The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	19946	83269	6588339	tRNA,holin,transposase,integrase	Synechococcus_phage(20.0%)	57	28073:28087	83517:83531
WP_041025264.1|19946_20891_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011979050.1|20943_21450_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.0	1.5e-18
WP_011979051.1|21588_22614_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011979052.1|22748_23837_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.0	4.3e-23
WP_011979053.1|23876_24434_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011979054.1|24444_25422_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_011979055.1|25613_26531_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_003156232.1|26588_27413_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011979056.1|27524_28511_+	phospholipase	NA	NA	NA	NA	NA
28073:28087	attL	CCAGACCGCCGCCTT	NA	NA	NA	NA
WP_011979057.1|28491_29778_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011979058.1|29774_30377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979059.1|30380_31934_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.1	9.2e-19
WP_011979060.1|31938_32862_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003157288.1|32879_34391_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_011979061.1|34519_35419_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011979062.1|35429_35807_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_011979063.1|35785_36151_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_003111192.1|36158_36782_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003157285.1|36966_37773_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011979064.1|37769_38978_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_034080798.1|39081_39969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003157334.1|40070_40286_+	dodecin family protein	NA	NA	NA	NA	NA
WP_011979066.1|40397_40625_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_011979067.1|40917_42606_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_187152829.1|53223_53757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979071.1|53971_54355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809540.1|54862_55075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041025265.1|55568_56261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071535402.1|56383_56701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154008.1|57147_58401_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_011979072.1|58883_59570_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_011979073.1|59600_59954_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003154014.1|59950_60616_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003154016.1|60630_61047_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171941870.1|61422_62937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011979075.1|63618_64047_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011979076.1|64299_64848_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.0	1.8e-33
WP_011979077.1|64886_65393_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_011979078.1|65458_66379_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011979079.1|66486_67374_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011979080.1|67436_68138_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|68221_68677_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003157864.1|68787_69021_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003157863.1|69033_69471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003157862.1|69527_69944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049792063.1|70035_71163_+	aminopeptidase	NA	NA	NA	NA	NA
WP_011979082.1|71172_72159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011979083.1|72191_72857_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011979084.1|72849_73392_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011979085.1|73469_75515_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	1.7e-33
WP_011979086.1|75511_75787_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003152715.1|75875_76139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979087.1|76185_78540_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003152713.1|78536_80639_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023083569.1|80631_81576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123789211.1|81629_81959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169311241.1|81988_83269_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
83517:83531	attR	CCAGACCGCCGCCTT	NA	NA	NA	NA
>prophage 2
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	98023	139866	6588339	transposase,integrase	Erysipelothrix_phage(25.0%)	49	94211:94238	137376:137403
94211:94238	attL	GTGTTGGCGCTGATGGAAAATTGACCCA	NA	NA	NA	NA
WP_011914409.1|98023_100189_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079262147.1|100185_101205_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_008567175.1|101757_102174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008567178.1|102192_103875_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	5.3e-36
WP_008567179.1|103907_104342_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_008567180.1|104354_104630_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_008567181.1|104643_104994_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_008567182.1|105065_105476_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_008567186.1|106039_106393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019486123.1|106464_107547_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041025267.1|108298_109885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794485.1|109925_111083_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011979105.1|111180_111309_-	ultraviolet light resistance protein B	NA	A0A218MNF2	uncultured_virus	75.8	6.0e-09
WP_034065824.1|111308_111740_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	44.7	1.5e-24
WP_003131969.1|111875_112310_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|112381_112732_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|112744_113020_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003158917.1|113091_114777_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	2.1e-40
WP_000995360.1|114794_115160_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|115156_115393_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_011979107.1|115389_116391_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003150544.1|116394_117324_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089107.1|117525_117765_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003150546.1|117764_118175_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003299771.1|118178_121172_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089113.1|121184_121397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|121404_121680_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089115.1|121692_122043_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|122117_122516_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003464995.1|122818_123664_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|123693_124212_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004423958.1|124954_126226_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005005993.1|126587_126962_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464988.1|127822_128089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464986.1|128258_128540_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|128607_128880_-	glutaredoxin 3	NA	A0A1X7BZ88	Faustovirus	42.6	1.3e-08
