602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999298.1|272075_272408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999300.1|272929_273277_-	hypothetical protein	NA	NA	NA	NA	NA
272527:272542	attR	ATTTGTGATTTATATT	NA	NA	NA	NA
WP_144080963.1|273328_273556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005530066.1|274154_275162_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	61.8	1.2e-115
WP_011999302.1|275166_276948_-|terminase	terminase	terminase	A0A1D9C9R1	Salinivibrio_phage	80.7	3.0e-263
WP_011999303.1|277122_277998_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2I7RNH1	Vibrio_phage	60.1	6.5e-78
WP_011999304.1|277998_279009_+|capsid	phage major capsid protein, P2 family	capsid	A0A1D9C9Q5	Salinivibrio_phage	65.0	4.3e-118
WP_011999305.1|279012_279729_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	58.0	1.3e-68
WP_021018311.1|279847_280267_+|head	head completion/stabilization protein	head	A0A2I7RNH7	Vibrio_phage	70.5	2.1e-50
WP_011999307.1|280263_280755_+|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	91.4	4.9e-83
WP_011999308.1|280738_281395_+	virion morphogenesis protein	NA	A0A2I7RNI6	Vibrio_phage	88.5	7.2e-106
WP_011999309.1|281410_282532_+	DUF2586 family protein	NA	A0A2I7RNI8	Vibrio_phage	82.7	1.5e-180
WP_011999310.1|282535_282991_+	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	92.7	3.7e-77
WP_011999311.1|283003_283222_+	TraR/DksA C4-type zinc finger protein	NA	A0A2I7RNJ6	Vibrio_phage	72.1	2.6e-20
WP_011999312.1|283218_283731_+	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	39.5	8.0e-20
WP_011999313.1|283727_283958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005530042.1|283960_284197_+	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	42.7	1.0e-09
WP_005530039.1|284193_284457_+|tail	putative phage tail assembly chaperone	tail	A0A2I7RNJ9	Vibrio_phage	78.3	1.7e-29
WP_011999314.1|284667_287223_+|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	53.5	6.2e-230
WP_011999315.1|287222_287555_+	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	75.7	1.1e-38
WP_011999316.1|287547_288735_+|plate	baseplate J/gp47 family protein	plate	A0A2I7RNJ7	Vibrio_phage	57.8	4.1e-136
WP_011999317.1|288754_289255_+	hypothetical protein	NA	A0A2I7RNJ4	Vibrio_phage	48.9	3.7e-38
WP_011999318.1|289258_290065_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	44.6	1.6e-27
WP_011999319.1|290057_290813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999320.1|290815_291046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999321.1|291055_291592_+	hypothetical protein	NA	A0A2I7RNK5	Vibrio_phage	81.4	1.3e-73
WP_011999322.1|291605_292295_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	80.7	1.1e-112
WP_011999323.1|292285_292984_+	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	92.2	3.9e-126
WP_011999324.1|292983_293181_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	85.9	1.6e-21
WP_048814469.1|293612_293792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999327.1|294140_295157_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011999328.1|295267_296467_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_005537019.1|296622_297117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005530007.1|298523_298658_+	hypothetical protein	NA	R9TPW0	Vibrio_phage	86.4	5.3e-16
WP_021018308.1|299058_299496_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_011999336.1|299522_299999_+	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_011999494.1|300977_301289_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999338.1|301285_301639_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.7	1.8e-15
WP_011999339.1|301698_303231_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.6e-71
WP_011999341.1|303670_305314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018306.1|305313_307431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999494.1|307606_307918_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|307914_308268_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021018384.1|309566_310610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999345.1|311089_312136_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_021018303.1|312173_313217_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999347.1|313373_314402_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999348.1|314709_315903_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011999349.1|315980_317195_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_021017672.1|317379_318423_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086028389.1|318647_319444_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_038891499.1|319783_320503_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_011999352.1|320564_321887_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	648821	720118	2204018	transposase	Enterobacteria_phage(22.22%)	54	NA	NA
WP_012129097.1|648821_650015_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129100.1|650559_650985_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129101.1|651290_651485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005433595.1|651981_652230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129102.1|652492_653131_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_012129104.1|653306_653570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005433589.1|653633_654620_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_012127098.1|654679_656002_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129105.1|656219_657839_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.5	3.0e-20
WP_012129106.1|658004_659297_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.1	4.0e-52
WP_021018263.1|662636_663476_-	arginase	NA	NA	NA	NA	NA
WP_005442559.1|663482_664217_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129110.1|664700_666170_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012129113.1|667539_668625_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_012129114.1|668669_671096_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012129116.1|671476_673009_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
WP_012127165.1|673068_673422_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.7	1.8e-15
WP_011999494.1|673418_673730_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010643691.1|674964_675645_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_041853317.1|676245_677556_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012129119.1|677693_679850_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010643707.1|679846_680458_-	cbb3-type cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_012129120.1|680459_681869_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_010643711.1|681884_682274_-	cytochrome c	NA	NA	NA	NA	NA
WP_012129122.1|683247_684126_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012129125.1|684864_685344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010643718.1|686461_687079_+	porin family protein	NA	NA	NA	NA	NA
WP_086028365.1|687170_688704_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012129127.1|688818_689715_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.2	5.3e-43
WP_012129128.1|689711_690557_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012129129.1|690590_692195_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	63.9	2.1e-18
WP_012129130.1|692216_693386_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_012129131.1|693498_693882_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012129132.1|694183_695395_+	thiolase family protein	NA	NA	NA	NA	NA
WP_012129133.1|695431_696925_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012129134.1|696942_698097_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012129135.1|698165_698954_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_012129136.1|698962_700087_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012129137.1|700098_701004_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_012129138.1|701186_701945_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005431534.1|702528_703410_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005532284.1|703415_705452_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012129142.1|705441_706041_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_012129143.1|706040_706352_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_005532282.1|706360_707233_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_041853551.1|707497_708592_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_012129147.1|708947_709844_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129148.1|709999_710398_+	RidA family protein	NA	NA	NA	NA	NA
WP_012129149.1|710491_711952_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012129150.1|712019_713009_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_012127146.1|714504_715698_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012129154.1|716212_717946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129155.1|717945_718677_+	DUF3726 domain-containing protein	NA	NA	NA	NA	NA
WP_012126481.1|718738_720118_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
>prophage 4
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	731387	774714	2204018	transposase	Leptospira_phage(20.0%)	36	NA	NA
WP_021018259.1|731387_732932_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.3e-70
WP_012129164.1|733160_733805_-	DUF799 family lipoprotein	NA	NA	NA	NA	NA
