The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009565	Mycobacterium tuberculosis F11, complete genome	4424435	1946033	2006321	4424435	integrase,transposase	Burkholderia_virus(46.15%)	47	1944840:1944857	2011067:2011084
1944840:1944857	attL	GAGCAGTACCTCGACGGC	NA	NA	NA	NA
WP_087902221.1|1946033_1947295_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003408486.1|1947626_1948337_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003900395.1|1948437_1949823_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	27.6	1.3e-32
WP_003408493.1|1949855_1950425_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_003408495.1|1950449_1951220_-	hypothetical protein	NA	A0A2D1GPL9	Mycobacterium_phage	43.6	5.6e-25
WP_003408497.1|1951216_1952155_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003408499.1|1952391_1953945_-	serine hydrolase	NA	A0A0Y0A2S9	Mycobacterium_phage	26.2	3.2e-11
WP_003898989.1|1954376_1955933_+	succinate-semialdehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_003408503.1|1955942_1956491_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003408506.1|1956554_1957187_-	membrane protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	99.5	2.5e-108
WP_003408509.1|1957473_1957716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077364998.1|1957990_1958527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408513.1|1958586_1958829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901238.1|1958927_1960886_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003898992.1|1960882_1962070_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_003408522.1|1962356_1962641_+	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003898994.1|1962654_1964337_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_003408528.1|1964404_1964617_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_003898996.1|1964616_1964865_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003898997.1|1964872_1965610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003898998.1|1965703_1967404_+	serine/threonine protein kinase	NA	A0A2K9L111	Tupanvirus	26.3	1.8e-12
WP_003408538.1|1967688_1968090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898999.1|1968079_1968691_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003899000.1|1968837_1970268_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	26.8	8.8e-16
WP_003408545.1|1970329_1972927_+	ATP transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.0	1.3e-28
WP_003408551.1|1973299_1974031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003408556.1|1974027_1974585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408558.1|1974668_1976267_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003408560.1|1976320_1977703_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003408562.1|1977829_1978279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938414.1|1978313_1981241_-	PPE family protein	NA	NA	NA	NA	NA
WP_003906670.1|1981444_1982956_-	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|1983133_1984395_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003900400.1|1984677_1986222_-	phospholipase C	NA	NA	NA	NA	NA
WP_003899005.1|1987685_1988825_+	sulfite oxidase	NA	NA	NA	NA	NA
WP_003900401.1|1989025_1991863_+	RND family transporter	NA	NA	NA	NA	NA
WP_087902221.1|1992398_1993660_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_012775775.1|1993658_1994198_+	cutinase family protein	NA	NA	NA	NA	NA
WP_012054293.1|1994464_1997200_-	PE family protein	NA	NA	NA	NA	NA
WP_087902221.1|1997413_1998674_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899007.1|1999133_2000642_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003899008.1|2000651_2001035_-	DUF5073 domain-containing protein	NA	NA	NA	NA	NA
WP_003899009.1|2001034_2001823_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899010.1|2001962_2002430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003410095.1|2002840_2004097_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_087902221.1|2004235_2005496_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_077365248.1|2006081_2006321_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.6	8.3e-12
2011067:2011084	attR	GAGCAGTACCTCGACGGC	NA	NA	NA	NA
>prophage 2
NC_009565	Mycobacterium tuberculosis F11, complete genome	4424435	2954505	2992777	4424435	capsid,tRNA,terminase,integrase,head,protease	Mycobacterium_phage(30.0%)	48	2983306:2983333	2992930:2992957
WP_003413486.1|2954505_2956584_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2956692_2956920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2956916_2958302_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2958646_2959147_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2959163_2959604_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2959750_2960428_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2960412_2960766_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2960778_2961204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2961200_2961875_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2961952_2962774_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2962909_2963803_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2963805_2964624_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2964638_2965820_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2965878_2966310_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2966823_2968065_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2968374_2968737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2969083_2970208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2970209_2970749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2970888_2972187_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2972225_2972507_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2972651_2973137_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2973163_2973421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2973421_2975758_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2975786_2976029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2976029_2976707_+	membrane protein	NA	NA	NA	NA	NA
WP_012054325.1|2976902_2977559_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2977721_2978168_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2978342_2978675_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2978794_2979154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2979255_2979714_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2979849_2980230_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2980226_2981723_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2981912_2982149_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2982221_2982395_+	hypothetical protein	NA	NA	NA	NA	NA
2983306:2983333	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2983439_2983871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2983867_2984866_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2984879_2985344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2985331_2985583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2985753_2987193_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2987200_2987734_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_072464513.1|2987886_2988513_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2988544_2988868_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2988947_2989193_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2989189_2990617_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2990618_2991011_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2991007_2991268_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2991284_2991647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2991649_2992777_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2992930:2992957	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