WP_002118292.1|129333_130080_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_003464980.1|130072_130675_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_003464979.1|131142_131613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003464978.1|131938_132232_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_005006001.1|132290_132722_-	heme-binding protein	NA	NA	NA	NA	NA
WP_002118279.1|132794_133808_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016487060.1|133883_134051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011979111.1|134255_135224_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_003464969.1|135220_135925_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003464967.1|136065_136605_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464965.1|136606_137050_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011911830.1|137570_138374_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
137376:137403	attR	GTGTTGGCGCTGATGGAAAATTGACCCA	NA	NA	NA	NA
WP_116826081.1|138366_139866_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	686459	806560	6588339	plate,head,holin,terminase,tail,portal,lysis,capsid,tRNA	Pseudomonas_phage(57.89%)	129	NA	NA
WP_012074122.1|686459_687581_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	26.7	3.7e-09
WP_012074123.1|687842_687992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128571712.1|688551_689319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012074125.1|689347_690319_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	92.0	3.7e-167
WP_012074126.1|690303_691002_-	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	37.8	1.9e-40
WP_012074127.1|691001_691541_-	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	100.0	8.0e-95
WP_012074128.1|691537_692458_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	34.5	1.3e-17
WP_012074129.1|692454_693165_-	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	100.0	4.7e-135
WP_012074130.1|693178_695143_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	99.8	0.0e+00
WP_012074131.1|695154_695679_-|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	100.0	5.7e-98
WP_012074132.1|695671_696844_-|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	100.0	1.5e-223
WP_012074133.1|696840_697161_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	100.0	4.2e-51
WP_012074134.1|697157_699212_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	100.0	0.0e+00
WP_012074135.1|699226_699367_-	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	100.0	2.2e-20
WP_012074136.1|699390_699678_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	100.0	2.0e-44
WP_012074137.1|699674_700160_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	100.0	4.2e-79
WP_012074138.1|700156_700618_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	100.0	1.4e-79
WP_025297585.1|700614_700920_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	40.4	7.6e-10
WP_012074140.1|700919_701129_-	TraR/DksA family transcriptional regulator	NA	A0A0U4IIN4	Pseudomonas_phage	100.0	5.2e-34
WP_029771257.1|701128_701560_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	100.0	1.9e-75
WP_012074142.1|701581_702697_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	100.0	5.0e-208
WP_012074143.1|702708_703374_-	virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	100.0	2.7e-121
WP_012074144.1|703366_703804_-|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	100.0	8.5e-79
WP_012074145.1|703805_704267_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	96.7	2.0e-78
WP_012074146.1|704364_705102_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	90.2	4.1e-118
WP_012074147.1|705098_706121_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
WP_034019549.1|706120_707074_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	99.7	6.0e-146
WP_012074149.1|707231_709280_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	99.4	0.0e+00
WP_034019547.1|709191_710046_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	97.4	7.8e-129
WP_023122741.1|710091_710352_+	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	47.6	2.1e-13
WP_012074151.1|710327_710537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012074152.1|710895_711177_-	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	75.3	1.7e-32
WP_012074153.1|711173_711404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012074154.1|711400_711616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034019545.1|711602_712016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012074155.1|712083_712440_-	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	56.4	6.3e-32
WP_012074156.1|712455_712857_-	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	72.9	3.4e-50
WP_012074157.1|712828_713029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012074158.1|713459_716153_-	toprim domain-containing protein	NA	A0A0U3TH43	Pseudomonas_phage	56.1	4.0e-304
WP_012074159.1|716163_716406_-	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	56.2	4.0e-14
WP_012074160.1|716499_716736_+	helix-turn-helix transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	57.7	1.0e-17
WP_012074162.1|717960_721698_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	1.6e-13
WP_012074163.1|721804_723658_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_012074165.1|723737_725729_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.0	3.2e-72
WP_003085042.1|725811_726261_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|726328_726544_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012074166.1|726744_727770_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.8e-108
WP_012074167.1|727848_728418_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003149641.1|728501_728855_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003149639.1|728845_729388_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012074168.1|729360_730593_-	multifunctional CCA addition/repair protein	NA	A0A1V0E714	Klebsiella_phage	43.0	5.3e-78
WP_012074169.1|730635_731142_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_012074170.1|731236_732790_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_012074171.1|732786_734058_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_012074172.1|734158_736081_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003149627.1|736361_736694_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_012074174.1|736737_737589_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	30.9	9.6e-10
