The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	539300	548714	3863450		Bacillus_phage(33.33%)	7	NA	NA
WP_011948233.1|539300_541529_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	1.7e-106
WP_011986136.1|542176_542386_+	recombinase RecT	NA	H7BUU1	unidentified_phage	63.5	1.6e-14
WP_003356906.1|543266_543614_+	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	60.5	1.7e-29
WP_011948235.1|543632_543782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011948236.1|544299_545109_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	40.6	3.0e-45
WP_011948237.1|546065_547442_+	PhoH family protein	NA	A0A141HS37	Bacillus_phage	44.3	3.0e-106
WP_011948238.1|547709_548714_+	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	30.7	4.3e-09
>prophage 2
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	874207	885926	3863450		Clostridium_botulinum_D_phage(50.0%)	6	NA	NA
WP_011948507.1|874207_876088_-	botulinum neurotoxin hemagglutinin HA70 subunit	NA	Q786X9	Clostridium_botulinum_D_phage	68.5	1.3e-240
WP_003356711.1|876101_876542_-	hemagglutinin	NA	Q786Y1	Clostridium_botulinum_D_phage	63.0	1.9e-46
WP_011948508.1|876604_877486_-	ricin-type beta-trefoil lectin domain protein	NA	Q38196	Clostridium_botulinum_phage	36.7	3.5e-39
WP_011948509.1|877712_878249_+	botulinum neurotoxin transcription-activating sigma factor BotR	NA	Q9ZWV5	Clostridium_botulinum_D_phage	52.2	2.1e-39
WP_011948510.1|878410_881992_+	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	66.2	0.0e+00
WP_011948511.1|882035_885926_+	botulinum neurotoxin type A	NA	Q332E0	Clostridium_botulinum_C_phage	32.5	5.8e-179
>prophage 3
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	1654792	1661858	3863450		uncultured_phage(33.33%)	8	NA	NA
WP_011949098.1|1654792_1655737_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.6	4.2e-14
WP_011949099.1|1656360_1657356_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358645.1|1657472_1658234_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_011949100.1|1658251_1658683_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	32.4	4.0e-12
WP_011949101.1|1658684_1659350_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.1	1.7e-38
WP_004451708.1|1659353_1659944_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.8	7.0e-44
WP_011949102.1|1660127_1660787_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	3.0e-59
WP_011986260.1|1660901_1661858_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	7.7e-16
>prophage 4
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	2557333	2615948	3863450	tail,capsid,protease,portal,head,terminase,tRNA,integrase	Clostridium_phage(39.47%)	74	2560421:2560437	2583740:2583756
WP_011986868.1|2557333_2558038_-	N-acetylmuramoyl-L-alanine amidase	NA	M9Q1I7	Clostridium_phage	45.5	2.7e-42
WP_003356211.1|2558077_2558272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986869.1|2558285_2558540_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	70.9	6.3e-26
WP_011986870.1|2558618_2559494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986871.1|2559645_2559819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986872.1|2560042_2560585_-	hypothetical protein	NA	NA	NA	NA	NA
2560421:2560437	attL	TTTTTTATCTACCCATT	NA	NA	NA	NA
WP_004442193.1|2560914_2561097_-	hypothetical protein	NA	A0A0K2SUB6	Clostridium_phage	69.1	3.9e-14
WP_004442196.1|2561098_2561425_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	43.7	3.2e-14
WP_012099361.1|2561436_2562846_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	61.8	1.6e-78
WP_187147405.1|2562845_2563916_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	E2ELJ7	Clostridium_phage	58.2	5.4e-119
WP_012099363.1|2563916_2564783_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	69.9	1.3e-110
WP_012099364.1|2564799_2570112_-|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	36.3	3.8e-72
WP_012099365.1|2570366_2570693_-	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	35.1	1.2e-05
WP_012099366.1|2570728_2571310_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	60.1	1.5e-59
WP_012099367.1|2571312_2571657_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	43.5	6.6e-18
WP_041926461.1|2571653_2572037_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	51.4	7.0e-29
WP_012099369.1|2572029_2572356_-|head	phage head closure protein	head	A0A2H4J374	uncultured_Caudovirales_phage	33.0	3.5e-05
WP_012099370.1|2572336_2572657_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	47.3	5.5e-11
WP_012099371.1|2572673_2572829_-	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012099372.1|2572848_2573976_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	65.3	2.7e-129
WP_012099373.1|2573968_2574727_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	59.4	4.3e-70
WP_012099374.1|2574716_2575901_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	37.4	7.4e-69
WP_012099375.1|2575916_2577617_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	57.3	1.3e-183
WP_012099376.1|2577613_2578078_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	62.5	3.9e-50
WP_012099377.1|2578113_2578467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099378.1|2578553_2579027_-	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	39.0	2.7e-14
