The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	590302	601816	4368373	integrase	Enterobacteria_phage(71.43%)	13	589739:589762	601865:601888
589739:589762	attL	CGTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_071817994.1|590302_591835_+	ATP-binding protein	NA	K7PHD1	Enterobacteria_phage	39.7	3.0e-94
WP_071817995.1|591831_592674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012123979.1|592838_595154_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	59.6	2.1e-256
WP_012123980.1|595167_595509_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_012123981.1|595495_595762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041460398.1|595758_596286_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	58.1	3.0e-30
WP_041460399.1|596299_596548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041460400.1|596544_596802_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.1e-17
WP_012123985.1|597310_598021_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	28.0	9.1e-14
WP_012123986.1|598017_598269_+	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	61.7	2.4e-14
WP_012123987.1|598549_599245_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_181037662.1|599241_600483_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012123989.1|600616_601816_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	5.3e-107
601865:601888	attR	CGTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
>prophage 2
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	969834	1056237	4368373	portal,head,protease,lysis,capsid,integrase,tail,holin,terminase	Cronobacter_phage(20.41%)	91	969652:969703	1009907:1009958
969652:969703	attL	TTTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCTGACACCCCATGACA	NA	NA	NA	NA
WP_012124195.1|969834_971019_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	32.6	2.0e-37
WP_012124196.1|971020_971230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041460437.1|971268_971838_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.4	3.0e-60
WP_012124198.1|971871_972192_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	81.9	2.2e-36
WP_012124199.1|972184_972622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012124200.1|972618_973101_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	3.9e-69
WP_041460438.1|973093_973438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012124203.1|974255_975185_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.0	8.3e-100
WP_012124205.1|975984_976311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007901036.1|976472_977351_+	BRCT domain-containing protein	NA	U3PB51	Vibrio_phage	33.8	4.2e-37
WP_012124207.1|977342_978032_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.4	7.2e-40
WP_012124208.1|978167_978389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007901034.1|978439_978991_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.4	6.7e-65
WP_012124209.1|979157_979325_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_012124212.1|980213_980450_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012124213.1|980449_981628_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	82.4	2.2e-105
WP_012124214.1|981624_981954_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	49.0	5.7e-19
WP_004388343.1|981950_982334_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	77.2	2.2e-51
WP_049761066.1|982349_983075_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.8	3.4e-56
WP_041460440.1|983071_984121_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	65.0	8.4e-133
WP_012124217.1|984139_984898_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	60.7	2.7e-80
WP_071817998.1|985189_985426_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_041460694.1|985394_985736_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_007747946.1|985878_986259_+|holin	phage holin family protein	holin	F1C592	Cronobacter_phage	97.6	4.5e-60
WP_007709085.1|986245_986530_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	2.9e-19
WP_012124219.1|986526_987150_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	95.2	4.5e-110
WP_012124220.1|987149_987614_+|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	57.1	2.3e-34
WP_041460441.1|988136_988487_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	83.5	9.8e-54
WP_012124223.1|988483_988702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041460442.1|988864_989338_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	91.1	7.0e-79
WP_012124225.1|989337_991095_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.6	0.0e+00
WP_012124226.1|991094_992399_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.2	6.4e-223
WP_012124227.1|992407_993262_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.1	2.0e-116
WP_012124228.1|993275_994496_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	92.9	1.1e-205
WP_012124229.1|994549_994732_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	89.5	7.4e-13
WP_012124230.1|994741_995068_+|head,tail	phage head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.9	1.1e-25
WP_012124231.1|995064_995406_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012124232.1|995402_995852_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	85.9	1.8e-63
WP_012124233.1|995848_996178_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	53.6	1.9e-22
WP_012124234.1|996225_996681_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	74.3	4.0e-55
WP_015386562.1|996731_997127_+|tail	phage tail assembly chaperone	tail	F1C576	Cronobacter_phage	87.0	3.7e-57
WP_012124237.1|997150_997420_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	58.6	3.8e-21
