The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	312798	375094	4517345	tail,transposase,protease	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|312798_314244_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|314446_317305_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002228695.1|317329_320170_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|320370_320730_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_011906147.1|320726_321128_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	60.2	1.1e-35
WP_002214300.1|321140_321443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|321576_326067_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|326123_329717_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|329757_332259_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|332494_333361_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|333621_334533_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|334835_335039_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|335046_335982_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|335983_337939_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|339868_340342_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|340346_340628_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|340739_341288_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|341468_342809_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|343057_343702_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|343909_344296_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|344519_344930_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|345282_346950_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|347044_348460_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|348870_349824_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|350057_350534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|350832_351219_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|351356_351821_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|351832_352768_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|353105_353378_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|353374_354229_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|354534_355017_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|355445_356879_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011906149.1|356940_357666_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|357672_358218_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|358201_358765_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|358761_359325_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|359433_360420_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|360530_361505_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|361769_362588_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|362805_363588_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|363592_364150_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|364162_364786_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|364821_365124_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|365270_365525_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|365678_366941_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|367121_368210_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|368435_368894_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|369010_370384_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|370654_371059_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|371282_372410_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|372722_373151_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|373165_373558_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|373554_373752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|373931_374573_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|374578_375094_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 2
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	597240	678206	4517345	tRNA,plate,protease,transposase	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002215902.1|597240_597891_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|598341_598737_+	lipoprotein	NA	NA	NA	NA	NA
WP_002213014.1|601012_601513_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_041175540.1|601555_603106_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|603117_604470_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|604466_605153_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|605152_606889_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|606892_607384_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|607801_610450_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011906172.1|610446_612795_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210009.1|612810_615108_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|615094_615862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|615957_616654_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|617262_617898_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|619226_621389_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|621944_622904_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|622949_624449_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|624481_625465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|625547_627581_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|627684_628785_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|629083_630160_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|630342_630615_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|630792_631908_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|632245_632965_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|632964_633291_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|633401_634328_+	glutaminase B	NA	NA	NA	NA	NA
WP_011906173.1|635668_645001_+	virulence determinant	NA	NA	NA	NA	NA
WP_002209987.1|645190_646321_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|646313_646907_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|647006_647297_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|647293_647848_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|648135_648957_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|649089_649788_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|649807_650932_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|651040_652156_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|652159_653044_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|653223_653646_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|653645_654209_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|654324_655284_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|655309_656041_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|656292_657000_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|657097_657610_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|657802_658957_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|660163_662143_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|662302_662623_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|662656_662767_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|662912_663665_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|664155_666150_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|666457_666916_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209964.1|667256_668273_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|668375_669539_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|669658_670738_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|671175_672045_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209960.1|672307_672925_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209959.1|673114_673894_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|673904_674813_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|675154_675811_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|676117_677359_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002213775.1|677747_678206_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	1086794	1181801	4517345	lysis,terminase,tRNA,transposase,integrase,tail	Escherichia_phage(12.5%)	93	1131413:1131443	1171225:1171255
WP_002209743.1|1086794_1088003_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210664.1|1088519_1089866_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|1090172_1091189_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|1092522_1092987_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|1093070_1093919_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|1094555_1095764_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|1095982_1096843_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|1097652_1098459_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|1098556_1098943_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|1098955_1099246_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|1099242_1101168_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211673.1|1102384_1102936_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_011192431.1|1103098_1104949_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|1105065_1106082_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|1106096_1106744_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|1106877_1107150_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|1107220_1107634_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_011906206.1|1107981_1108977_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|1109290_1110166_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|1110238_1110988_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011906207.1|1111431_1113366_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|1113515_1114790_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|1114897_1116016_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|1116050_1116956_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|1117153_1118023_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|1118287_1119490_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_011906208.1|1119505_1120810_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|1121275_1122811_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|1123028_1123748_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|1123991_1125566_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|1125801_1126332_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|1126748_1127105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|1128196_1128937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|1128953_1130153_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