WP_012099379.1|2579026_2579320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143706894.1|2579321_2579678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099381.1|2579891_2580074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099382.1|2580102_2580378_-	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	43.7	5.1e-13
WP_012099383.1|2580531_2581077_-|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	59.0	1.3e-55
WP_012099384.1|2581073_2581289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099385.1|2581512_2581902_-	nitroreductase	NA	A0A0A7RTL7	Clostridium_phage	58.3	4.0e-40
WP_012099386.1|2581891_2582059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041926462.1|2582216_2583212_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.2	1.7e-21
WP_012099389.1|2583574_2584624_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	29.0	1.5e-36
2583740:2583756	attR	TTTTTTATCTACCCATT	NA	NA	NA	NA
WP_012099390.1|2584658_2584859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986347.1|2584902_2585850_-	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	59.0	3.3e-104
WP_012099391.1|2585892_2586612_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	43.5	4.7e-50
WP_012099392.1|2586676_2587045_-	nucleotide pyrophosphohydrolase	NA	A0A248XD87	Klebsiella_phage	39.8	4.3e-07
WP_012099393.1|2587044_2587587_-	hypothetical protein	NA	A0A2K9V2Y3	Faecalibacterium_phage	27.5	1.5e-08
WP_012099394.1|2587587_2588421_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SFJ6	Streptococcus_phage	62.6	1.1e-45
WP_012099395.1|2588516_2588786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099396.1|2588802_2588985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099397.1|2588986_2589247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099398.1|2589312_2589513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012099399.1|2589502_2589685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099400.1|2589697_2590462_-	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	49.2	2.1e-56
WP_012099402.1|2590833_2591037_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099403.1|2591243_2591609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099404.1|2591620_2593135_+	recombinase family protein	NA	A0A0A7S0M8	Clostridium_phage	77.0	1.2e-228
WP_003386384.1|2594000_2594180_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_012047889.1|2594613_2594751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003386388.1|2595141_2595396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011986873.1|2596486_2597155_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_011986874.1|2597233_2597710_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_075142602.1|2598154_2598268_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_011986875.1|2598762_2599047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986876.1|2599057_2599861_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	53.2	1.9e-76
WP_011986877.1|2599841_2600645_-	recombinase RecT	NA	H7BUU1	unidentified_phage	54.3	1.6e-59
WP_011986878.1|2600837_2601086_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003397157.1|2601292_2601445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011986879.1|2601662_2603333_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011986880.1|2603418_2604039_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	2.1e-35
WP_011986881.1|2604186_2605413_-	U32 family peptidase	NA	Q6DW11	Phage_TP	37.0	3.8e-52
WP_011986882.1|2605405_2606062_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_004440261.1|2606144_2607176_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011986883.1|2607253_2609080_-	translational GTPase TypA	NA	D0R0F5	Streptococcus_phage	29.9	3.5e-17
WP_003385808.1|2609723_2611433_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003385810.1|2611480_2611933_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_011986884.1|2612054_2612309_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_004440635.1|2612322_2612736_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003385813.1|2612942_2613194_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_011986885.1|2613308_2615948_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.4	1.9e-64
>prophage 5
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	2989682	2999151	3863450		Synechococcus_phage(42.86%)	7	NA	NA
WP_003385254.1|2989682_2991182_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.9e-69
WP_012047940.1|2991395_2992013_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	1.5e-25
WP_012099415.1|2992140_2993136_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.7	9.9e-67
WP_012047942.1|2993196_2994645_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.5e-58
WP_012047943.1|2994736_2995441_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	6.0e-42
WP_003357851.1|2995440_2995920_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	1.1e-26
WP_012099417.1|2996595_2999151_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
>prophage 6
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	3077304	3154805	3863450	tail,capsid,protease,portal,head,tRNA,terminase,holin,integrase	Clostridium_phage(48.84%)	93	3100981:3101007	3140246:3140272
WP_012048000.1|3077304_3078603_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_012048001.1|3078602_3079361_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003385115.1|3079458_3080397_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012048002.1|3080574_3081720_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	2.2e-25