WP_012074175.1|737588_737969_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_012074176.1|738005_738812_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_012074177.1|738927_739914_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_012074178.1|739910_741203_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003152145.1|741183_743970_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_012074180.1|744096_745113_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012074181.1|745109_745784_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_012074182.1|745785_746544_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012074183.1|746544_747594_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_012074184.1|747745_750145_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_012074185.1|750187_750820_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012074186.1|750948_751983_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012074187.1|752216_753326_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	1.0e-27
WP_012074188.1|753381_754428_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012074189.1|754539_755787_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152154.1|755863_756694_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012074190.1|756817_757492_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_012074191.1|757491_758310_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_012074192.1|758382_759861_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003152158.1|760145_760460_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003152159.1|760560_761331_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.5	3.0e-71
WP_003152160.1|761788_761989_+	TraR/DksA C4-type zinc finger protein	NA	Q9ZXI6	Pseudomonas_virus	48.4	1.0e-07
WP_003152161.1|762034_762394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152162.1|762848_763202_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.7	3.0e-26
WP_003152163.1|763223_763739_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	46.3	6.8e-35
WP_012074193.1|763735_764293_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	54.3	4.1e-46
WP_004366794.1|764444_764771_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	58.3	2.7e-29
WP_004366796.1|764767_765655_+|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	58.0	2.9e-86
WP_004366797.1|765647_766262_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	59.4	9.2e-63
WP_033999491.1|767455_767890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004366801.1|767938_769099_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	78.2	1.7e-174
WP_004366803.1|769111_769615_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	71.6	6.1e-65
WP_004366805.1|769629_769974_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012074196.1|770146_772411_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_012074197.1|772420_773290_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.9	1.2e-76
WP_004366813.1|773264_773471_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	5.6e-17
WP_004366815.1|773528_774524_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	58.2	3.1e-108
WP_012074198.1|774548_775178_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	77.5	3.9e-85
WP_012074199.1|775174_775537_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	45.5	8.7e-13
WP_012074200.1|775533_775791_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	67.1	1.5e-19
WP_012074202.1|776110_776605_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	57.1	1.1e-45
WP_003150143.1|776616_776964_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003150141.1|776993_777248_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	8.3e-10
WP_012074203.1|777294_779133_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	4.4e-28
WP_012074204.1|779125_779467_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.9	5.0e-18
WP_012074205.1|779474_780170_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	5.7e-69
WP_003150138.1|780172_780943_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	56.0	5.0e-82
WP_003117974.1|780997_781600_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	6.5e-53
WP_012074206.1|781658_785324_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	54.0	0.0e+00
WP_126593864.1|785613_786318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150136.1|786572_787622_+	hypothetical protein	NA	A0A1B0YZW2	Pseudomonas_phage	68.2	1.1e-95
WP_041025284.1|787621_787924_+	hypothetical protein	NA	I6PBW9	Pseudomonas_phage	81.0	1.1e-40
WP_012074208.1|787920_788145_+	hypothetical protein	NA	A0A0S3UFY6	Pseudomonas_phage	83.8	2.2e-27
WP_003150133.1|788550_789156_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	1.9e-73
WP_012074210.1|789157_790207_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	2.4e-111
WP_012074211.1|790203_791040_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	5.6e-71
WP_003085219.1|792016_792439_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003150131.1|792758_793553_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_012074213.1|793617_794265_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_012074214.1|794364_794703_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003150128.1|794778_796260_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.9	5.1e-67
WP_012074215.1|796271_797072_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012074216.1|797132_798200_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012074217.1|798321_799290_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003150125.1|799305_799728_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_012074218.1|800017_801052_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003150123.1|801051_801771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074197375.1|801771_802194_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|802271_802622_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_034000208.1|802671_803763_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_079262152.1|803765_805076_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	45.0	1.0e-18
WP_012074222.1|805360_806560_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	1540197	1549220	6588339		Bacillus_phage(33.33%)	8	NA	NA
WP_074197311.1|1540197_1540833_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.7	3.0e-40
WP_023442978.1|1540878_1541772_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_034080333.1|1541872_1542877_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	1.2e-35
WP_003092272.1|1543302_1543626_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003152354.1|1543692_1546260_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_012074710.1|1546385_1547393_-	TolB family protein	NA	NA	NA	NA	NA
WP_003152358.1|1547539_1548046_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	73.4	9.9e-55
WP_003092260.1|1548179_1549220_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 5
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	2408131	2468596	6588339	integrase,terminase,transposase,tail,tRNA	Pseudomonas_phage(70.15%)	79	2407655:2407670	2429455:2429470
2407655:2407670	attL	CCGGGCTTCCAGCTCC	NA	NA	NA	NA
WP_003152610.1|2408131_2409316_+	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.9e-08
WP_003152612.1|2409312_2409795_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_012075288.1|2409878_2410802_-	transaldolase	NA	A0A0E3FGE1	Synechococcus_phage	29.1	3.2e-11