WP_012129165.1|733804_734176_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_012129166.1|734172_734490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129167.1|734489_735458_-	curli production assembly protein CsgG	NA	NA	NA	NA	NA
WP_012129169.1|735882_736626_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	33.3	1.4e-25
WP_012129170.1|736715_737459_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129171.1|737460_738150_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_005431471.1|738146_738815_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_012129172.1|738954_739527_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_012129173.1|739536_740367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129174.1|740485_741133_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012129179.1|743708_746723_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	54.9	3.4e-195
WP_012129180.1|746818_747790_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_021018248.1|749030_750074_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129184.1|750111_751632_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041853550.1|751690_753352_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_012129187.1|753631_754381_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_012129188.1|754392_755358_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_012126704.1|755655_756681_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012129191.1|757308_758451_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_012129192.1|758447_759431_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_012129193.1|759423_760518_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005431478.1|761112_761433_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_005431501.1|761667_762294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129195.1|762381_763734_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012126704.1|764123_765149_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005431498.1|765344_765821_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_012129196.1|765913_766375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129198.1|767038_768232_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_021018257.1|769232_769529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129202.1|769646_769982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129203.1|770104_771286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853662.1|771375_772044_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	4.0e-27
WP_012129205.1|772015_773257_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011999187.1|773388_774714_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	805447	871961	2204018	transposase	Enterobacteria_phage(38.46%)	41	NA	NA
WP_021017672.1|805447_806491_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999348.1|806618_807812_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129235.1|808282_809326_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129236.1|809691_812580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129239.1|813327_813900_-	YceI family protein	NA	NA	NA	NA	NA
WP_012129240.1|814209_814824_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012129243.1|817715_819014_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011999348.1|822726_823920_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129245.1|823969_824389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129246.1|824390_825071_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_086028426.1|826021_827144_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012129250.1|827898_828885_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	31.0	1.1e-17
WP_157722661.1|829176_838578_+	tandem large repeat	NA	NA	NA	NA	NA
WP_021017764.1|838783_840328_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|840388_840742_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|840738_841050_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_048814473.1|841083_842406_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_021018250.1|842475_843375_-	DMT family transporter	NA	NA	NA	NA	NA
WP_012129255.1|843525_843978_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012129256.1|843991_844546_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129257.1|844549_844960_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129258.1|845088_846501_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005426938.1|846721_847174_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_005447071.1|847175_847646_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_012129259.1|847701_849549_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	40.5	4.0e-61
WP_012129260.1|849802_850078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129261.1|850214_851315_-	alkene reductase	NA	NA	NA	NA	NA
WP_012129262.1|851326_851713_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_012129265.1|852865_853387_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129266.1|853432_853870_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021018248.1|854308_855352_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129268.1|855362_856811_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.3	9.2e-21
WP_021018246.1|856910_857246_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_086028355.1|857623_858746_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.0	7.4e-26
WP_012129273.1|860671_861811_+	exonuclease SbcCD subunit D	NA	G3MA97	Bacillus_virus	21.8	2.4e-08
WP_012129274.1|861820_864877_+	SMC family ATPase	NA	E3SMW4	Prochlorococcus_phage	22.4	6.1e-06
WP_012129275.1|864964_865345_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_041853653.1|865718_867401_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012129277.1|867455_868835_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	26.7	1.4e-47
WP_086028361.1|869254_870378_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012127656.1|870917_871961_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	898372	955170	2204018	transposase,protease	Vibrio_phage(16.67%)	46	NA	NA
WP_021017672.1|898372_899416_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021018241.1|899496_900657_-	MFS transporter	NA	NA	NA	NA	NA
WP_021018240.1|900833_901268_-	thioredoxin TrxC	NA	A0A1X9I9P5	Staphylococcus_phage	31.7	1.7e-10
WP_012129304.1|901433_902531_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011999187.1|902581_903907_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129305.1|905375_906938_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_012129307.1|907472_908735_-	hydroxymethylglutaryl-CoA reductase	NA	A2RQD2	Archaeal_BJ1_virus	36.6	4.7e-05
WP_012129308.1|909431_910064_+	DUF3299 domain-containing protein	NA	NA	NA	NA	NA
WP_021018237.1|910348_910567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129310.1|910627_912331_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005536098.1|912482_912776_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012129311.1|912802_913204_+	membrane protein	NA	NA	NA	NA	NA
WP_012129312.1|913218_913659_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_012129313.1|913692_914556_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012129314.1|914864_916985_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.8e-268
WP_005435220.1|917070_917541_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	62.9	6.2e-51
WP_012129316.1|917689_919075_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012127146.1|919850_921044_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_041853651.1|921582_922770_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_012129320.1|922782_923460_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012126481.1|923534_924914_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_012129321.1|925093_925630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010644161.1|925795_926167_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_041853544.1|926331_927783_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_012129323.1|927873_928626_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129324.1|928638_929328_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012129325.1|929324_930431_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.0	3.9e-19
WP_005427129.1|930516_930954_-	DUF3069 domain-containing protein	NA	NA	NA	NA	NA
WP_041853543.1|931197_932157_+	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	32.2	9.7e-11
WP_041853542.1|932280_933525_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.0	5.7e-11
WP_021018234.1|933780_934149_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_012129329.1|934213_934495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129330.1|934929_936486_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012129331.1|936498_937893_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_041853541.1|938046_939501_+	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
WP_012129333.1|939475_940138_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012129334.1|940146_941028_+	DUF2861 family protein	NA	NA	NA	NA	NA
WP_012129335.1|941087_942209_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_012129336.1|942251_942407_+	YoaH family protein	NA	NA	NA	NA	NA