WP_003357980.1|3081862_3083734_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.7	1.6e-142
WP_012048003.1|3083788_3084433_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003357960.1|3084459_3085491_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_012099423.1|3085691_3086834_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003357725.1|3086860_3088669_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.3	4.2e-23
WP_012048005.1|3088809_3089205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012048006.1|3089275_3090367_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_012048007.1|3090551_3091526_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_003358111.1|3091735_3092002_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_012048008.1|3092036_3093068_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_012048009.1|3093096_3094884_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_012048010.1|3094895_3095126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012048011.1|3095230_3097825_-	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
WP_012048012.1|3098333_3099848_-	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
3100981:3101007	attL	TAGTGTGGGAAAAGTGTGGGAAAATAA	NA	NA	NA	NA
WP_012099427.1|3101381_3101618_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUG5	Clostridium_phage	67.9	3.0e-22
WP_012099428.1|3101694_3101973_+	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	82.6	1.6e-35
WP_012099429.1|3102007_3102595_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	30.9	2.8e-08
WP_012099430.1|3102821_3103418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143706896.1|3103408_3104242_-	hypothetical protein	NA	Q331T3	Clostridium_botulinum_C_phage	28.4	3.8e-19
WP_012099432.1|3104631_3104781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099433.1|3104915_3105467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187147404.1|3105552_3105711_-	hypothetical protein	NA	A0A2H4J4S7	uncultured_Caudovirales_phage	75.0	4.9e-13
WP_079995902.1|3105835_3106003_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012099436.1|3106216_3106462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099437.1|3106458_3106635_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	66.0	2.8e-09
WP_012099438.1|3106764_3107535_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.6	2.5e-89
WP_012099439.1|3107579_3107996_-|holin	phage holin family protein	holin	A0A1B1P7S2	Bacillus_phage	42.9	1.3e-23
WP_012099440.1|3108085_3108790_-	glycosyl hydrolase	NA	Q0SPG7	Clostridium_phage	44.6	1.1e-38
WP_012099441.1|3108830_3109019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099442.1|3109032_3109287_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	69.6	4.1e-25
WP_041926499.1|3109373_3109802_-	hypothetical protein	NA	A0A0A7S1G5	Clostridium_phage	47.7	8.4e-23
WP_012099444.1|3109805_3110477_-	SocA family protein	NA	A0A0A7RUP2	Clostridium_phage	47.3	2.1e-52
WP_004442193.1|3110587_3110770_-	hypothetical protein	NA	A0A0K2SUB6	Clostridium_phage	69.1	3.9e-14
WP_004442196.1|3110771_3111098_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	43.7	3.2e-14
WP_012099445.1|3111109_3112540_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	54.7	2.6e-68
WP_012099447.1|3112539_3113625_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	E2ELJ7	Clostridium_phage	46.9	1.0e-85
WP_012099449.1|3113628_3114498_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	58.6	6.6e-91
WP_012099451.1|3114510_3119655_-|tail	phage tail tape measure protein	tail	E2ELJ5	Clostridium_phage	63.5	1.2e-126
WP_143706895.1|3119707_3119914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099454.1|3119910_3120240_-	hypothetical protein	NA	A0A2I7SBZ1	Paenibacillus_phage	29.7	3.2e-06
WP_012099456.1|3120240_3120840_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	61.1	4.0e-63
WP_012099458.1|3120842_3121184_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	41.7	4.2e-17
WP_041926468.1|3121272_3121656_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	47.1	3.1e-24
WP_012099461.1|3121648_3122008_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_012099463.1|3121958_3122258_-	hypothetical protein	NA	E2ELI6	Clostridium_phage	44.0	8.2e-09
WP_012099464.1|3122267_3123413_-|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	58.1	1.0e-123
WP_012099465.1|3123412_3124156_-|protease	Clp protease ClpP	protease	Q8W605	Listeria_phage	47.6	2.6e-51
WP_041926469.1|3124158_3125301_-|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	41.2	1.1e-82
WP_143706897.1|3125325_3126930_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	48.6	1.1e-142
WP_012099468.1|3126955_3127447_-|terminase	P27 family phage terminase small subunit	terminase	V5URT8	Oenococcus_phage	52.7	2.3e-08
WP_050761139.1|3127619_3127889_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	53.9	1.6e-19
WP_012099469.1|3127938_3128247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099470.1|3128443_3128989_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	51.9	9.3e-51
WP_012099471.1|3128985_3129201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099472.1|3129385_3129814_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012099473.1|3129797_3129968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099474.1|3129969_3130260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099475.1|3130252_3130405_-	hypothetical protein	NA	A0A0A7RTX2	Clostridium_phage	47.7	4.8e-05