WP_012075289.1|2410880_2411885_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012075290.1|2411988_2413095_+|integrase	tyrosine-type recombinase/integrase	integrase	L7TP61	Pseudomonas_virus	99.5	1.0e-213
WP_012075291.1|2413104_2413389_-	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	98.9	3.0e-45
WP_025991793.1|2413463_2413850_-	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	100.0	2.1e-65
WP_187152835.1|2413953_2415135_-	hypothetical protein	NA	D6RRR7	Pseudomonas_phage	91.9	5.0e-41
WP_012075296.1|2415232_2415739_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	93.5	7.8e-84
WP_012075297.1|2415735_2416101_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	93.7	1.3e-59
WP_012075298.1|2416097_2416670_-	hypothetical protein	NA	H2BD41	Pseudomonas_phage	92.6	5.1e-100
WP_041025316.1|2416666_2417305_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	81.7	3.4e-92
WP_012075300.1|2417650_2418100_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	97.2	2.6e-75
WP_012075301.1|2418096_2420007_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	98.6	1.3e-296
WP_012075302.1|2420132_2421044_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_012075303.1|2421084_2421942_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	97.2	1.0e-160
WP_012075304.1|2422082_2423828_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	78.3	2.0e-243
WP_012075305.1|2423831_2424596_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.4	2.3e-103
WP_003116739.1|2424607_2424808_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_012075306.1|2424814_2425609_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	56.0	1.4e-74
WP_041025317.1|2425605_2426097_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	45.9	7.9e-33
WP_012075308.1|2426105_2426909_-	PD-(D/E)XK nuclease family protein	NA	H2BD50	Pseudomonas_phage	96.3	2.2e-149
WP_003116743.1|2426916_2427054_-	hypothetical protein	NA	J7I432	Pseudomonas_phage	100.0	8.3e-17
WP_041025318.1|2427050_2427374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075309.1|2427370_2427550_-	hypothetical protein	NA	H2BD52	Pseudomonas_phage	98.3	3.2e-24
WP_003099037.1|2427546_2427768_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_012075310.1|2427751_2427904_-	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	100.0	2.6e-11
WP_012075311.1|2428398_2428770_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	97.6	8.0e-62
WP_012075312.1|2428804_2429017_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	2.0e-33
WP_086008389.1|2429245_2430407_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	7.3e-85
2429455:2429470	attR	GGAGCTGGAAGCCCGG	NA	NA	NA	NA
WP_041025320.1|2431290_2431623_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	89.8	1.1e-46
WP_079262168.1|2432062_2433052_-	hypothetical protein	NA	I6NRL3	Burkholderia_virus	31.2	9.0e-28
WP_012075316.1|2433249_2433900_-	BRCT domain-containing protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.7	1.2e-121
WP_049792076.1|2434033_2434606_-	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	88.3	4.8e-82
WP_003451709.1|2434983_2435202_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_012075318.1|2435233_2435806_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	97.9	1.8e-100
WP_012075319.1|2435808_2436771_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	47.5	1.6e-13
WP_012075320.1|2436898_2437312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075321.1|2437304_2437754_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	97.3	8.1e-77
WP_012075322.1|2437782_2438652_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	90.7	1.1e-151
WP_012075324.1|2439639_2439948_+	hypothetical protein	NA	A0A125RNL3	Pseudomonas_phage	55.0	1.0e-17
WP_012075325.1|2439950_2440247_+	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	58.4	7.1e-21
WP_138009451.1|2440318_2440894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075326.1|2441017_2441617_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	57.1	2.4e-44
WP_041025321.1|2441600_2442896_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.0	1.1e-145
WP_003451684.1|2442898_2444254_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	46.0	4.3e-97
WP_012075329.1|2444250_2445330_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.3	5.7e-201
WP_003103389.1|2445458_2446202_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_012075331.1|2446211_2447183_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	5.4e-110
WP_012075332.1|2447223_2447709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075333.1|2447692_2448157_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	5.2e-10
WP_041025322.1|2448156_2448546_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	54.3	1.4e-32
WP_012075335.1|2448549_2449224_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.0	1.0e-115
WP_012075336.1|2449220_2449631_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	1.9e-24
WP_012075337.1|2449698_2450352_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	7.7e-60
WP_003103406.1|2450361_2450742_+|tail	phage tail assembly chaperone	tail	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
WP_012075338.1|2450804_2451068_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	1.4e-15
WP_012075339.1|2451064_2454256_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.2	4.3e-156
WP_012075340.1|2454261_2454600_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	99.1	3.1e-60
WP_012075341.1|2454596_2455346_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	6.2e-146
WP_012075342.1|2455348_2456143_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	98.0	5.9e-147
WP_041025323.1|2456546_2456861_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012075345.1|2456957_2457104_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_138009469.1|2457177_2458044_+	phage antirepressor N-terminal domain-containing protein	NA	G9L6D8	Escherichia_phage	42.9	3.5e-36
WP_071536558.1|2458191_2458596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041025324.1|2458646_2459258_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	81.8	2.2e-85
WP_138009452.1|2459254_2459779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075348.1|2459903_2463470_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	86.8	0.0e+00
WP_004349473.1|2463466_2463751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071536557.1|2463747_2464413_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	44.4	5.8e-55
WP_041025325.1|2464431_2465223_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	95.4	8.0e-136
WP_012075349.1|2465222_2465525_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	99.0	5.7e-50
WP_012075350.1|2465521_2465749_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	94.7	6.8e-32
WP_012075351.1|2465815_2466445_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	92.8	5.6e-108
WP_012075352.1|2466441_2466810_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	62.3	2.1e-30
WP_041025326.1|2466806_2467070_+	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	86.0	5.0e-34
WP_012075354.1|2467105_2467369_+	hypothetical protein	NA	J7I447	Pseudomonas_phage	92.0	5.0e-42
WP_012075355.1|2467350_2468043_-	SOS response-associated peptidase family protein	NA	A0A2K8I970	Pseudomonas_phage	90.0	4.9e-121