WP_086028365.1|944779_946313_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012129340.1|947937_948468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129342.1|948990_949908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028361.1|950212_951336_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_086028365.1|951652_953186_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080514168.1|953257_953545_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.6	3.8e-11
WP_012129346.1|953604_955170_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.9e-26
>prophage 7
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	961671	968454	2204018		Vibrio_phage(100.0%)	11	NA	NA
WP_021018230.1|961671_963057_-	hypothetical protein	NA	Q783T9	Vibrio_phage	84.4	3.1e-236
WP_021018229.1|963061_963406_-	DUF2523 domain-containing protein	NA	Q783U0	Vibrio_phage	73.7	1.5e-43
WP_012129361.1|963407_964505_-	hypothetical protein	NA	Q783U1	Vibrio_phage	61.6	1.1e-85
WP_012129363.1|965030_965279_-	hypothetical protein	NA	Q783U2	Vibrio_phage	89.0	8.6e-28
WP_012129364.1|965284_965515_-	hypothetical protein	NA	Q783U3	Vibrio_phage	88.2	1.7e-30
WP_012127988.1|965520_965880_-	DUF1293 family protein	NA	Q783U4	Vibrio_phage	95.8	7.2e-60
WP_012129365.1|965883_967029_-	replication initiation factor domain-containing protein	NA	A0A1W6UG38	Vibrio_phage	90.6	1.3e-208
WP_005531344.1|967012_967228_-	hypothetical protein	NA	A0A1W6UGD1	Vibrio_phage	87.3	7.2e-31
WP_012129366.1|967231_967633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018226.1|967616_967880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129368.1|968085_968454_+	hypothetical protein	NA	Q9MCC3	Vibrio_phage	60.3	1.7e-32
>prophage 8
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	990010	1117612	2204018	plate,transposase,protease	Leptospira_phage(33.33%)	96	NA	NA
WP_012129386.1|990010_990613_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_012129387.1|990696_991896_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_012129388.1|992102_994013_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_012129389.1|994085_995741_+	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_012129390.1|995856_996477_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012129391.1|996590_997430_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_012129393.1|997652_998249_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_021018225.1|998210_998543_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_005531301.1|998552_998804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129395.1|998787_1000494_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129396.1|1000573_1000807_-	DUF3389 domain-containing protein	NA	NA	NA	NA	NA
WP_012129397.1|1000819_1001257_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_012129398.1|1001437_1002235_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041853648.1|1002312_1003395_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_012129400.1|1003753_1004998_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_012129401.1|1005020_1007501_+	lipase	NA	NA	NA	NA	NA
WP_012129402.1|1007635_1007845_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_012129403.1|1008125_1008683_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_021018224.1|1008839_1009757_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_011999339.1|1009816_1011349_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.2	1.6e-71
WP_011999338.1|1011408_1011762_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.7	1.8e-15
WP_011999494.1|1011758_1012070_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011999045.1|1012632_1012920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129407.1|1012903_1014226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129408.1|1014862_1015213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129410.1|1015462_1018006_-	peptidase	NA	NA	NA	NA	NA
WP_012129411.1|1018005_1018221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129412.1|1018217_1019303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129413.1|1019268_1019997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129416.1|1022846_1023347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129417.1|1023697_1024231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999348.1|1024853_1026047_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_086028371.1|1026172_1026969_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021018212.1|1027025_1027913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129420.1|1028732_1030649_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	42.2	7.9e-28
WP_012129421.1|1030645_1031185_-	YfiR family protein	NA	NA	NA	NA	NA
WP_012129422.1|1031178_1033335_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041853645.1|1033585_1033915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129425.1|1034651_1035572_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	6.2e-172
WP_005495177.1|1035675_1036467_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_005426887.1|1036463_1037789_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_077201632.1|1037800_1038301_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012129426.1|1038293_1039808_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_021018210.1|1039817_1040417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129428.1|1041039_1042344_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129429.1|1042371_1045761_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_005427005.1|1045793_1046246_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005532465.1|1046345_1047344_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012129430.1|1047340_1049089_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005532467.1|1049099_1049510_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012129431.1|1049571_1051047_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005449476.1|1051055_1051562_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012129432.1|1051588_1053190_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021018209.1|1053189_1055193_-	protein kinase	NA	A0A2I2L4T9	Orpheovirus	24.6	8.9e-06
WP_012129434.1|1055428_1056373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129435.1|1056365_1057358_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_012129436.1|1057338_1058658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129437.1|1058759_1059245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129438.1|1059244_1061323_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.4e-33
WP_005426983.1|1061395_1061914_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_041853643.1|1062369_1065048_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.6e-90
WP_012129441.1|1065034_1066663_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129442.1|1066782_1070418_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012129443.1|1070447_1071542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129444.1|1071535_1072849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129445.1|1072914_1074612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999187.1|1075371_1076697_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129448.1|1077541_1078906_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012129454.1|1081504_1082410_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_012129455.1|1082492_1083215_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012129456.1|1083395_1084376_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	75.9	5.8e-136
WP_005426806.1|1084636_1085359_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012128174.1|1085644_1086673_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129458.1|1086844_1087453_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_086028371.1|1087482_1088279_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011999348.1|1089517_1090711_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012126736.1|1091316_1093506_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_012129460.1|1095361_1096555_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.7e-68
WP_021018205.1|1096951_1097314_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_012129463.1|1098049_1099546_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.5e-26
WP_011998799.1|1099605_1099959_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1099955_1100267_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012127098.1|1100399_1101722_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005424996.1|1101843_1102035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018204.1|1102313_1103333_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.7	1.4e-39
WP_038863590.1|1103862_1105605_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_012129468.1|1105878_1107513_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_041853639.1|1107573_1108884_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_005530845.1|1109543_1110023_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_021018202.1|1110319_1111225_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129473.1|1111511_1112963_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_005530839.1|1113080_1113650_-	YceI family protein	NA	NA	NA	NA	NA
WP_005530836.1|1113646_1114186_-	cytochrome b	NA	NA	NA	NA	NA
WP_005530834.1|1114360_1114603_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_005530832.1|1114733_1115366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017764.1|1116067_1117612_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