1131413:1131443	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_097608205.1|1131739_1132108_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|1132169_1133087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|1133103_1134102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|1134101_1137305_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|1137480_1137702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|1137876_1138497_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|1138552_1138768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|1138910_1139462_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|1139560_1140568_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|1140641_1140809_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|1140932_1141364_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211708.1|1142346_1143057_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|1143059_1143812_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213775.1|1143931_1144390_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|1144641_1145100_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|1145405_1145747_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_011906212.1|1145749_1149265_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|1149265_1149526_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|1149573_1149885_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|1149897_1150818_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|1150883_1151291_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|1151287_1151872_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211717.1|1152226_1152481_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|1152477_1152960_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|1153007_1154213_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|1154226_1155000_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|1155121_1156234_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|1156234_1156876_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|1156894_1157623_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_011906214.1|1157622_1159113_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002211724.1|1159122_1159572_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|1159602_1160238_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|1160694_1161408_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|1161953_1162412_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|1162396_1162909_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|1162939_1163137_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|1163382_1163658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|1163654_1163864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|1164287_1164851_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|1164899_1165118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|1165121_1165511_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|1165511_1166117_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|1166190_1166637_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|1166612_1167362_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|1167661_1167922_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|1168089_1168869_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1168868_1169891_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|1169960_1171199_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|1171225_1171672_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
1171225:1171255	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|1171774_1172431_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|1172501_1173587_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|1173727_1174000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|1174720_1175407_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|1175431_1176244_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|1176247_1176517_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|1176753_1177875_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002220632.1|1178034_1179723_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|1180257_1180365_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211184.1|1181102_1181801_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	1635091	1680249	4517345	tRNA,lysis,transposase,plate	Escherichia_phage(25.0%)	36	NA	NA
WP_002211870.1|1635091_1637119_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|1637282_1637741_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|1637958_1638621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|1639318_1640395_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|1640412_1641666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|1641998_1643180_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|1643421_1643829_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|1643825_1644521_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|1644856_1645741_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|1646096_1647794_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|1648074_1648812_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_011901829.1|1649530_1650553_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1650552_1651332_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011906260.1|1652246_1653761_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	3.4e-10
WP_002211963.1|1653990_1654983_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|1655730_1656897_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|1656951_1657614_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|1657797_1658949_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|1659084_1659954_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002224699.1|1660227_1661367_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211956.1|1661387_1662230_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|1662486_1662699_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|1662782_1665143_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|1665144_1666407_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|1666408_1667077_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|1667086_1668397_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|1668931_1670206_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|1670207_1670978_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002211947.1|1671042_1671696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|1671923_1673519_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|1674201_1674825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|1675036_1676404_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|1676428_1676881_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|1676880_1677462_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011906261.1|1677436_1678522_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|1678485_1680249_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	1893942	1973228	4517345	coat,transposase,protease	Escherichia_phage(18.75%)	60	NA	NA
WP_011906282.1|1893942_1894965_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_000970353.1|1894964_1895657_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_002215834.1|1897013_1898972_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.5	7.0e-24
WP_002215833.1|1898968_1902631_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	23.0	3.4e-11
WP_002211626.1|1902627_1905516_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.7	5.1e-63
WP_002211627.1|1905597_1908969_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_002228047.1|1909103_1909514_-	peptidase	NA	NA	NA	NA	NA
WP_002211629.1|1909501_1909972_-	YgdB family protein	NA	NA	NA	NA	NA
WP_002211630.1|1909968_1910577_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_002228638.1|1910567_1911137_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_002211384.1|1911372_1912167_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
WP_002211383.1|1912173_1913046_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002228076.1|1913296_1915543_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	7.9e-11
WP_002211381.1|1915555_1916083_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002209838.1|1916779_1917466_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_002209839.1|1917854_1918895_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_002209840.1|1919271_1919523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228641.1|1919601_1919835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209842.1|1919863_1921084_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_002230664.1|1921080_1923237_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.1	7.5e-19
WP_011906284.1|1923685_1925947_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.5	1.6e-72
WP_002209845.1|1926256_1927279_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_002209846.1|1927275_1928538_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_002209847.1|1928752_1929694_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209848.1|1929690_1930851_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209849.1|1931219_1932128_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209850.1|1932234_1933122_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002209852.1|1933234_1933870_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011906285.1|1933855_1935547_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	3.1e-12