WP_012075356.1|2468083_2468596_-	hypothetical protein	NA	A0A0U1VYP0	Pseudomonas_phage	88.2	1.0e-83
>prophage 6
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	2619448	2626340	6588339	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_012075461.1|2619448_2620729_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	4.1e-97
WP_012075462.1|2620730_2622128_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012075463.1|2622132_2623107_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012075464.1|2623192_2624176_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	3.2e-142
WP_003153616.1|2624172_2624508_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.9e-38
WP_003153615.1|2624504_2624810_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_012075465.1|2624809_2625169_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	60.8	1.2e-33
WP_012075466.1|2625165_2625561_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	69.8	2.5e-45
WP_003153609.1|2625671_2626340_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	81.6	3.3e-90
>prophage 7
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	2853820	2945706	6588339	protease,transposase,tail	Tupanvirus(27.27%)	52	NA	NA
WP_012075627.1|2853820_2855818_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_012075628.1|2855829_2856849_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_012075629.1|2856845_2857886_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_012075630.1|2858033_2858468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075631.1|2858496_2860479_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.9	1.1e-45
WP_170323393.1|2860565_2861021_+	DUF4946 domain-containing protein	NA	NA	NA	NA	NA
WP_003156891.1|2861173_2861443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003156892.1|2861559_2862474_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012075633.1|2862874_2865049_+	FUSC family protein	NA	NA	NA	NA	NA
WP_012075634.1|2865038_2865248_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_012075635.1|2865244_2866249_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003156704.1|2866292_2866538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075636.1|2866798_2867713_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_012075637.1|2867868_2868882_+	acetyltransferase	NA	NA	NA	NA	NA
WP_003156700.1|2868960_2869524_-	RNA polymerase factor sigma-70	NA	NA	NA	NA	NA
WP_012075638.1|2870157_2870922_+	thioesterase	NA	NA	NA	NA	NA
WP_012075639.1|2871013_2884042_+	pyoverdine non-ribosomal peptide synthase/polyketide synthase PvdL	NA	A0A2K9KZV5	Tupanvirus	23.9	5.6e-93
WP_171941869.1|2884174_2884543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075641.1|2884551_2884743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041025342.1|2885206_2885935_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.3	1.9e-51
WP_003156532.1|2886026_2886539_-	Bro-N domain-containing protein	NA	G8I4Q8	Mycobacterium_phage	31.4	2.0e-07
WP_086008390.1|2887237_2888400_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	2.8e-84
WP_012075645.1|2888737_2888911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075646.1|2889826_2889994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075647.1|2890065_2890986_-	transporter	NA	NA	NA	NA	NA
WP_041025343.1|2891020_2892439_-	OprD family porin	NA	NA	NA	NA	NA
WP_003089647.1|2892517_2893198_-	hydrolase	NA	NA	NA	NA	NA
WP_012075649.1|2893285_2894146_-	pirin family protein	NA	NA	NA	NA	NA
WP_012075650.1|2894246_2895215_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012075651.1|2895218_2896904_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_003155282.1|2897255_2897681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075652.1|2897673_2898993_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012075653.1|2899177_2900587_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.1	5.8e-20
WP_003089636.1|2900664_2900883_+	MbtH family protein	NA	NA	NA	NA	NA
WP_012075654.1|2900883_2901648_+	thioesterase	NA	NA	NA	NA	NA
WP_012075655.1|2901746_2902664_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012075656.1|2902660_2903566_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012075657.1|2903562_2904318_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	3.4e-11
WP_012075658.1|2904314_2905259_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012075659.1|2905291_2905846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075660.1|2905842_2906172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089621.1|2906168_2906708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075661.1|2906704_2907916_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012075663.1|2908233_2920644_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.8	4.0e-96
WP_161440564.1|2920650_2935620_+	non-ribosomal peptide synthase/polyketide synthase	NA	A0A2K9L3I8	Tupanvirus	26.8	1.7e-154
WP_012075665.1|2935668_2936634_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012075666.1|2936734_2939161_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003148545.1|2939333_2940986_-	cyclic peptide export ABC transporter	NA	A0A1V0SD74	Indivirus	29.4	7.1e-09
WP_003148547.1|2941278_2942106_+	pyoverdine synthetase F	NA	NA	NA	NA	NA
WP_012075667.1|2942173_2943025_-	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	41.8	1.4e-40
WP_003148549.1|2943053_2944337_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_012075668.1|2944359_2945706_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
>prophage 8
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	3138805	3176454	6588339	transposase,integrase	Faustovirus(20.0%)	30	3155257:3155272	3173201:3173216
WP_012075806.1|3138805_3140650_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_161440562.1|3140661_3141516_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_071535376.1|3141524_3142682_+	TniQ family protein	NA	NA	NA	NA	NA
WP_012075808.1|3142655_3143531_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012075809.1|3143691_3144792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012075810.1|3144879_3145755_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_171941853.1|3146457_3148311_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_012075812.1|3148300_3149419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075813.1|3149411_3151307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033986780.1|3151312_3152359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535374.1|3152387_3153455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075817.1|3153456_3153969_-	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	38.2	2.0e-15
WP_012075818.1|3154245_3154455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075819.1|3154523_3154925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075820.1|3154921_3155230_+	hypothetical protein	NA	NA	NA	NA	NA
3155257:3155272	attL	GGCCTGGCTGGGACCG	NA	NA	NA	NA
WP_023435641.1|3155317_3155509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012075821.1|3155960_3158651_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012075822.1|3158844_3162537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794183.1|3162732_3163035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794184.1|3163327_3164329_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003111050.1|3164509_3165481_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111049.1|3165510_3166254_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
