The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	1732926	1741138	3995387	protease	uncultured_phage(33.33%)	9	NA	NA
WP_012099656.1|1732926_1733871_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.6	1.4e-14
WP_012099657.1|1734494_1735490_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_012099658.1|1735606_1736368_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_011949100.1|1736385_1736817_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	32.4	4.0e-12
WP_012099659.1|1736818_1737484_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.1	1.0e-38
WP_012099660.1|1737487_1738078_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.8	5.4e-44
WP_012099661.1|1738261_1738921_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.3e-59
WP_012099662.1|1739214_1740033_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012099663.1|1740181_1741138_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	7.7e-16
>prophage 2
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	1966489	2055434	3995387	capsid,terminase,integrase,tail,protease,portal,head	Clostridium_phage(50.0%)	90	1980470:1980486	2056697:2056713
WP_079991858.1|1966489_1966948_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_012099820.1|1966938_1968354_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_012099821.1|1968455_1969328_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012099822.1|1969595_1970297_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_003358857.1|1970716_1970884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099823.1|1971559_1974766_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012099824.1|1974793_1975843_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.6	5.2e-58
WP_003493683.1|1976359_1976527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099827.1|1979977_1980703_-	hypothetical protein	NA	NA	NA	NA	NA
1980470:1980486	attL	AAATTTTTTAGCTATTT	NA	NA	NA	NA
WP_012099829.1|1980895_1981687_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_012099830.1|1982860_1983967_+	hypothetical protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	38.3	6.8e-16
WP_012099831.1|1984093_1985650_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.7e-52
WP_012099832.1|1986011_1987745_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_012099833.1|1987764_1989660_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_012099834.1|1989671_1990151_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_012099835.1|1990637_1991825_-	potassium transporter	NA	NA	NA	NA	NA
WP_012099836.1|1992083_1992962_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	39.5	5.2e-51
WP_003405456.1|1993203_1994298_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012099837.1|1994413_1995550_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.8	8.5e-22
WP_012099838.1|1995733_1996246_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_003402813.1|1996313_1996754_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_003402814.1|1996814_1997396_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	9.1e-20
WP_003402816.1|1997388_1998135_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	3.0e-07
WP_012099839.1|1998109_1998700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099840.1|1998923_2000147_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.4	6.5e-36
WP_012099841.1|2000269_2000992_-	EcsC family protein	NA	NA	NA	NA	NA
WP_012099842.1|2001150_2002209_-	endonuclease	NA	NA	NA	NA	NA
WP_003402834.1|2002350_2002599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099843.1|2002705_2004010_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.1	3.5e-128
WP_012099844.1|2004295_2005111_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	41.9	6.7e-61
WP_012099845.1|2005148_2006024_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.5	3.0e-14
WP_003359007.1|2006075_2006303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099846.1|2006293_2006947_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003362492.1|2007153_2007690_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004451811.1|2008173_2009700_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_012099848.1|2010516_2011272_-	C40 family peptidase	NA	A0A0A7RU71	Clostridium_phage	71.4	1.1e-41
WP_012099849.1|2012413_2012992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099851.1|2014407_2014995_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	32.8	2.5e-09
WP_012099852.1|2015123_2015882_-	SH3 domain-containing protein	NA	I1TJX3	Clostridium_phage	58.7	3.4e-51
WP_012099855.1|2016531_2016726_-	hypothetical protein	NA	A0A0A7RU02	Clostridium_phage	98.4	2.3e-28
WP_012099856.1|2017120_2017288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099857.1|2017328_2017544_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	69.6	7.0e-10
WP_012099858.1|2017545_2017905_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	54.3	4.3e-20
WP_012099859.1|2017920_2018508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099860.1|2018525_2018987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099861.1|2018983_2019805_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	56.1	5.7e-52
WP_012099862.1|2019811_2020969_-	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	36.4	6.3e-65
WP_012099863.1|2020972_2021842_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	42.7	3.7e-49