>prophage 9
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1155983	1200899	2204018	transposase	Vibrio_phage(37.5%)	31	NA	NA
WP_012127098.1|1155983_1157306_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_041853534.1|1157565_1158684_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_005431308.1|1158951_1159575_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012129509.1|1159953_1161249_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.3	1.7e-103
WP_005431364.1|1161300_1161681_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_012129510.1|1161810_1164675_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	3.0e-273
WP_012129512.1|1165207_1166110_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	93.6	1.1e-162
WP_012129513.1|1166696_1169249_-	peptidase	NA	NA	NA	NA	NA
WP_012129411.1|1169248_1169464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157722665.1|1169460_1170429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999328.1|1171621_1172821_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.0	5.2e-102
WP_086028371.1|1174132_1174928_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012129522.1|1175614_1176523_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	93.4	3.4e-162
WP_012129523.1|1177109_1179683_-	peptidase	NA	NA	NA	NA	NA
WP_012129411.1|1179682_1179898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129412.1|1179894_1180980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129413.1|1180945_1181674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129524.1|1181692_1184497_-	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129416.1|1184519_1185020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129525.1|1185105_1185648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021017672.1|1187388_1188432_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129529.1|1188916_1189837_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	93.4	3.9e-166
WP_012129531.1|1190119_1192228_+	LruC domain-containing protein	NA	NA	NA	NA	NA
WP_012129532.1|1192240_1192717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129534.1|1193130_1194027_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_012129535.1|1194027_1195044_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012129536.1|1195040_1196012_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012129537.1|1196011_1196776_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	9.8e-14
WP_012129538.1|1196824_1198966_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012129539.1|1199061_1199556_-	YcxB family protein	NA	NA	NA	NA	NA
WP_086028361.1|1199775_1200899_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
>prophage 10
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1212355	1255465	2204018	transposase	Enterobacteria_phage(40.0%)	38	NA	NA
WP_086028365.1|1212355_1213889_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012129552.1|1213963_1214215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048814421.1|1214491_1215655_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_005431386.1|1215909_1216368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129555.1|1216478_1216670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129558.1|1217807_1218809_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011999348.1|1219020_1220214_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_041853531.1|1220452_1221244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999347.1|1222706_1223735_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021018181.1|1223799_1224282_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_080514171.1|1224299_1224629_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_005431367.1|1224868_1225219_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_012129566.1|1226422_1227085_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012129567.1|1227092_1227452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|1227458_1228652_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_162600501.1|1228742_1229492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127698.1|1231039_1231780_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_012127697.1|1231790_1233323_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	3.9e-110
WP_011998779.1|1234039_1234393_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1234389_1234701_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012129573.1|1234777_1235827_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_012129574.1|1235816_1237037_-	MFS transporter	NA	NA	NA	NA	NA
WP_012129575.1|1237033_1238290_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012129576.1|1238273_1239284_-	phosphotransferase	NA	NA	NA	NA	NA
WP_012129577.1|1239295_1239814_-	dCTP deaminase	NA	NA	NA	NA	NA
WP_012129578.1|1239810_1240296_-	deoxycytidine deaminase	NA	NA	NA	NA	NA
WP_012129580.1|1240456_1241137_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012129583.1|1241383_1241857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129584.1|1242000_1243200_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.1e-101
WP_011999348.1|1243328_1244522_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_144080947.1|1244490_1245045_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_012129587.1|1245569_1245908_-	hypothetical protein	NA	A0A1P8DTL0	Salmonella_phage	37.4	2.7e-08
WP_086028361.1|1246408_1247532_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_086028432.1|1248165_1248961_-|transposase	IS5-like element ISVha3 family transposase	transposase	NA	NA	NA	NA
WP_005426767.1|1249512_1250457_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_041853530.1|1250866_1252048_+	quorum-sensing autoinducer CAI-1 synthase	NA	NA	NA	NA	NA
WP_012129595.1|1252154_1254200_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	38.3	2.9e-12
WP_021017672.1|1254421_1255465_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1277181	1404155	2204018	transposase,integrase,holin	Enterobacteria_phage(33.33%)	86	1368895:1368908	1403467:1403480
WP_012129615.1|1277181_1278375_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_041853529.1|1279022_1281380_+	fatty acid cis/trans isomerase	NA	NA	NA	NA	NA
WP_005533325.1|1281398_1281590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129618.1|1281655_1284613_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	6.6e-50
WP_041853528.1|1284701_1285706_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_005431754.1|1285770_1286226_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_012129620.1|1286311_1288381_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.9	2.5e-19
WP_012129621.1|1288674_1290828_+	TIGR01666 family membrane protein	NA	H9YQA8	environmental_Halophage	29.5	1.6e-05
WP_005533336.1|1291363_1291630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129626.1|1291892_1310528_-	retention module-containing protein	NA	NA	NA	NA	NA
WP_012129627.1|1311391_1311640_+	YgjV family protein	NA	NA	NA	NA	NA
WP_012129629.1|1311808_1312195_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012129630.1|1312281_1313037_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	1.1e-12
WP_012129631.1|1313039_1313990_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012129632.1|1313982_1314918_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.9	5.0e-68
WP_012129633.1|1314940_1315849_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005431817.1|1316093_1316249_+	DUF3012 domain-containing protein	NA	NA	NA	NA	NA
WP_012129634.1|1316333_1317014_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129635.1|1317136_1317868_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005530599.1|1317872_1318610_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	34.9	1.4e-25
WP_012129636.1|1319209_1320220_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012129637.1|1320237_1321155_-	ribokinase	NA	NA	NA	NA	NA
WP_012129638.1|1321357_1322236_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	22.7	4.3e-05
WP_005431792.1|1322327_1323311_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_012129639.1|1323307_1324813_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.6e-18
WP_012129640.1|1324837_1325257_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_012129641.1|1325794_1328131_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012129643.1|1328796_1329990_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	4.8e-68
WP_012129645.1|1330673_1331312_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012128611.1|1331456_1332836_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_021018168.1|1333037_1333445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129648.1|1333539_1333857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005431873.1|1333942_1334620_-	DedA family protein	NA	NA	NA	NA	NA
WP_012129649.1|1334670_1335078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129650.1|1335215_1335734_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_012129652.1|1336406_1337222_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_012129653.1|1337231_1338242_-	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_012129654.1|1338466_1338934_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012128517.1|1340299_1341772_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_012129658.1|1343571_1344543_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_041853527.1|1344800_1348403_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.5	1.1e-33