WP_003111048.1|3166275_3167592_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_012075823.1|3168003_3169413_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111046.1|3169428_3170157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120172.1|3170153_3171059_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003120171.1|3171066_3171531_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003111043.1|3171710_3172073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003111042.1|3172069_3175084_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	1.7e-72
3173201:3173216	attR	GGCCTGGCTGGGACCG	NA	NA	NA	NA
WP_010794468.1|3175227_3176454_-|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
>prophage 9
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	5156125	5241655	6588339	plate,integrase,head,terminase,tail,portal,lysis,capsid,tRNA,protease	Pseudomonas_phage(72.34%)	99	5155456:5155475	5205363:5205382
5155456:5155475	attL	ACCTGATCGACCGCCAACTG	NA	NA	NA	NA
WP_003094153.1|5156125_5156533_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	63.7	1.7e-33
WP_003150418.1|5156544_5157162_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003150420.1|5157246_5158029_-	cytochrome c1	NA	NA	NA	NA	NA
WP_012077202.1|5158028_5159240_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_003100631.1|5159239_5159833_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003150422.1|5160083_5160476_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003150423.1|5160490_5160919_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_012077203.1|5161164_5162202_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_003120905.1|5162232_5163378_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_074197390.1|5163631_5164531_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150429.1|5164643_5165606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150430.1|5165670_5166765_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012077204.1|5166857_5168204_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003150434.1|5168271_5168901_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003094304.1|5169045_5169492_+	YhcB family protein	NA	NA	NA	NA	NA
WP_012077205.1|5169566_5171465_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.2	1.8e-32
WP_003094311.1|5171476_5172394_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_003150436.1|5172737_5173853_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_003150438.1|5173827_5174586_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012077206.1|5174702_5175872_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	28.9	3.2e-08
WP_012077207.1|5175918_5176974_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.3	5.1e-21
WP_012077208.1|5176976_5178299_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_012077209.1|5178425_5179061_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003155078.1|5179077_5180343_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003094334.1|5180365_5180605_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003155080.1|5180721_5181030_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003155083.1|5181026_5181674_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_003094339.1|5181685_5182159_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_003155085.1|5182159_5182957_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_003094343.1|5182956_5183766_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	8.5e-24
WP_170870649.1|5184175_5185156_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	7.6e-35
WP_012077212.1|5185155_5185695_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	51.5	4.5e-29
WP_012077213.1|5185703_5186276_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_012077214.1|5186262_5186790_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_012077215.1|5186789_5187515_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.1e-22
WP_003155095.1|5187741_5189235_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003155096.1|5189312_5189621_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003155098.1|5189634_5190099_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003155100.1|5190100_5190961_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.6	5.9e-07
WP_003155102.1|5190990_5191263_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_012077216.1|5191293_5192409_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	60.2	2.3e-120
WP_012077217.1|5192413_5192650_-	helix-turn-helix domain-containing protein	NA	A0A0U4ISL7	Pseudomonas_phage	57.7	1.7e-17
WP_012077218.1|5192744_5192975_+	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	84.2	2.8e-25
WP_012077219.1|5192985_5195679_+	toprim domain-containing protein	NA	A0A0U3TH43	Pseudomonas_phage	56.0	2.0e-303
WP_012074157.1|5196109_5196310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077220.1|5196281_5196683_+	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	72.2	7.6e-50
WP_012074155.1|5196698_5197055_+	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	56.4	6.3e-32
WP_025297579.1|5197122_5197536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012074154.1|5197522_5197738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012074153.1|5197734_5197965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012074152.1|5197961_5198243_+	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	75.3	1.7e-32
WP_012074151.1|5198601_5198811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023122741.1|5198786_5199047_-	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	47.6	2.1e-13
WP_034019547.1|5199092_5199947_-|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	97.4	7.8e-129
WP_012074149.1|5199858_5201907_-|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	99.4	0.0e+00
WP_034019549.1|5202064_5203018_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	99.7	6.0e-146
WP_012074147.1|5203017_5204040_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
WP_012077221.1|5204036_5204774_+|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	89.7	3.8e-116
WP_012077222.1|5204871_5205333_+|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	97.4	5.2e-79
WP_012077223.1|5205334_5205772_+|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	94.5	2.0e-75
5205363:5205382	attR	ACCTGATCGACCGCCAACTG	NA	NA	NA	NA
WP_012077224.1|5205764_5206430_+	virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	98.2	5.7e-119
WP_012074142.1|5206441_5207557_+	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	100.0	5.0e-208
WP_029771257.1|5207578_5208010_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	100.0	1.9e-75
WP_012074140.1|5208009_5208219_+	TraR/DksA family transcriptional regulator	NA	A0A0U4IIN4	Pseudomonas_phage	100.0	5.2e-34
WP_025297585.1|5208218_5208524_+	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	40.4	7.6e-10
WP_012074138.1|5208520_5208982_+	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	100.0	1.4e-79
WP_012074137.1|5208978_5209464_+|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	100.0	4.2e-79