WP_012099864.1|2021857_2025358_-|tail	phage tail tape measure protein	tail	A0A0A7RVT5	Clostridium_phage	51.5	7.1e-67
WP_012099866.1|2025374_2025554_-	hypothetical protein	NA	A0A0A7RUE3	Clostridium_phage	76.3	2.1e-20
WP_012099867.1|2025613_2025958_-	hypothetical protein	NA	A0A0A7RUF5	Clostridium_phage	69.7	2.8e-37
WP_014519284.1|2026019_2026622_-|tail	tail protein	tail	A0A0A7RUI3	Clostridium_phage	71.1	7.8e-75
WP_012099869.1|2026688_2027045_-	hypothetical protein	NA	A0A0A7S158	Clostridium_phage	83.6	7.9e-51
WP_012099870.1|2027055_2027415_-	hypothetical protein	NA	A0A0A7RUF1	Clostridium_phage	60.5	8.9e-34
WP_012099871.1|2027414_2027783_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	66.7	3.0e-37
WP_012099872.1|2027772_2028066_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	42.4	1.9e-13
WP_012099873.1|2028150_2029383_-|capsid	phage major capsid protein	capsid	Q0SPK4	Clostridium_phage	49.5	3.1e-94
WP_012099874.1|2029434_2030178_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	75.9	8.1e-98
WP_014519285.1|2030170_2031421_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	79.9	2.4e-187
WP_012099876.1|2031464_2031647_-	hypothetical protein	NA	A0A0A7RUH2	Clostridium_phage	70.4	2.2e-12
WP_012099877.1|2031670_2033428_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	43.2	3.1e-119
WP_012099878.1|2033428_2033914_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	41.4	1.5e-20
WP_012099879.1|2034061_2034529_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	44.7	1.7e-24
WP_012099880.1|2034621_2036415_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_012099881.1|2036401_2036653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099882.1|2036633_2037227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099883.1|2037248_2037446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099884.1|2037475_2037721_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	45.7	2.3e-09
WP_012099885.1|2037845_2038028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099886.1|2038078_2038291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099887.1|2038375_2038687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099888.1|2038716_2038905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099889.1|2038905_2039160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099890.1|2039234_2039789_-	nuclease	NA	NA	NA	NA	NA
WP_012099891.1|2040037_2040484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099892.1|2040534_2041212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099895.1|2045131_2046268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099896.1|2046313_2047255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099897.1|2047300_2048053_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012099898.1|2048133_2048553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099900.1|2049224_2049890_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099902.1|2050173_2050503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099904.1|2050753_2051083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099905.1|2051233_2051563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099906.1|2051850_2052336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099907.1|2052426_2052789_-	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	61.9	4.9e-32
WP_012099908.1|2052814_2053495_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012099909.1|2053491_2053677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099910.1|2053941_2054442_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012099911.1|2054441_2055434_-|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	22.0	2.7e-08
2056697:2056713	attR	AAATTTTTTAGCTATTT	NA	NA	NA	NA
>prophage 3
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	2528316	2571561	3995387	plate,tail,terminase,portal	Clostridium_phage(70.83%)	57	NA	NA
WP_012100293.1|2528316_2528559_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	50.0	1.2e-13
WP_012100295.1|2528976_2529378_-	resolvase	NA	A0A2H4J078	uncultured_Caudovirales_phage	51.6	9.3e-24
WP_012100296.1|2529422_2529668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100297.1|2529673_2529865_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	82.5	1.2e-16
WP_012100298.1|2530293_2531061_-	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	64.3	8.7e-87
WP_041173229.1|2531105_2531300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100300.1|2531337_2531592_-	membrane protein	NA	NA	NA	NA	NA
WP_012100301.1|2531612_2532368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100302.1|2532529_2532712_-	hypothetical protein	NA	A0A0K2SUB6	Clostridium_phage	69.1	2.0e-13
WP_012100303.1|2532713_2533055_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	64.0	9.3e-33
WP_012100304.1|2533066_2534248_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	61.0	8.2e-68
WP_012100305.1|2534251_2534878_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	75.6	2.4e-87
WP_012100306.1|2534858_2535953_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.4	1.2e-158
WP_012100307.1|2535953_2536361_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	76.9	7.0e-51
WP_012100308.1|2536363_2536708_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	71.1	2.8e-37
WP_012100309.1|2536710_2537685_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.0	1.1e-155
WP_012100311.1|2537700_2538378_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	76.8	1.7e-94