WP_012129660.1|1348403_1349546_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_012129661.1|1349605_1351273_+	response regulator	NA	NA	NA	NA	NA
WP_012129663.1|1351675_1353043_+	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_012129664.1|1353052_1353844_+	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	28.1	5.4e-23
WP_012129665.1|1354062_1354719_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012129666.1|1354862_1356047_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.2	7.8e-26
WP_005425967.1|1356048_1356891_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_021018166.1|1356953_1357892_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_012129668.1|1357934_1359644_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	30.7	1.9e-57
WP_012129669.1|1359663_1361124_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009700210.1|1361140_1361740_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_086028361.1|1362365_1363488_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	32.6	9.6e-26
WP_012129670.1|1363612_1364875_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012129671.1|1365106_1366579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129672.1|1366617_1367268_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012129673.1|1367276_1368824_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_012129674.1|1368828_1369389_-	hypothetical protein	NA	NA	NA	NA	NA
1368895:1368908	attL	AGGTTTGAACCAAG	NA	NA	NA	NA
WP_041853526.1|1369375_1369858_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_012129676.1|1369860_1370583_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005425863.1|1370594_1371437_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005425870.1|1371433_1372336_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_012129677.1|1372337_1373609_-	CpaF family protein	NA	NA	NA	NA	NA
WP_012129678.1|1373605_1374847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129679.1|1374849_1375326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129680.1|1375322_1376693_-	pilus assembly protein N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012129681.1|1376692_1377517_-	pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_021018165.1|1377538_1377955_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_012129683.1|1378118_1378325_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_012129684.1|1378791_1379700_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011999348.1|1379668_1380862_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129685.1|1380957_1381449_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_012129686.1|1381454_1383464_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012127146.1|1385415_1386609_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012129690.1|1387254_1388337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129691.1|1388336_1393094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129693.1|1393299_1394484_+	TniQ family protein	NA	NA	NA	NA	NA
WP_012129694.1|1394484_1396407_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_012129695.1|1396378_1397437_+	type I-F CRISPR-associated protein Csy3	NA	NA	NA	NA	NA
WP_021018164.1|1397439_1398039_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_012129697.1|1398533_1398740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012129698.1|1398831_1399380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129699.1|1399373_1400768_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	32.3	2.5e-39
WP_012129700.1|1400858_1401839_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_012129701.1|1401860_1402862_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012129703.1|1402961_1404155_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	9.8e-69
1403467:1403480	attR	CTTGGTTCAAACCT	NA	NA	NA	NA
>prophage 12
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1442572	1504354	2204018	transposase	Enterobacteria_phage(23.08%)	50	NA	NA
WP_012128611.1|1442572_1443952_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012129738.1|1444010_1445063_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	49.5	3.7e-80
WP_010647147.1|1445523_1446504_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012129741.1|1446965_1447880_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_012129742.1|1447872_1448892_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_012129743.1|1448904_1449441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129744.1|1449437_1450205_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012129745.1|1450203_1450440_+	DUF2909 domain-containing protein	NA	NA	NA	NA	NA
WP_012129746.1|1450442_1451327_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012129747.1|1451338_1451929_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012129748.1|1451949_1453590_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.5	1.5e-11
WP_080514177.1|1453586_1454750_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_021018154.1|1455079_1456774_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.1	2.8e-93
WP_011999278.1|1457097_1458429_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129754.1|1458813_1459446_-	LysE family translocator	NA	NA	NA	NA	NA
WP_012129755.1|1459687_1460515_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129756.1|1460586_1461330_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_012129757.1|1461326_1461638_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_012129758.1|1461646_1462261_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_041853524.1|1462467_1463502_-	porin	NA	NA	NA	NA	NA
WP_005426000.1|1464070_1465039_+	porin	NA	NA	NA	NA	NA
WP_012128611.1|1465355_1466735_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012127146.1|1466872_1468066_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_010647169.1|1468297_1469137_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012129764.1|1469199_1469814_+	glutaredoxin	NA	A0A0K1YA09	Cronobacter_phage	45.1	7.6e-09
WP_005426002.1|1470148_1470496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018151.1|1470615_1471806_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_012129766.1|1471917_1472805_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129767.1|1472992_1474987_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_012129768.1|1474986_1475940_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129769.1|1476031_1478179_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012129770.1|1478386_1479295_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129774.1|1480350_1481136_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	4.2e-12
WP_012129775.1|1483258_1484578_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0WXW0	Clostridium_phage	35.4	2.6e-14
WP_012129776.1|1484668_1485298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129778.1|1485447_1485849_+	GFA family protein	NA	NA	NA	NA	NA
WP_041853522.1|1486029_1486701_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_005533370.1|1487171_1488536_+	YjiH family protein	NA	NA	NA	NA	NA
WP_021018143.1|1488963_1490007_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129782.1|1490102_1491974_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.9	2.0e-20
WP_012129783.1|1492051_1492363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041853385.1|1492563_1493874_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012129785.1|1494491_1495649_-	tyrosine transporter	NA	NA	NA	NA	NA
WP_012129786.1|1496433_1496745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129787.1|1496885_1497233_+	helix-turn-helix transcriptional regulator	NA	Q8H9R3	Vibrio_phage	48.4	9.9e-14
WP_021018147.1|1498135_1499884_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129792.1|1500486_1501026_+	redoxin family protein	NA	NA	NA	NA	NA
WP_012129794.1|1501875_1502670_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	40.4	8.8e-42
WP_012129795.1|1502670_1503048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011999529.1|1503160_1504354_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	5.7e-69
>prophage 13
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1515391	1571724	2204018	transposase	Enterobacteria_phage(12.5%)	42	NA	NA
WP_011999348.1|1515391_1516585_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129807.1|1516905_1517850_-	sugar kinase	NA	NA	NA	NA	NA
WP_012129808.1|1517952_1519473_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_021018143.1|1519627_1520671_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129810.1|1521257_1522703_-	D-aminoacylase	NA	NA	NA	NA	NA
WP_012129813.1|1524243_1525107_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041853612.1|1525479_1526427_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005534577.1|1526431_1527358_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	34.6	3.7e-23
WP_005425148.1|1527357_1528455_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012129816.1|1528532_1528865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129817.1|1529095_1530022_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012129818.1|1530115_1534354_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_041853521.1|1534669_1535107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012129820.1|1535241_1536633_+	TolC family protein	NA	NA	NA	NA	NA
WP_012129821.1|1536797_1538531_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012129822.1|1538533_1541713_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005425081.1|1541791_1542358_+	copper-binding protein	NA	NA	NA	NA	NA