WP_012074136.1|5209460_5209748_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	100.0	2.0e-44
WP_012074135.1|5209771_5209912_+	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	100.0	2.2e-20
WP_012074134.1|5209926_5211981_+|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	100.0	0.0e+00
WP_012074133.1|5211977_5212298_+	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	100.0	4.2e-51
WP_012074132.1|5212294_5213467_+|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	100.0	1.5e-223
WP_012074131.1|5213459_5213984_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	100.0	5.7e-98
WP_012077225.1|5213995_5215960_+|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	99.7	0.0e+00
WP_012074129.1|5215973_5216684_+	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	100.0	4.7e-135
WP_012074128.1|5216680_5217601_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	34.5	1.3e-17
WP_012077226.1|5217597_5218137_+	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	99.4	2.3e-94
WP_012077227.1|5218136_5218829_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	36.1	1.5e-40
WP_012077228.1|5218813_5219785_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	100.0	1.4e-182
WP_012077229.1|5219827_5220232_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	100.0	4.2e-72
WP_071534354.1|5220259_5220442_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	100.0	3.7e-28
WP_003155104.1|5221149_5222052_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_012077233.1|5222118_5222733_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	4.7e-83
WP_012077234.1|5222745_5223195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077235.1|5223223_5224600_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003155111.1|5224592_5224988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077236.1|5225138_5226488_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_023443259.1|5226508_5227111_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012077237.1|5227141_5228584_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003156636.1|5228586_5229435_-	carbon-nitrogen hydrolase family protein	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.9	7.1e-05
WP_012077239.1|5229484_5233312_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_003156999.1|5233326_5234784_-	ribonuclease G	NA	NA	NA	NA	NA
WP_012077240.1|5234817_5235423_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012077241.1|5235509_5236004_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_071535372.1|5236003_5237038_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003094393.1|5237069_5238107_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003094397.1|5238345_5238633_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_012077243.1|5238648_5240103_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_012077244.1|5240209_5241655_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
>prophage 10
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	5284908	5305684	6588339	head,integrase,transposase,terminase,tail,portal,capsid,protease	uncultured_Caudovirales_phage(20.0%)	23	5295061:5295107	5305947:5305993
WP_086008395.1|5284908_5286128_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	43.6	4.0e-17
WP_012077270.1|5286234_5287398_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012077272.1|5287868_5289890_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.2	2.0e-34
WP_012077273.1|5290078_5290915_-	regulatory signaling modulator protein AmpE	NA	NA	NA	NA	NA
WP_012077274.1|5290911_5291478_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	31.4	6.8e-12
WP_012077275.1|5291627_5293877_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_003152758.1|5294161_5295010_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
5295061:5295107	attL	ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA	NA	NA	NA	NA
WP_012077277.1|5295231_5296446_+|integrase	site-specific integrase	integrase	G8C7K6	Escherichia_phage	32.7	2.5e-27
WP_041025519.1|5296442_5296928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077278.1|5297127_5297328_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012077279.1|5297449_5297698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041025406.1|5297715_5297970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034081339.1|5298093_5298294_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171941867.1|5298386_5298749_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041025407.1|5299010_5299229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077284.1|5299766_5300996_+|capsid	phage major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	36.3	7.3e-43
WP_012077285.1|5300998_5301508_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	46.4	3.4e-31
WP_012077286.1|5301504_5302743_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	38.4	2.3e-65
WP_012077287.1|5302739_5303138_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.4	1.4e-08
WP_041025408.1|5303143_5303608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077289.1|5303604_5305101_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	65.6	1.3e-182
WP_012077290.1|5305097_5305373_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_012077291.1|5305369_5305684_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	31.4	9.6e-08
5305947:5305993	attR	ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA	NA	NA	NA	NA
>prophage 11
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	5455570	5540252	6588339	coat,tRNA,transposase,integrase	Pseudomonas_phage(37.5%)	78	5528485:5528544	5541336:5541417
WP_003149934.1|5455570_5456119_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_023442800.1|5456149_5456683_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049792051.1|5456682_5457225_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003149928.1|5457243_5458032_+	molecular chaperone	NA	NA	NA	NA	NA
WP_012077377.1|5458048_5460421_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012077378.1|5460417_5461365_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_012077379.1|5461366_5462740_-	MFS transporter	NA	NA	NA	NA	NA
WP_003149922.1|5463015_5464038_-	ferrochelatase	NA	NA	NA	NA	NA
WP_012077380.1|5464034_5464952_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_012077381.1|5465359_5466343_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012077382.1|5466494_5467451_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_012077383.1|5467460_5468360_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	33.0	2.5e-16
WP_079262208.1|5468356_5469805_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.4	1.6e-44
WP_003151671.1|5469955_5470477_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	71.1	1.2e-60
WP_003151673.1|5470610_5471408_-	glutamate racemase	NA	NA	NA	NA	NA
WP_041025524.1|5471397_5472156_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_012077386.1|5472149_5472980_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003151675.1|5472981_5474064_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	7.4e-07