WP_002214100.1|1935710_1936112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|1936469_1937678_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|1937725_1938076_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|1938411_1939248_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|1939339_1940101_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|1940436_1942104_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|1942144_1943035_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|1943027_1943948_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|1943961_1945089_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|1945104_1946397_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|1946694_1947405_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|1947974_1948523_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|1948726_1950118_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|1950332_1951184_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|1951568_1952360_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|1952546_1953713_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|1954039_1955407_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|1955460_1956264_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|1956260_1957424_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|1957420_1960033_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|1960114_1960894_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|1961046_1961589_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|1962246_1963128_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|1963582_1965655_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|1965674_1966388_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|1966483_1966981_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|1967212_1968460_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|1968428_1971080_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|1971559_1972114_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1972119_1972650_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|1972670_1973228_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	2291209	2361627	4517345	tRNA,plate,transposase	Escherichia_phage(53.85%)	55	NA	NA
WP_002209686.1|2291209_2291689_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|2291769_2292576_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2292595_2293438_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2293443_2293704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906308.1|2293802_2296082_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	2.9e-29
WP_002209681.1|2300210_2301047_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|2301062_2301842_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2301841_2302864_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|2303542_2304892_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|2304895_2305435_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|2305708_2306194_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|2306519_2308022_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|2308045_2308570_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011906310.1|2308674_2309283_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|2309267_2310458_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2310482_2311691_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002231031.1|2311712_2313263_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|2313390_2314152_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2314308_2314854_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|2315054_2317730_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2318512_2320393_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211584.1|2321511_2322693_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002215319.1|2322699_2323731_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002211586.1|2323770_2325108_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002224806.1|2325104_2325806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211588.1|2325806_2327489_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011906313.1|2327485_2327968_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211590.1|2328325_2328928_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211594.1|2330189_2331284_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211596.1|2331612_2332632_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002215840.1|2332687_2334274_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211598.1|2334270_2335320_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002211599.1|2335392_2335917_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|2336383_2336863_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211601.1|2337092_2337941_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002211602.1|2338771_2341198_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211603.1|2341209_2341827_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|2341828_2342605_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002228419.1|2342962_2343559_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211606.1|2343555_2344125_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002211607.1|2344370_2345027_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002215846.1|2345023_2345380_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002215847.1|2345406_2346078_-	lipoprotein	NA	NA	NA	NA	NA
WP_002211610.1|2346667_2347099_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|2347193_2347718_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_011906314.1|2347943_2349179_-	alanine transaminase	NA	NA	NA	NA	NA
WP_002211614.1|2349444_2350692_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211615.1|2350769_2351741_-	glucokinase	NA	NA	NA	NA	NA
WP_002211616.1|2351921_2352398_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211617.1|2352500_2353379_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211618.1|2353514_2354504_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002354622.1|2354773_2355088_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211621.1|2355180_2356410_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002222185.1|2359265_2360681_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002213775.1|2361168_2361627_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	2719850	2790471	4517345	tail,transposase,coat,plate	Vibrio_phage(16.67%)	59	NA	NA
WP_002213759.1|2719850_2720309_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208786.1|2720507_2722019_-	amino acid permease	NA	NA	NA	NA	NA
WP_002208788.1|2722276_2723149_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208790.1|2723806_2724895_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002208791.1|2725058_2725916_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
WP_002208792.1|2725986_2728458_-	fimbrial biogenesis usher protein PsaC	NA	NA	NA	NA	NA
WP_002208793.1|2728541_2729363_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002208794.1|2729489_2729966_-	adhesin PsaA	NA	NA	NA	NA	NA
WP_002216523.1|2730510_2730999_-	protein PsaF	NA	NA	NA	NA	NA
WP_002208796.1|2730995_2731640_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002208797.1|2731964_2733665_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002208798.1|2733679_2734618_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208799.1|2734614_2735748_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_002208801.1|2736009_2736465_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_002208802.1|2736577_2737576_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208803.1|2737611_2739186_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208804.1|2739294_2740383_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208805.1|2740498_2741209_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_002208806.1|2741228_2742782_-	xylulokinase	NA	NA	NA	NA	NA
WP_002208807.1|2742785_2744282_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002208808.1|2744632_2745775_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002230767.1|2745771_2746737_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_002208810.1|2746747_2747563_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208811.1|2747631_2747886_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208812.1|2748260_2749505_+	tryptophan permease	NA	NA	NA	NA	NA
WP_002228019.1|2749608_2750181_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208813.1|2750320_2751514_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002224659.1|2752117_2753590_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
WP_002208819.1|2755270_2756254_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208820.1|2756312_2757014_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208822.1|2757455_2758040_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_071525527.1|2758690_2760208_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208825.1|2760289_2762098_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208826.1|2762107_2763208_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208827.1|2763207_2764236_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208828.1|2764237_2765830_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208829.1|2765890_2766235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|2767219_2768419_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208832.1|2768522_2769230_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208833.1|2769763_2771521_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208834.1|2771682_2771967_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002213775.1|2772105_2772564_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|2772764_2773769_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|2773946_2774174_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|2774201_2775998_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|2776228_2776612_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|2776968_2778117_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|2778129_2778618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|2779317_2779680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|2779805_2781242_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|2781532_2782273_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|2782570_2783350_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|2783446_2783794_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|2783790_2784051_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|2784047_2785184_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|2785187_2785643_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208850.1|2786252_2787308_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|2787304_2788711_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|2788977_2790471_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 8