WP_012124238.1|997511_997850_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	61.5	2.1e-32
WP_012124239.1|997910_1001441_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	51.2	7.6e-287
WP_012124240.1|1001486_1001825_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	61.6	1.6e-37
WP_012124241.1|1001831_1002584_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	96.4	7.1e-142
WP_012124242.1|1002586_1003291_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	97.4	1.8e-139
WP_012124243.1|1003287_1003884_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	99.0	1.8e-103
WP_012124244.1|1003933_1007095_+	host specificity protein J	NA	F1C571	Cronobacter_phage	97.3	0.0e+00
WP_049761345.1|1007447_1008032_+	hypothetical protein	NA	F1C570	Cronobacter_phage	56.9	6.0e-56
WP_012124246.1|1008969_1009551_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	40.9	1.6e-32
WP_012124247.1|1010060_1011824_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
1009907:1009958	attR	TTTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCTGACACCCCATGACA	NA	NA	NA	NA
WP_004387431.1|1011843_1012071_-	YejL family protein	NA	NA	NA	NA	NA
WP_012124248.1|1012205_1013210_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	4.8e-85
WP_004387433.1|1013310_1013595_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_012124249.1|1013721_1015482_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	1.4e-100
WP_012124251.1|1015652_1016360_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_012124252.1|1016375_1017572_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.7	1.9e-24
WP_004387437.1|1017906_1018251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012124254.1|1018254_1019844_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	3.2e-19
WP_012124255.1|1019845_1020871_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004387440.1|1020867_1021965_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_012124256.1|1021973_1023779_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012124257.1|1023874_1025437_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004387441.1|1025606_1026176_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.1e-13
WP_007851281.1|1026602_1027310_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012124258.1|1027340_1028327_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_041460443.1|1028457_1029924_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	6.0e-44
WP_012124262.1|1030130_1031321_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_004387446.1|1031385_1031958_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_004387449.1|1032464_1032719_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_012124266.1|1032715_1033897_-	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_012124267.1|1034266_1035400_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_004387452.1|1035396_1036335_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_007869388.1|1036351_1038049_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_041460444.1|1038177_1039008_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_012124269.1|1039008_1039866_-	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	33.8	8.1e-25
WP_041460445.1|1039940_1040990_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_007851261.1|1041107_1041974_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029039354.1|1042160_1043630_+	amino acid permease	NA	NA	NA	NA	NA
WP_041460446.1|1043842_1044673_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004387460.1|1044796_1045921_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004387461.1|1046045_1046717_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	1.2e-55
WP_012124275.1|1046725_1047883_+	DUF418 family protein	NA	NA	NA	NA	NA
WP_012124276.1|1048038_1049064_+	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_004387464.1|1049347_1050346_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_004387465.1|1050427_1051948_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	6.3e-12
WP_004387466.1|1051963_1052974_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_004387784.1|1053689_1054403_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_012124277.1|1054527_1055412_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_007869369.1|1055541_1056237_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 3
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	1204536	1213524	4368373		Burkholderia_phage(33.33%)	9	NA	NA
WP_007794693.1|1204536_1204776_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	84.8	5.5e-32
WP_041460463.1|1204929_1206054_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	9.4e-106
WP_012124374.1|1206698_1207397_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.9	1.3e-07
WP_162618440.1|1207523_1208891_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.4	2.9e-101
WP_012124376.1|1208874_1209372_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	2.1e-33
WP_012124377.1|1209375_1210287_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004388132.1|1210465_1211380_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004388133.1|1211469_1211652_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_012124379.1|1211853_1213524_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	1.7e-23
>prophage 4
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	1561009	1567764	4368373		Cronobacter_phage(44.44%)	9	NA	NA
WP_012124593.1|1561009_1562293_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	57.2	4.3e-147
WP_015386639.1|1562318_1562570_-	excisionase family protein	NA	S4TND0	Salmonella_phage	47.4	2.0e-16