WP_012099476.1|3130416_3131412_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.5	2.3e-23
WP_012099477.1|3131464_3131602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099478.1|3131710_3132142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011986347.1|3132214_3133162_-	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	59.0	3.3e-104
WP_012099479.1|3133204_3133924_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	42.6	1.2e-48
WP_012099480.1|3133982_3134267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099481.1|3134257_3134773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050761147.1|3134791_3135550_-	ATP-binding protein	NA	M9Q1J4	Clostridium_phage	43.2	2.8e-53
WP_050761140.1|3135491_3136412_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A0A7RTL4	Clostridium_phage	71.7	1.3e-73
WP_004442273.1|3136434_3136704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099396.1|3136720_3136903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099484.1|3136904_3137165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099485.1|3137176_3137938_-	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	46.9	2.2e-50
WP_012099486.1|3137949_3138231_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_012099487.1|3138202_3138445_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099488.1|3138647_3138980_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099489.1|3139040_3140204_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	27.5	1.2e-26
WP_012048014.1|3141073_3142981_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	31.4	1.3e-17
3140246:3140272	attR	TAGTGTGGGAAAAGTGTGGGAAAATAA	NA	NA	NA	NA
WP_012048015.1|3142999_3144388_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_012099571.1|3144454_3145534_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_012048017.1|3145639_3146248_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012048018.1|3146436_3147684_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_012048019.1|3147791_3148694_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003357849.1|3149019_3149400_-	RidA family protein	NA	NA	NA	NA	NA
WP_012048020.1|3149415_3150690_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	29.2	1.3e-18
WP_003360010.1|3150700_3151270_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003360011.1|3151352_3151958_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003358089.1|3152200_3152494_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_012048021.1|3152520_3153795_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003357774.1|3154173_3154476_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012048022.1|3154478_3154805_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 7
NC_009697	Clostridium botulinum A str. ATCC 19397, complete sequence	3863450	3187108	3209008	3863450		Clostridium_phage(85.71%)	26	NA	NA
WP_012048045.1|3187108_3188194_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	69.5	1.1e-140
WP_012048046.1|3188205_3189204_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.3	4.0e-140
WP_003360052.1|3189215_3189470_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_012048047.1|3189475_3191371_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	52.9	3.3e-119
WP_012048048.1|3191385_3192624_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	81.1	1.3e-196
WP_012048049.1|3192646_3193627_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	61.6	3.2e-110
WP_012099496.1|3193628_3194969_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.6	2.1e-75
WP_012048051.1|3194983_3195325_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	54.3	7.9e-16
WP_003403529.1|3195337_3196423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012099497.1|3196409_3196844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012048053.1|3196856_3198398_-	membrane protein	NA	A0A0A7RU22	Clostridium_phage	42.4	5.8e-05
WP_003393374.1|3198473_3198641_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	68.5	1.1e-15
WP_012048055.1|3198675_3199092_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	70.5	7.6e-45
WP_012048056.1|3199107_3199995_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	75.3	3.1e-120
WP_012048057.1|3199999_3200419_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	71.9	3.9e-57
WP_012048058.1|3200424_3200772_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	58.9	1.1e-33
WP_012048059.1|3200776_3201142_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	56.2	5.0e-32
WP_012048060.1|3201141_3201426_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	60.2	1.0e-24
WP_012048061.1|3202112_3202634_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	49.4	3.1e-35
WP_012099498.1|3203114_3203915_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.8	9.9e-33
WP_012099499.1|3203904_3204810_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	38.7	9.4e-40
WP_003384849.1|3204903_3205116_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012099500.1|3205177_3205387_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012048067.1|3205578_3205989_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003403583.1|3206290_3206440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012048068.1|3207520_3209008_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.3	1.3e-65