WP_012100312.1|2538377_2540537_-	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	46.8	7.0e-134
WP_012100313.1|2540594_2541356_-	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	42.4	2.2e-42
WP_012100314.1|2541592_2542006_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	76.3	1.4e-54
WP_012100315.1|2542023_2542488_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	74.7	7.6e-62
WP_012100316.1|2542491_2543802_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	84.6	1.0e-212
WP_079992187.1|2543963_2544437_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	75.4	4.7e-51
WP_012100320.1|2544581_2545073_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	76.5	3.3e-63
WP_012100321.1|2545072_2545456_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	82.7	6.3e-54
WP_012100322.1|2545457_2545802_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	77.2	5.3e-44
WP_012100323.1|2545815_2546781_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	77.9	2.4e-142
WP_012100324.1|2546800_2547406_-	scaffold protein	NA	A0A0A7RW68	Clostridium_phage	40.8	4.2e-20
WP_012100325.1|2547426_2547690_-	hypothetical protein	NA	A0A0K2FMK5	Brevibacillus_phage	54.8	8.2e-21
WP_012100326.1|2547706_2548075_-	hypothetical protein	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	63.9	8.2e-35
WP_012100327.1|2548105_2548300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100328.1|2548316_2549348_-	primosomal protein	NA	A0A0A7RVY7	Clostridium_phage	76.7	8.2e-149
WP_012100329.1|2549328_2550780_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	87.9	6.2e-235
WP_012100330.1|2550792_2552202_-|terminase	phage terminase large subunit	terminase	A0A0A7RTS1	Clostridium_phage	87.4	1.4e-212
WP_012100331.1|2552194_2552782_-|terminase	terminase small subunit	terminase	A0A0A0RSW5	Bacillus_phage	40.2	7.2e-25
WP_012100332.1|2553004_2553556_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	29.9	2.1e-13
WP_012100333.1|2553542_2553920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100334.1|2553928_2555293_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.0	3.3e-161
WP_012100336.1|2555455_2555737_-	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	78.3	1.2e-20
WP_012100338.1|2555997_2558421_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	88.2	0.0e+00
WP_012100339.1|2558467_2559493_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	32.6	1.1e-44
WP_012100340.1|2559536_2559821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100341.1|2559859_2560090_-	hypothetical protein	NA	A0A2D1GQA7	Lysinibacillus_phage	51.5	1.2e-10
WP_012100342.1|2560138_2561569_-	DNA methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	46.1	5.9e-113
WP_050760349.1|2561610_2563575_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	89.9	0.0e+00
WP_012100344.1|2563607_2563787_-	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	53.8	1.1e-11
WP_012100345.1|2563817_2563988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154018680.1|2564069_2564690_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	83.9	1.3e-88
WP_012100347.1|2564701_2565847_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.7	9.0e-197
WP_012100349.1|2566010_2566457_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	47.5	2.6e-06
WP_012100350.1|2566502_2566757_-	hypothetical protein	NA	A0A0A7RTF9	Clostridium_phage	68.6	2.4e-25
WP_012100351.1|2566756_2567008_-	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	70.0	1.5e-27
WP_012100352.1|2567071_2567623_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0A0RUJ6	Bacillus_phage	28.7	3.0e-12
WP_012100354.1|2567982_2568834_-	ORF6N domain-containing protein	NA	X5JAW6	Clostridium_phage	51.5	1.0e-67
WP_012100356.1|2569126_2569330_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100357.1|2569621_2569999_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J076	uncultured_Caudovirales_phage	50.8	3.4e-20
WP_012100358.1|2570010_2571561_+	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	35.4	2.2e-73
>prophage 4
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	3093138	3102740	3995387		Synechococcus_phage(28.57%)	8	NA	NA
WP_012100665.1|3093138_3094638_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	47.5	1.2e-68
WP_012100666.1|3094851_3095469_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.4e-25
WP_012100667.1|3095596_3096592_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.1	7.6e-67
WP_012100668.1|3096763_3098212_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_012100669.1|3098303_3099008_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.7	3.0e-41
WP_012100670.1|3099007_3099487_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	3.7e-27
WP_041173178.1|3100014_3100149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079992192.1|3100169_3102740_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	33.1	5.8e-10
>prophage 5
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	3253807	3275408	3995387		Clostridium_phage(85.71%)	27	NA	NA
WP_012100764.1|3253807_3254893_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	69.8	1.5e-140
WP_012100765.1|3254904_3255903_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	71.4	7.5e-139
WP_003360052.1|3255914_3256169_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_012100766.1|3256174_3258070_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	51.5	4.6e-113