WP_012124595.1|1562650_1563751_-	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	91.5	4.6e-198
WP_038862657.1|1563752_1564043_-	host-nuclease inhibitor protein	NA	I6PDJ2	Cronobacter_phage	72.6	1.6e-33
WP_012124597.1|1564735_1565341_-	LexA family transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	52.9	6.3e-16
WP_071818046.1|1565450_1565672_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	60.3	6.7e-16
WP_012124598.1|1565728_1566073_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	88.2	8.2e-45
WP_012124599.1|1566163_1567021_+	helix-turn-helix domain-containing protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	58.6	1.0e-43
WP_012124600.1|1567017_1567764_+	replication protein	NA	I6PBN0	Cronobacter_phage	66.1	4.2e-78
>prophage 5
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	1570797	1638149	4368373	portal,head,protease,tRNA,lysis,capsid,tail,holin,transposase,terminase	Salmonella_phage(19.23%)	71	NA	NA
WP_012124603.1|1570797_1571253_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	84.8	7.2e-73
WP_012124605.1|1571446_1571743_+	hypothetical protein	NA	F1C5C8	Cronobacter_phage	72.3	1.5e-31
WP_012124606.1|1571739_1572102_+	RusA family crossover junction endodeoxyribonuclease	NA	I6PBN1	Cronobacter_phage	87.5	1.6e-54
WP_012124607.1|1572098_1572794_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	65.4	2.8e-76
WP_012124608.1|1572927_1573161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007793917.1|1573908_1574124_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	84.5	6.7e-29
WP_015386656.1|1574123_1574609_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	72.3	7.7e-65
WP_012124610.1|1574608_1574959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041460487.1|1575754_1576099_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_108637838.1|1576235_1576355_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_071818005.1|1576403_1576586_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012124613.1|1576630_1576951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071818047.1|1577219_1577735_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_041460488.1|1577858_1578218_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	64.3	1.0e-37
WP_015386663.1|1578384_1578813_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	57.5	4.6e-29
WP_012124617.1|1578816_1580544_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	60.1	1.2e-205
WP_012124619.1|1580689_1581931_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	71.3	4.0e-174
WP_012124620.1|1581923_1582547_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.7	9.3e-79
WP_012124621.1|1582616_1583837_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	64.5	2.7e-143
WP_012124622.1|1583842_1584109_+	Ig domain-containing protein	NA	A0A0C5KL53	Enterococcus_phage	48.1	1.1e-07
WP_012124623.1|1584143_1584461_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	59.8	3.1e-30
WP_012124624.1|1584457_1584853_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	53.5	1.3e-30
WP_012124625.1|1584845_1585364_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	72.8	9.7e-66
WP_012124627.1|1585860_1586433_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	60.5	5.2e-60
WP_012124628.1|1586490_1587672_+	hypothetical protein	NA	O22004	Shigella_phage	41.5	4.4e-21
WP_129560256.1|1587947_1588094_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	48.9	1.9e-06
WP_015386679.1|1588798_1589125_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_054628786.1|1589423_1589675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041460489.1|1589663_1590716_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_012124632.1|1590712_1592947_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_012124633.1|1592943_1593621_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_012124634.1|1593636_1594719_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.3e-08
WP_041460490.1|1594768_1595761_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041460705.1|1595926_1597324_+	YcjX family protein	NA	NA	NA	NA	NA
WP_007868161.1|1597320_1598364_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_041460491.1|1598512_1600075_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_004387306.1|1600126_1600633_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_012124638.1|1600769_1601768_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_012124639.1|1601749_1602472_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_012124640.1|1602716_1604333_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012124641.1|1604393_1604834_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_170921726.1|1604951_1605287_-	anti-adapter protein IraM	NA	NA	NA	NA	NA
WP_012124642.1|1605773_1606355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387314.1|1606595_1606850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004387315.1|1606996_1607236_-	general stress protein	NA	NA	NA	NA	NA
WP_004387316.1|1607958_1609710_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004387317.1|1609910_1610102_-	hypothetical protein	NA	I6S5X8	Salmonella_phage	46.6	2.9e-07
WP_004387318.1|1610175_1610499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387319.1|1610700_1610874_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004387320.1|1610952_1611156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004387321.1|1611195_1612179_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004387322.1|1612498_1612648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012124649.1|1612685_1613618_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.2	3.4e-141