WP_012129823.1|1542431_1543055_-	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_021018142.1|1543163_1544042_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129825.1|1544366_1545218_+	CARB/PSE/RTG family carbenicillin-hydrolyzing class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	42.0	5.5e-50
WP_012129827.1|1545432_1545831_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_021018141.1|1545850_1546366_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012129829.1|1546492_1546855_-	VOC family protein	NA	NA	NA	NA	NA
WP_012127656.1|1548356_1549400_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012129832.1|1550256_1550787_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_080514178.1|1550822_1551983_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012129834.1|1552014_1552935_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_144080945.1|1552999_1553200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018139.1|1555087_1557244_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.8	1.8e-65
WP_012129842.1|1557671_1558700_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005426417.1|1560438_1560690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018138.1|1560846_1561272_+	universal stress protein	NA	NA	NA	NA	NA
WP_011999278.1|1561433_1562765_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012129846.1|1562817_1563570_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012129847.1|1563562_1564315_-	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.7	5.3e-20
WP_012129848.1|1564545_1565853_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_012129849.1|1565980_1566862_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_012129850.1|1566861_1567710_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_012129851.1|1567710_1568868_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	3.9e-22
WP_012129852.1|1568860_1569685_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012129853.1|1569708_1569897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127491.1|1570191_1571724_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
>prophage 14
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1595504	1645443	2204018	transposase	Leptospira_phage(36.36%)	36	NA	NA
WP_012129880.1|1595504_1597037_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.4	1.2e-71
WP_012127165.1|1597096_1597450_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.7	1.8e-15
WP_021017836.1|1597446_1597758_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_157722666.1|1598098_1600708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048814458.1|1600647_1603506_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_021018133.1|1603519_1604230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129885.1|1604426_1607765_-	calcium-binding protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	40.2	4.1e-16
WP_012129888.1|1608472_1608928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129891.1|1611001_1612375_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_144080972.1|1612359_1614411_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.2	6.9e-38
WP_041853608.1|1615396_1615963_+	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	55.6	6.7e-52
WP_011999348.1|1616075_1617269_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_011998890.1|1618124_1618322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129897.1|1618392_1619112_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_012129898.1|1619550_1621035_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_012129899.1|1621040_1622387_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_012129900.1|1622511_1623306_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012129901.1|1623309_1624236_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012129902.1|1624225_1625368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005532354.1|1625977_1626217_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011999348.1|1626346_1627540_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_012129906.1|1627790_1628660_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012129907.1|1628791_1629940_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_021018131.1|1630377_1631406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012127146.1|1631862_1633056_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.1	2.8e-68
WP_012129911.1|1633310_1633775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012129912.1|1634017_1634728_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_012129913.1|1635238_1635673_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_012129914.1|1635739_1636174_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_012129915.1|1636170_1636863_+	molecular chaperone	NA	NA	NA	NA	NA
WP_048814459.1|1637053_1639336_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_012129917.1|1639599_1641183_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.5	3.8e-52
WP_021018259.1|1641172_1642717_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.3e-70
WP_011998779.1|1642777_1643131_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1643127_1643439_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_086028385.1|1643908_1645443_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1839405	1908701	2204018	transposase,protease	Wolbachia_phage(18.18%)	58	NA	NA
WP_012130098.1|1839405_1840785_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	1.3e-48
WP_103025446.1|1842510_1842741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130100.1|1842818_1843430_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_041853507.1|1843522_1844923_-	tryptophanase	NA	NA	NA	NA	NA
WP_021018093.1|1845219_1846464_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_012130105.1|1846633_1847041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130106.1|1847087_1847609_-	GrpB family protein	NA	NA	NA	NA	NA
WP_012130107.1|1847758_1848991_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_012130108.1|1848999_1851123_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_012130109.1|1851211_1852222_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_012130112.1|1853055_1854366_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_012130113.1|1854432_1855782_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130114.1|1855956_1858017_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_012130115.1|1858164_1859556_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012130116.1|1859643_1861680_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_005432583.1|1861899_1862238_+	YggL family protein	NA	NA	NA	NA	NA
WP_005432584.1|1862943_1863810_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012130119.1|1863977_1864223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130120.1|1864723_1865626_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	38.8	4.0e-06
WP_005432587.1|1866002_1866908_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.4	1.8e-38
WP_012130123.1|1866971_1867400_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_012130124.1|1867459_1868209_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041853595.1|1868545_1870456_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_012130126.1|1870457_1871378_+	agmatinase	NA	NA	NA	NA	NA
WP_012130127.1|1871640_1872846_+	multidrug efflux MFS transporter EmrD	NA	NA	NA	NA	NA
WP_021018090.1|1873123_1875289_+	oligopeptidase B	NA	F2Y2S5	Organic_Lake_phycodnavirus	21.6	4.0e-12
WP_041853506.1|1875467_1876451_-	porin	NA	NA	NA	NA	NA
WP_012130130.1|1876666_1877536_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005432612.1|1877550_1878426_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012130131.1|1878425_1879160_-	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.4	7.5e-11
WP_012130132.1|1879159_1880095_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012130133.1|1880157_1880709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005432620.1|1880705_1881026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162471677.1|1881070_1881907_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_012130135.1|1881917_1882412_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_080514183.1|1882479_1882971_-	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_012128517.1|1883510_1884983_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	5.0e-131
WP_012130138.1|1885406_1886252_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012130139.1|1886424_1887597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130140.1|1887593_1888214_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_005432634.1|1888213_1888618_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_012130141.1|1888614_1889169_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012130142.1|1889168_1890536_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_012130143.1|1890536_1891304_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_012130144.1|1891379_1893452_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012130145.1|1893658_1895032_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012130146.1|1895031_1895697_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	2.6e-26
WP_012130148.1|1896110_1896821_+	glycerophosphoryl diester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	30.1	5.5e-11