WP_012100767.1|3258084_3259338_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	78.9	1.1e-192
WP_012100768.1|3259360_3260329_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.5	3.0e-108
WP_012100769.1|3260330_3261680_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.1	2.3e-74
WP_012100770.1|3261694_3262036_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	57.1	7.2e-17
WP_012100771.1|3262048_3263134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100772.1|3263120_3263555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100773.1|3263567_3264971_-	membrane protein	NA	A0A0A7RU22	Clostridium_phage	42.0	7.8e-33
WP_012100774.1|3265046_3265214_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	68.5	4.3e-15
WP_012100775.1|3265248_3265665_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	68.2	1.7e-44
WP_012100776.1|3265679_3266567_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.7	2.6e-119
WP_003403551.1|3266571_3266991_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	72.7	6.0e-58
WP_012100777.1|3266996_3267344_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	58.0	4.7e-32
WP_012100778.1|3267348_3267714_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.0	2.2e-32
WP_012100779.1|3267713_3267998_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	2.3e-24
WP_012100780.1|3268501_3269023_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	1.4e-35
WP_003483819.1|3269136_3269457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046665300.1|3269513_3270362_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.8	4.0e-32
WP_012100782.1|3270303_3271209_-	hypothetical protein	NA	A8ASN4	Listeria_phage	38.7	9.4e-40
WP_072570747.1|3271302_3271536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100783.1|3271576_3271786_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|3271977_3272388_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003403583.1|3272689_3272839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100784.1|3273920_3275408_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.8	6.2e-65
>prophage 6
NC_009699	Clostridium botulinum F str. Langeland, complete genome	3995387	3380306	3465762	3995387	capsid,terminase,integrase,tail,protease,bacteriocin,tRNA,portal,head,holin	Clostridium_phage(51.22%)	94	3417909:3417928	3453160:3453179
WP_012100841.1|3380306_3382214_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.0	1.1e-138
WP_012100842.1|3382561_3383461_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_012100843.1|3383615_3384323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100844.1|3384513_3386085_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012100845.1|3386086_3386782_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	8.6e-25
WP_003405920.1|3387559_3388450_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003405923.1|3388487_3389228_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003361573.1|3389313_3389586_-	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_012100846.1|3389885_3390845_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	35.2	2.2e-10
WP_012100847.1|3390844_3391864_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.2e-16
WP_012100848.1|3391877_3392795_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003405928.1|3392810_3393740_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012100850.1|3393820_3395503_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003357473.1|3395986_3396979_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012100852.1|3397001_3397880_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_012100853.1|3398102_3398858_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012100854.1|3399397_3400567_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012100855.1|3400824_3401535_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003357563.1|3401650_3402352_-	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	50.2	6.0e-50
WP_012100856.1|3402429_3402927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100857.1|3403125_3403878_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
WP_012100858.1|3404041_3404569_+	DUF4364 family protein	NA	NA	NA	NA	NA
WP_003357551.1|3404571_3405456_-	YncE family protein	NA	NA	NA	NA	NA
WP_003357396.1|3405595_3405856_+	TIGR03905 family TSCPD domain-containing protein	NA	NA	NA	NA	NA
WP_012100859.1|3405864_3407154_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012100860.1|3407729_3410375_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.3	4.8e-177
WP_012100861.1|3410395_3410902_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012100862.1|3411488_3412733_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_003405994.1|3412732_3413017_-	peptide maturation system acyl carrier-related protein	NA	NA	NA	NA	NA
WP_012100864.1|3413797_3414913_-	TIGR04066 family peptide maturation system protein	NA	NA	NA	NA	NA
WP_012100865.1|3414953_3416360_-	Cys-rich peptide radical SAM maturase CcpM	NA	NA	NA	NA	NA
WP_003405999.1|3416449_3416647_-|bacteriocin	CLI_3235 family bacteriocin precursor	bacteriocin	NA	NA	NA	NA
WP_012100866.1|3416767_3418564_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	6.4e-40
3417909:3417928	attL	TATTTCTCATAATTTTTTTT	NA	NA	NA	NA
WP_003406003.1|3419184_3419841_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.1	4.6e-12