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	2793649	2803664	4517345		Escherichia_phage(42.86%)	10	NA	NA
WP_002208859.1|2793649_2793940_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|2794536_2795331_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|2795306_2796119_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_116463120.1|2796121_2796817_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208862.1|2796849_2798154_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|2798364_2798844_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|2799117_2799840_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|2800045_2800288_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|2800459_2801395_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_011906348.1|2801876_2803664_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 9
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	2826757	2883412	4517345	tRNA,transposase,protease,holin	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002210815.1|2826757_2827267_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|2827324_2828518_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|2829136_2830345_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|2830601_2831144_-	membrane protein	NA	NA	NA	NA	NA
WP_002228030.1|2831501_2832944_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|2833011_2835192_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|2835461_2836577_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|2836988_2837879_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|2838003_2838207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2839431_2840640_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210804.1|2842023_2843358_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|2843913_2844612_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|2844746_2845685_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002210801.1|2845681_2846836_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191984.1|2847096_2848029_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210799.1|2848764_2849619_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|2849836_2851252_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|2851275_2852133_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|2852247_2852946_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_032465620.1|2853039_2853810_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002210794.1|2853872_2854949_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|2854948_2856550_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|2856673_2857942_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|2858369_2858843_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|2859088_2859970_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|2859972_2860833_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011906354.1|2860935_2861865_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|2861901_2862738_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|2862945_2863194_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|2863378_2864482_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_011906355.1|2864794_2865136_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|2865161_2865701_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|2865910_2867623_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|2867743_2868679_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|2869017_2869197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|2869270_2870209_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|2870508_2871438_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|2871852_2872311_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|2873239_2874103_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|2874448_2875297_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|2875334_2876228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|2876459_2878508_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|2878872_2879469_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|2879526_2880999_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011906357.1|2881021_2882725_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_011906358.1|2882953_2883412_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	2953939	2963081	4517345	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002210709.1|2953939_2954140_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|2954139_2954682_+	ash family protein	NA	NA	NA	NA	NA
WP_011906363.1|2954674_2955634_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002210707.1|2955630_2956719_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|2957067_2957382_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|2957387_2957705_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_011901829.1|2958309_2959332_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|2959331_2960111_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|2961003_2961189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|2961351_2961603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|2962313_2963081_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
>prophage 11
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	3480057	3561607	4517345	tRNA,transposase,plate	Escherichia_phage(18.18%)	60	NA	NA
WP_002222284.1|3480057_3480798_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|3480878_3481226_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002209462.1|3481487_3482255_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002223245.1|3484351_3485068_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_011901829.1|3486274_3487297_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|3487296_3488076_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3488337_3488724_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3489018_3491733_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3491810_3492344_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3492372_3492897_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3493063_3493984_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3494083_3495235_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3495307_3496564_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3496590_3497418_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3497419_3498340_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3498332_3499808_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_011906408.1|3499945_3501016_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3501012_3502215_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3502214_3503531_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3503533_3504616_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3504609_3505986_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3505982_3507470_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011906409.1|3507456_3509220_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3509285_3509603_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_011906410.1|3509599_3510556_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3510558_3511017_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3511571_3511661_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3512118_3512559_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002213759.1|3512758_3513217_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210447.1|3513400_3514411_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|3514915_3515374_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|3515572_3516097_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011906411.1|3516069_3517797_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002209743.1|3518296_3519505_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002216437.1|3519579_3521385_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3521955_3522912_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3523590_3523806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210453.1|3524128_3525691_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3525693_3526785_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3526786_3528217_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3528231_3528834_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|3529074_3530256_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|3530919_3532581_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3533520_3534513_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3534488_3536096_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3536082_3536793_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3536861_3537629_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3537824_3540194_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3540638_3543545_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3543800_3544154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906413.1|3547678_3549268_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|3549264_3550620_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3550739_3551231_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3551223_3551589_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3551594_3552212_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3552204_3553308_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|3553333_3555553_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3555565_3557914_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|3558017_3560606_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|3560623_3561607_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NC_009381	Yersinia pestis Pestoides F, complete sequence	4517345	4072322	4134924	4517345	tRNA,transposase,protease	Bacillus_phage(21.43%)	59	NA	NA