WP_012124651.1|1613903_1615016_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_014728788.1|1615419_1616277_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	48.6	6.1e-65
WP_012124654.1|1616294_1617365_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_012124655.1|1617345_1619151_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012124656.1|1619422_1620943_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012124657.1|1620975_1622007_+	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	31.6	1.0e-37
WP_041460492.1|1622175_1623222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012124659.1|1623223_1626745_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_015386690.1|1627023_1627290_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_007896943.1|1627290_1627713_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004388292.1|1627767_1628757_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	43.1	3.1e-68
WP_012124661.1|1628968_1631611_+	YdbH family protein	NA	NA	NA	NA	NA
WP_004388543.1|1631607_1631799_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_007868029.1|1631810_1632131_+	YdbL family protein	NA	NA	NA	NA	NA
WP_012124662.1|1632209_1632536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004386715.1|1632596_1633202_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_012124663.1|1633406_1637312_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	6.5e-53
WP_012124664.1|1637630_1638149_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	2063285	2073483	4368373	tRNA	Bacillus_phage(14.29%)	12	NA	NA
WP_004387814.1|2063285_2063750_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.0	1.0e-10
WP_012124992.1|2063827_2064571_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	7.1e-09
WP_004387815.1|2064573_2065125_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_012124993.1|2065154_2066156_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004387086.1|2066233_2066533_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_012124994.1|2066537_2068925_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	7.3e-07
WP_007867262.1|2068940_2069924_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_124752678.1|2070143_2070338_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124849.1|2070309_2070666_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2070713_2070911_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012905609.1|2071008_2071551_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.1e-14
WP_004387090.1|2071554_2073483_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.1e-130
>prophage 7
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	2690638	2702614	4368373	lysis,capsid	Cronobacter_phage(44.44%)	13	NA	NA
WP_012125402.1|2690638_2693137_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	3.8e-30
WP_124813642.1|2694587_2694974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041460580.1|2694977_2695958_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	97.3	2.1e-162
WP_041460581.1|2696796_2697243_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	76.5	6.0e-48
WP_041460730.1|2697252_2697453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125409.1|2697845_2698310_-|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	72.5	4.4e-49
WP_165756271.1|2698299_2698797_-	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	73.3	5.7e-71
WP_032986368.1|2698805_2699051_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	85.7	1.4e-27
WP_012125412.1|2699269_2699551_+	DUF1456 family protein	NA	NA	NA	NA	NA
WP_012125413.1|2699811_2700576_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	97.6	1.0e-132
WP_012125414.1|2700572_2700752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125415.1|2700748_2701006_-	hypothetical protein	NA	G0ZNC5	Cronobacter_phage	98.8	5.9e-40
WP_012125417.1|2701747_2702614_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.7	3.8e-30
>prophage 8
NC_009778	Cronobacter sakazakii ATCC BAA-894, complete sequence	4368373	2974742	3029308	4368373	integrase,terminase,tail,capsid	Cronobacter_phage(55.74%)	79	2976089:2976134	3025395:3025440
WP_012125605.1|2974742_2975924_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	1.4e-123
2976089:2976134	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_012125606.1|2976324_2976687_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	96.7	2.9e-56
WP_012125607.1|2976683_2977613_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	92.4	1.7e-161
WP_012125608.1|2977609_2979088_+	glucosyltransferase domain-containing protein	NA	I1TED7	Salmonella_phage	24.1	5.7e-18
WP_012125609.1|2979111_2981103_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	32.5	2.3e-62
WP_012125610.1|2981159_2983637_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	96.2	0.0e+00
WP_012125611.1|2983623_2984040_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	92.6	6.6e-73
WP_012125612.1|2984002_2984473_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	96.2	1.1e-81
WP_012125613.1|2984472_2984970_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	97.0	3.3e-95
WP_012125614.1|2984969_2988452_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	60.5	4.2e-261
WP_146091190.1|2988521_2989118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104672587.1|2989191_2989896_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	67.0	2.5e-88
WP_012125617.1|2989877_2990471_-	hypothetical protein	NA	F1C5E7	Cronobacter_phage	91.9	5.0e-106
WP_012125618.1|2990452_2991910_-	glycosyltransferase family 2 protein	NA	F1C5E6	Cronobacter_phage	96.5	1.3e-285
WP_012125619.1|2991949_2992444_-	hypothetical protein	NA	F1C5E5	Cronobacter_phage	98.8	5.1e-88