WP_012100867.1|3419856_3422454_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012100868.1|3422887_3423133_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012100870.1|3423622_3423859_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUG5	Clostridium_phage	67.9	3.9e-22
WP_012100871.1|3423930_3424212_+	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	88.0	6.1e-38
WP_012100872.1|3424232_3424706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100873.1|3424782_3424932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100874.1|3424909_3425818_-	recombinase	NA	NA	NA	NA	NA
WP_012100875.1|3425808_3427434_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_003399447.1|3427868_3428069_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012100876.1|3428308_3428710_-	recombinase family protein	NA	A0A2H4J078	uncultured_Caudovirales_phage	57.0	7.4e-29
WP_012100877.1|3428755_3429001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100878.1|3429013_3429196_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	86.0	7.7e-18
WP_012100879.1|3429816_3430554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100880.1|3430706_3431609_-	SH3 domain-containing protein	NA	A0A0A7RVQ3	Clostridium_phage	54.7	3.4e-42
WP_012100881.1|3431748_3432165_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	56.6	1.2e-34
WP_012100882.1|3432261_3432384_-	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	62.5	6.9e-07
WP_012100883.1|3432376_3432772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100884.1|3432785_3434450_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	53.0	4.7e-77
WP_079992194.1|3434456_3435476_-	hypothetical protein	NA	E2ELJ7	Clostridium_phage	59.4	2.4e-116
WP_012100886.1|3435527_3436397_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	69.7	2.9e-110
WP_012100887.1|3436413_3441894_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	50.9	9.9e-92
WP_012100890.1|3442162_3442450_-	hypothetical protein	NA	E2ELJ2	Clostridium_phage	48.4	1.5e-15
WP_012100891.1|3442485_3443067_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	59.6	6.9e-60
WP_154018643.1|3443173_3443416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012100893.1|3443410_3443794_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	51.4	1.4e-29
WP_012100894.1|3443786_3444113_-|head	phage head closure protein	head	E2ELI7	Clostridium_phage	33.3	3.5e-05
WP_012100895.1|3444093_3444423_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	33.0	6.1e-05
WP_012100896.1|3444439_3444595_-	termination factor Rho	NA	NA	NA	NA	NA
WP_012100897.1|3444614_3445742_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	62.1	3.6e-121
WP_012100898.1|3445734_3446535_-|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	67.6	1.7e-88
WP_012100899.1|3446570_3447764_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	38.6	2.8e-68
WP_012100900.1|3447779_3449477_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	60.9	6.4e-199
WP_041173254.1|3449473_3449938_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	61.9	6.7e-50
WP_012100902.1|3450204_3450678_-	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	37.8	4.6e-14
WP_012100903.1|3450677_3450971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100904.1|3451004_3451346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100905.1|3451383_3451659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100906.1|3451812_3452358_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	60.7	2.5e-56
WP_012100907.1|3452359_3452593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100908.1|3452801_3453188_-	nitroreductase	NA	A0A0A7RTL7	Clostridium_phage	70.9	2.0e-47
3453160:3453179	attR	TATTTCTCATAATTTTTTTT	NA	NA	NA	NA
WP_012100912.1|3453754_3454804_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	29.7	3.9e-37
WP_012100915.1|3455225_3455411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100916.1|3455448_3455721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100917.1|3455754_3455976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100918.1|3456011_3456374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100919.1|3456406_3457423_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0A8WIK9	Clostridium_phage	52.9	1.0e-103
WP_012100920.1|3457451_3457910_-	methyltransferase	NA	A0A0E3Y6D6	Fusobacterium_phage	73.3	5.1e-66
WP_012100921.1|3457955_3458699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100922.1|3458735_3459023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100923.1|3459013_3459529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100924.1|3459531_3460074_-	hypothetical protein	NA	A0A2K9V2Y3	Faecalibacterium_phage	28.6	1.1e-08
WP_012100925.1|3460074_3460911_-	hypothetical protein	NA	A0A1S5SFJ6	Streptococcus_phage	63.5	8.1e-46
WP_012100926.1|3461020_3461242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100927.1|3461257_3461440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100928.1|3461503_3461710_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	52.2	1.3e-10
WP_012100929.1|3461753_3462008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012100930.1|3462019_3462778_-	hypothetical protein	NA	A0A288WG93	Bacillus_phage	45.9	1.1e-52
WP_012100933.1|3463110_3463344_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012100934.1|3463553_3463919_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	48.6	1.3e-08
WP_012100936.1|3464124_3465762_+	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	42.4	1.0e-105