WP_021018086.1|1896846_1897329_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_021018085.1|1897506_1898502_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	42.1	6.2e-69
WP_005530256.1|1898586_1898943_+	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_012130152.1|1899158_1899851_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_012128611.1|1900842_1902222_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012130153.1|1902437_1903514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010645962.1|1904730_1905180_-	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_012130156.1|1905298_1906453_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_079771085.1|1906766_1906856_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011999348.1|1907507_1908701_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
>prophage 16
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1914541	1946601	2204018	transposase,tRNA,integrase	Leptospira_phage(50.0%)	25	1926236:1926254	1955601:1955619
WP_012130164.1|1914541_1916086_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	3.0e-70
WP_012130165.1|1916145_1916499_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.0e-14
WP_011999494.1|1916495_1916807_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_048814461.1|1918825_1920298_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.6	2.5e-130
WP_011998890.1|1920213_1920411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018044.1|1920571_1920853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128395.1|1920839_1921046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012128396.1|1921129_1921561_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_012130170.1|1922219_1922996_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
1926236:1926254	attL	AGTGAGCAAGGTTAGCGCA	NA	NA	NA	NA
WP_012130173.1|1926351_1927113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018081.1|1927440_1928988_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.3	1.6e-84
WP_012130176.1|1929007_1929949_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_021018080.1|1929950_1930355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130178.1|1930543_1931137_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012130179.1|1931416_1931659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018079.1|1932240_1932693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130182.1|1932710_1933355_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_012130183.1|1933351_1934272_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.7	1.6e-172
WP_021018078.1|1934302_1935283_-|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	38.7	2.9e-42
WP_011999494.1|1935452_1935764_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|1935760_1936114_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021017813.1|1936174_1937719_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_021018077.1|1937869_1939129_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012130189.1|1945318_1945843_-	DUF3087 domain-containing protein	NA	NA	NA	NA	NA
WP_012130190.1|1946001_1946601_+|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
1955601:1955619	attR	TGCGCTAACCTTGCTCACT	NA	NA	NA	NA
>prophage 17
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	1983636	2046858	2204018	transposase	Leptospira_phage(20.0%)	55	NA	NA
WP_012130229.1|1983636_1985181_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.7	2.3e-70
WP_011998799.1|1985240_1985594_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|1985590_1985902_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012130231.1|1986270_1986762_+	VOC family protein	NA	NA	NA	NA	NA
WP_021018074.1|1987318_1988110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005428402.1|1989682_1990087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130238.1|1990636_1990945_-	MliC family protein	NA	NA	NA	NA	NA
WP_012130240.1|1990941_1991403_-	ecotin family protein	NA	NA	NA	NA	NA
WP_005428272.1|1991604_1992024_+	VOC family protein	NA	NA	NA	NA	NA
WP_005428362.1|1992153_1992405_+	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_012130241.1|1992442_1993162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130242.1|1993687_1996378_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012130243.1|1996638_1997406_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011999114.1|1998328_1999249_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	96.4	2.3e-171
WP_012130247.1|2000217_2000463_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_005434843.1|2000549_2002037_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_005533107.1|2002033_2003059_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012130248.1|2003353_2003995_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_012130250.1|2004427_2005078_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_012130251.1|2005086_2005398_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011999348.1|2005548_2006742_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
WP_005428450.1|2007272_2007602_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_012130253.1|2007618_2008233_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010645422.1|2009701_2010142_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021018071.1|2010290_2010875_+	LysE family translocator	NA	NA	NA	NA	NA
WP_041853501.1|2011146_2013078_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_021018070.1|2013401_2014292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130259.1|2014425_2015496_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_012130260.1|2015511_2016501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041853580.1|2017279_2018053_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_012130263.1|2018127_2018997_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130264.1|2019065_2019578_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012130266.1|2019945_2020761_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_005428461.1|2021050_2022199_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.9	3.0e-35
WP_005428252.1|2022403_2023243_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012130267.1|2023445_2023685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005428270.1|2023734_2024106_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_041853500.1|2024387_2024852_+	oxidoreductase	NA	NA	NA	NA	NA
WP_012130270.1|2024848_2025940_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.0	3.8e-11
WP_012130271.1|2025950_2026355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130272.1|2026456_2027254_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_021018067.1|2027448_2029128_+	ribosomal large subunit pseudouridine synthase A	NA	NA	NA	NA	NA
WP_012130274.1|2029744_2031085_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012130275.1|2031296_2032319_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010648031.1|2032453_2033548_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.4	6.5e-19
WP_012130276.1|2033547_2034897_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.2	5.5e-68
WP_012130277.1|2034920_2035805_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_012130278.1|2035806_2036796_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012130281.1|2038129_2039134_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012128611.1|2039478_2040858_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.2	9.9e-49
WP_012130283.1|2040990_2042289_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_021017672.1|2042562_2043606_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012130285.1|2043833_2045018_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	27.5	6.6e-17
WP_005428352.1|2045040_2045322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011999278.1|2045526_2046858_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	2053793	2090164	2204018	transposase,tRNA	Leptospira_phage(54.55%)	32	NA	NA
WP_012130294.1|2053793_2054978_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.5	2.9e-73
WP_012126528.1|2055548_2056289_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	7.7e-48
WP_012127697.1|2056299_2057832_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	42.1	3.9e-110
WP_012130296.1|2058080_2059622_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.7e-26
WP_011998779.1|2059681_2060035_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|2060031_2060343_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_048814462.1|2063432_2064977_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998779.1|2065037_2065391_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_011999494.1|2065387_2065699_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|2066854_2068389_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162600502.1|2068507_2068828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130306.1|2068943_2069495_+	TniQ family protein	NA	NA	NA	NA	NA
WP_011999494.1|2069571_2069883_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998779.1|2069879_2070233_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.6	7.0e-15
WP_021018061.1|2070293_2071838_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	40.1	7.8e-26
WP_012130309.1|2072101_2072518_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012130311.1|2073769_2074795_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_012130312.1|2075215_2076646_+	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_012130313.1|2076672_2077068_-	GFA family protein	NA	NA	NA	NA	NA