WP_012125621.1|2992467_2992851_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	96.1	2.2e-67
WP_012125622.1|2992847_2993216_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	99.2	1.3e-59
WP_012125623.1|2993217_2993568_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.8	8.1e-40
WP_007847582.1|2993635_2994016_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	100.0	1.9e-63
WP_007847581.1|2994018_2994216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125624.1|2994225_2995311_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	93.9	3.6e-195
WP_012125625.1|2995323_2995752_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	98.6	2.2e-71
WP_012125626.1|2995757_2997158_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	97.6	1.1e-241
WP_012125627.1|2997209_2997557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041460599.1|2997560_2998538_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	94.6	5.4e-158
WP_012125629.1|2998491_2999949_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	95.7	1.1e-260
WP_012125630.1|2999960_3001424_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	99.4	2.9e-280
WP_007706533.1|3001410_3001968_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	98.9	7.2e-99
WP_041460600.1|3001995_3002331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125632.1|3002386_3002587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125633.1|3002638_3002851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125634.1|3002960_3003488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125635.1|3003586_3004291_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	81.8	6.3e-100
WP_041460601.1|3004699_3004996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143711294.1|3005154_3005478_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.4	2.5e-11
WP_165756669.1|3005509_3005998_-	glycoside hydrolase family protein	NA	G0ZNC8	Cronobacter_phage	98.8	2.1e-86
WP_049761357.1|3006012_3006234_-	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	95.8	2.1e-30
WP_041460602.1|3006518_3006710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125643.1|3007581_3008199_-	hypothetical protein	NA	F1C5D0	Cronobacter_phage	97.5	2.8e-112
WP_012125644.1|3008195_3008375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012125645.1|3008371_3008629_-	hypothetical protein	NA	G0ZNC5	Cronobacter_phage	96.4	9.5e-38
WP_094301150.1|3008625_3009240_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	100.0	3.2e-108
WP_041460740.1|3009236_3009530_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	66.0	3.5e-28
WP_012125648.1|3009522_3009699_-	hypothetical protein	NA	Q5G8S2	Enterobacteria_phage	53.4	2.6e-10
WP_012125649.1|3009691_3010012_-	DUF2591 domain-containing protein	NA	E5AGF4	Erwinia_phage	39.0	7.7e-13
WP_012125650.1|3010102_3010324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029464173.1|3010313_3010496_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	62.1	2.2e-12
WP_012125651.1|3010492_3010903_-	recombination protein NinB	NA	K7P6Y3	Enterobacteria_phage	86.7	2.1e-63
WP_140421392.1|3010874_3011135_-	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	64.8	2.5e-22
WP_012125653.1|3011131_3011389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041460742.1|3011526_3011877_-	hypothetical protein	NA	F1C5C6	Cronobacter_phage	88.8	3.7e-53
WP_012125658.1|3012144_3012981_-	DUF551 domain-containing protein	NA	A0A2I6PID9	Escherichia_phage	65.5	1.7e-27
WP_012125659.1|3013204_3014605_-	AAA family ATPase	NA	F1C5C4	Cronobacter_phage	98.7	1.4e-260
WP_012125660.1|3014594_3015491_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	91.3	2.2e-153
WP_012125661.1|3015677_3015956_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	87.8	9.9e-33
WP_041460603.1|3016069_3016285_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	94.4	6.5e-32
WP_012125662.1|3016402_3017065_+	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	93.2	2.6e-119
WP_012125663.1|3017238_3017664_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	88.5	9.2e-38
WP_012125664.1|3017676_3018009_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	77.2	8.8e-36
WP_012125665.1|3018017_3018263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125666.1|3018312_3018567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125667.1|3018610_3018952_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	37.8	6.7e-07
WP_012125668.1|3018952_3019195_+	hypothetical protein	NA	B1GS76	Salmonella_phage	45.0	2.8e-07
WP_012125669.1|3019589_3019721_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	67.4	1.8e-08
WP_012125670.1|3019708_3019855_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	67.4	5.6e-11
WP_012125672.1|3019942_3020128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125673.1|3020135_3020747_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	82.8	6.3e-88
WP_012125674.1|3020746_3021124_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	76.4	1.3e-48
WP_165756512.1|3021288_3021453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007893381.1|3021463_3021625_+	DUF2737 family protein	NA	A0A0K2FIU6	Enterobacter_phage	56.9	2.7e-06
WP_012125676.1|3021621_3022134_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	53.8	1.5e-13
WP_012125677.1|3022133_3022322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125678.1|3022674_3022929_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	42.9	2.4e-09
WP_012125679.1|3022963_3023596_+	hypothetical protein	NA	E5AGD3	Erwinia_phage	36.7	5.8e-28
WP_041460604.1|3023636_3023990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012125681.1|3024216_3025380_+|integrase	phage integrase family protein	integrase	F1C5B2	Cronobacter_phage	99.0	7.0e-229