WP_012077387.1|5474081_5475350_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_074197235.1|5475494_5477267_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012077389.1|5477271_5477889_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_012077390.1|5477890_5478739_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5478905_5479847_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003151680.1|5479964_5480579_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003151683.1|5480620_5481205_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003151685.1|5481248_5482349_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_012077391.1|5482564_5483752_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.6	2.9e-73
WP_071535395.1|5483738_5484467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033989083.1|5484538_5485117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077394.1|5485154_5486138_+	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	29.8	4.1e-12
WP_012077395.1|5486147_5488637_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_012077396.1|5488675_5489500_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_012077397.1|5489508_5490336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077398.1|5490370_5491540_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012077399.1|5491532_5493596_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_012077400.1|5493592_5494375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077401.1|5494371_5497152_-	lactate dehydrogenase	NA	Q6NE04	Leptospira_phage	33.5	2.5e-115
WP_001389365.1|5497615_5498380_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_049792052.1|5498424_5498871_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	9.0e-60
WP_001138014.1|5498874_5501841_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001082319.1|5503088_5503892_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|5503891_5504728_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_012077403.1|5504837_5505416_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.3	1.8e-36
WP_012077404.1|5505412_5508442_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_000946487.1|5508934_5509786_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_012077405.1|5509887_5510901_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.8	8.0e-72
WP_001389365.1|5511720_5512485_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_041025414.1|5512659_5513070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041025415.1|5513114_5513810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077409.1|5513806_5514202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077410.1|5514426_5515650_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_012077411.1|5516179_5516653_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_116803195.1|5516719_5519536_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_012077413.1|5519541_5519988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077414.1|5520112_5520718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077415.1|5520717_5520957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033976165.1|5521126_5521432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012077417.1|5521655_5522297_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_116803194.1|5523388_5524390_-	TrfA family protein	NA	NA	NA	NA	NA
WP_012077419.1|5524329_5524542_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_079262210.1|5524870_5525920_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_012077421.1|5526000_5526930_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_171941866.1|5527199_5528309_+	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
5528485:5528544	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_041025417.1|5528656_5529076_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041025418.1|5529072_5529318_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_012077425.1|5529343_5530342_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.4	1.3e-77
WP_041025419.1|5530338_5531631_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	91.6	7.4e-240
WP_012077427.1|5531860_5533135_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	87.1	1.3e-199
WP_003114150.1|5533138_5533495_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_049792053.1|5533499_5534858_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	58.0	5.0e-61
WP_012077430.1|5535017_5535266_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	91.5	2.0e-32
WP_003115979.1|5535278_5535530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077431.1|5535651_5536086_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	99.3	8.4e-63
WP_041025529.1|5536624_5536912_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.8	1.8e-53
WP_004352675.1|5536938_5537211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071535397.1|5537831_5538164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138009465.1|5538218_5538884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077433.1|5538920_5540252_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	34.6	1.4e-36
5541336:5541417	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 12
NC_009656	Pseudomonas aeruginosa PA7, complete sequence	6588339	6228704	6265278	6588339	transposase,integrase	Shigella_phage(33.33%)	24	6241288:6241304	6272856:6272872
WP_004352797.1|6228704_6229571_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.3	4.6e-60
WP_012077888.1|6229567_6229861_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086008398.1|6229891_6231045_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.9	1.9e-85
WP_010794468.1|6231218_6232445_+|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
WP_021263740.1|6232482_6235524_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	26.4	1.9e-28
WP_023096322.1|6235524_6237537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077892.1|6237533_6238298_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012077893.1|6238297_6240424_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_012077894.1|6240476_6241553_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
6241288:6241304	attL	TCCAGCGCCTGCGCCAC	NA	NA	NA	NA
WP_012077895.1|6241570_6243214_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012077896.1|6243210_6244680_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.9	7.9e-28
WP_012077897.1|6244682_6245624_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012077898.1|6246040_6248407_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	27.2	1.8e-05
WP_012077900.1|6248799_6249447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025297754.1|6249512_6249800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077903.1|6251514_6252531_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012077904.1|6252589_6254302_+	dynamin family protein	NA	NA	NA	NA	NA
WP_012077905.1|6254315_6256559_+	dynamin family protein	NA	NA	NA	NA	NA
WP_012077906.1|6256555_6258646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160328552.1|6259555_6260371_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_153565776.1|6260444_6260987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169311248.1|6261450_6262605_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_124083333.1|6262820_6263330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794470.1|6263313_6265278_-|integrase	integrase	integrase	NA	NA	NA	NA
6272856:6272872	attR	GTGGCGCAGGCGCTGGA	NA	NA	NA	NA