WP_012130315.1|2077286_2077895_+	YitT family protein	NA	NA	NA	NA	NA
WP_041853385.1|2077949_2079260_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_012130316.1|2079874_2080768_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010453583.1|2080916_2081270_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_005531215.1|2081416_2081668_-	DUF3081 domain-containing protein	NA	NA	NA	NA	NA
WP_005531216.1|2082042_2082843_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_021018371.1|2082969_2083836_-	glycerol kinase	NA	NA	NA	NA	NA
WP_021018370.1|2083986_2085213_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_021018369.1|2085661_2086033_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130321.1|2086029_2086887_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.6e-12
WP_012130322.1|2086886_2087717_+	membrane protein	NA	NA	NA	NA	NA
WP_095211511.1|2087813_2088851_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011999348.1|2088970_2090164_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	1.3e-68
>prophage 19
NC_009784	Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence	2204018	2125106	2195084	2204018	transposase,tRNA	Klosneuvirus(25.0%)	53	NA	NA
WP_012130358.1|2125106_2126438_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_012130359.1|2126624_2128643_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_041853574.1|2129089_2130769_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_012130361.1|2130835_2131489_-	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	38.1	2.8e-17
WP_012130362.1|2131581_2132484_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130363.1|2132870_2133617_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_048814463.1|2133768_2135394_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048814464.1|2135457_2135988_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_012130366.1|2136174_2136492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144080970.1|2136506_2136743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021017672.1|2136712_2137756_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_021018364.1|2137994_2138315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080969.1|2138672_2138987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130370.1|2139006_2139321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514184.1|2139325_2139664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130371.1|2139686_2140013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130372.1|2140028_2140361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018362.1|2140368_2140719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080514185.1|2141091_2141457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130376.1|2141460_2141838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080968.1|2142208_2142550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080967.1|2142596_2142944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130382.1|2143712_2144078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130383.1|2144107_2144419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086028365.1|2144440_2145975_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144080966.1|2153686_2154037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018357.1|2154107_2154695_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_041853573.1|2157208_2159122_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012130390.1|2159127_2159811_-	transglutaminase-like cysteine peptidase	NA	NA	NA	NA	NA
WP_021018356.1|2159924_2161316_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012130392.1|2161431_2162655_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130393.1|2162647_2164561_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_012130394.1|2164689_2165325_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_005428959.1|2165393_2166113_-	helix-turn-helix transcriptional regulator	NA	A2I306	Vibrio_virus	40.6	3.6e-34
WP_012130395.1|2166883_2167696_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012130397.1|2168096_2171228_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_012130398.1|2171239_2171947_+	1-pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_021018354.1|2172084_2173578_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_021018353.1|2173628_2174159_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005428980.1|2174307_2174547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012130401.1|2174699_2175059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130402.1|2175205_2175739_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041853697.1|2176375_2177389_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005449899.1|2178445_2178922_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_012130407.1|2179003_2179711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130409.1|2180348_2182187_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	2.1e-33
WP_021018351.1|2182592_2183594_+	amidinotransferase	NA	NA	NA	NA	NA
WP_095211508.1|2187587_2188628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018350.1|2188708_2188885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012130416.1|2189339_2189933_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_012130417.1|2189984_2190380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012127656.1|2192568_2193612_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011999529.1|2193890_2195084_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	38.4	5.7e-69
>prophage 1
NC_009777	Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence	89008	12862	56994	89008	transposase	Leptospira_phage(25.0%)	47	NA	NA
WP_021017764.1|12862_14407_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	2.7e-71
WP_011998799.1|14467_14821_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011999494.1|14817_15129_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011998802.1|16424_16772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998803.1|16783_17122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086028461.1|17321_18445_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.3	2.0e-23
WP_011998807.1|19388_19820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080514193.1|19801_19927_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011998809.1|20692_20977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998811.1|21435_22479_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	26.7	1.6e-06
WP_080514194.1|22559_22691_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_011998812.1|22895_23912_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011998813.1|24022_25222_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	47.8	1.5e-101
WP_011998815.1|26002_26827_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_011998817.1|27552_27849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011998818.1|27835_28033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998819.1|28170_29208_+	permease	NA	NA	NA	NA	NA
WP_011998820.1|29679_31884_-	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_011998821.1|31892_32429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021018375.1|32439_34179_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_011998823.1|34221_35238_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_011998825.1|35588_36782_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_011998826.1|36774_37542_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_011998827.1|37538_38294_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_011998829.1|38517_39468_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_005430722.1|39477_39711_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011998830.1|39723_40389_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_021018377.1|40391_42722_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_011998832.1|42684_43056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998833.1|43058_43376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998834.1|43390_43993_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011998835.1|43982_44342_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011998836.1|44395_44578_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011998838.1|45336_45927_+	LexA family transcriptional regulator	NA	H9A0Q4	Staphylococcus_phage	26.0	2.1e-08
WP_021018378.1|45948_46374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998840.1|46386_47034_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_011998841.1|47030_47510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144080979.1|48213_49014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998844.1|49713_50112_+	GIY-YIG nuclease family protein	NA	A0A0P0YND3	Yellowstone_lake_phycodnavirus	41.8	1.3e-12
WP_011998845.1|50224_50992_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	32.8	5.2e-15
WP_011998846.1|51012_51309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998849.1|51661_52000_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021018379.1|52010_52256_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_011998851.1|53128_53581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998852.1|53777_54764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998853.1|54851_55247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998854.1|55449_56994_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.9	3.6e-71