WP_012125682.1|3025578_3026832_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.1	3.4e-96
3025395:3025440	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_004385346.1|3026842_3027946_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.3	1.4e-58
WP_004385347.1|3028237_3029308_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.1	3.9e-109
>prophage 1
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	0	13279	131196	protease	Bacillus_phage(100.0%)	14	NA	NA
WP_041460762.1|956_1574_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011998922.1|1672_2440_+	membrane protein	NA	NA	NA	NA	NA
WP_041460763.1|2563_3622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998924.1|3626_4157_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011998925.1|4453_5662_+	MFS transporter	NA	NA	NA	NA	NA
WP_032989735.1|5977_6916_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_011998928.1|7164_7707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998929.1|7703_8243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998930.1|8275_8971_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011998931.1|9027_9411_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_011998932.1|9464_10355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011998933.1|10516_11287_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_007854387.1|11411_12104_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	1.2e-26
WP_011998934.1|12100_13279_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.4	3.8e-17
>prophage 2
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	20987	22295	131196		Burkholderia_virus(100.0%)	1	NA	NA
WP_011998941.1|20987_22295_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	6.1e-64
>prophage 3
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	29228	39848	131196		Enterobacteria_phage(20.0%)	12	NA	NA
WP_007873161.1|29228_29972_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	48.2	1.1e-46
WP_011998950.1|30050_31961_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	1.3e-14
WP_041460766.1|32393_32780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761377.1|32817_33357_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011998954.1|33434_33758_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011998955.1|33750_34149_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_011998956.1|34121_34847_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007798787.1|34928_35750_+	alpha/beta hydrolase	NA	A0A220NRX7	Mycobacterium_phage	29.3	3.6e-14
WP_011998957.1|35796_37173_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_041460768.1|37452_38652_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	28.4	4.4e-37
WP_041460769.1|38639_39359_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007780690.1|39554_39848_-	NINE protein	NA	M4ZS56	Bacillus_phage	68.8	3.6e-17
>prophage 4
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	47150	52621	131196		uncultured_Caudovirales_phage(75.0%)	6	NA	NA
WP_011998969.1|47150_47564_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.1	5.2e-46
WP_011998970.1|47608_48892_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	2.5e-171
WP_011998971.1|48979_49315_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.9	2.0e-24
WP_011998972.1|49404_50292_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_041460774.1|50316_51195_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011998974.1|51286_52621_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.2	3.4e-14
>prophage 5
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	59752	66615	131196		Cronobacter_phage(50.0%)	3	NA	NA
WP_041460775.1|59752_62413_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	6.7e-94
WP_094301165.1|62988_63420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071818053.1|63705_66615_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	43.5	7.3e-09
>prophage 6
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	74942	75701	131196		Indivirus(100.0%)	1	NA	NA
WP_011998998.1|74942_75701_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.4	4.4e-14
>prophage 7
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	80517	81492	131196	integrase	Gordonia_phage(100.0%)	1	76360:76373	81685:81698
76360:76373	attL	TGCCGATGCCGAGT	NA	NA	NA	NA
WP_041460791.1|80517_81492_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	37.3	4.0e-12
WP_041460791.1|80517_81492_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	37.3	4.0e-12
81685:81698	attR	ACTCGGCATCGGCA	NA	NA	NA	NA
>prophage 8
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	89637	91296	131196		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_029039502.1|89637_91296_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.9	1.1e-09
>prophage 9
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	95570	97517	131196		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_041460781.1|95570_97517_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.1e-13
>prophage 10
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	100682	103397	131196		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_011999014.1|100682_103397_-	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	24.6	2.1e-34
>prophage 11
NC_009780	Cronobacter sakazakii ATCC BAA-894 plasmid pESA3, complete sequence	131196	127746	129922	131196		Escherichia_phage(100.0%)	2	NA	NA
WP_011999030.1|127746_128715_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	56.9	1.4e-89
WP_007780816.1|128722_129922_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	78.0	6.8e-179