WP_100067904.1|4072322_4073676_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002209257.1|4073739_4074009_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002209256.1|4074131_4075106_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002209255.1|4075105_4075516_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002223151.1|4075581_4078260_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
WP_002209253.1|4078284_4079772_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002222054.1|4079793_4080246_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002210190.1|4080777_4081113_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002210189.1|4081335_4082676_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002210188.1|4082685_4083519_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	6.5e-19
WP_002228195.1|4083638_4085573_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
WP_002228196.1|4085629_4086259_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_002210185.1|4086405_4086699_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002210184.1|4086826_4087303_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002217314.1|4087560_4089009_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_002210183.1|4089014_4089677_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_002210182.1|4089673_4090741_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210181.1|4090835_4092008_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002210180.1|4092008_4092995_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002210179.1|4093082_4093340_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210178.1|4093359_4093671_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002210177.1|4093930_4094902_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	6.0e-08
WP_002210176.1|4094998_4095346_-	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210175.1|4095529_4095805_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210174.1|4096238_4097177_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002210173.1|4097640_4098111_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002210172.1|4098499_4098763_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002210171.1|4099058_4100441_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011191626.1|4100611_4101625_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	1.8e-71
WP_002210169.1|4101824_4102352_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_002210168.1|4102469_4102826_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_011906451.1|4102828_4106725_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_002210166.1|4106721_4108458_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_002210165.1|4108732_4109371_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002210164.1|4109629_4110961_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002210163.1|4111068_4111281_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_002210162.1|4111616_4112180_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_002220539.1|4112182_4112923_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_002210160.1|4113357_4115328_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002210159.1|4115482_4116148_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_002228198.1|4116245_4116866_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210158.1|4117223_4117964_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_002210157.1|4118103_4118559_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|4118680_4119139_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210156.1|4119334_4119787_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002210155.1|4119826_4120054_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002430134.1|4120058_4120376_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_011906452.1|4120384_4120777_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_032485927.1|4121143_4121860_-	esterase	NA	NA	NA	NA	NA
WP_001297096.1|4121925_4122705_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|4122704_4123727_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002215294.1|4124043_4124355_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_032484797.1|4124426_4126058_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002209161.1|4126477_4127218_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002217229.1|4130112_4130538_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209157.1|4130886_4132185_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
WP_002217227.1|4132284_4132485_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002209155.1|4132656_4133661_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002209154.1|4133664_4134924_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 1
NC_009377	Yersinia pestis Pestoides F plasmid CD, complete sequence	71507	13246	70428	71507	transposase	Enterobacteria_phage(37.5%)	58	NA	NA
WP_000255944.1|13246_14269_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002212907.1|15801_16149_-	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002212909.1|16373_17006_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002361471.1|16984_17614_-	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212912.1|17613_18348_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002212914.1|18354_18702_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212915.1|18702_19200_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_011901822.1|19196_19544_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212916.1|19545_19809_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_002212917.1|19809_20010_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212919.1|20006_21266_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212923.1|21262_23086_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_002212925.1|23091_23505_-	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002229797.1|23730_23829_-	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212931.1|23907_24723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002222527.1|24846_25242_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_011901823.1|25816_26881_-	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212938.1|26880_27666_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_002212945.1|27662_27929_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212947.1|27930_28584_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212948.1|28580_29504_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011901824.1|29500_30868_-	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212952.1|30867_31332_-	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_011901825.1|31328_32648_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212958.1|32845_33727_+	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212965.1|33707_33986_+	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002229794.1|33972_34344_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212969.1|34340_34709_+	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229791.1|34705_35050_+	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212971.1|35036_37151_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002220918.1|37147_37588_+	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212973.1|37629_37917_+	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_011171995.1|37918_38893_+	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002222758.1|38895_39402_+	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212985.1|39379_40585_+	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002212987.1|40603_41524_+	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002209743.1|42066_43275_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002229781.1|43972_44182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222517.1|44512_45805_+	T3SS effector E3 ubiquitin ligase YopM	NA	NA	NA	NA	NA
WP_116442925.1|46046_46292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002393889.1|47040_47391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|48164_48563_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213007.1|50029_50578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|51175_51805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|53816_54983_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|54979_55945_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002224342.1|57117_57360_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|57352_57652_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|57791_58451_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|58644_59037_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|59846_61019_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|61793_62219_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|62366_63466_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|63565_63895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|64033_64498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|64516_65068_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_011901828.1|65231_67547_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_042469136.1|70158_70428_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_009378	Yersinia pestis Pestoides F plasmid MT, complete sequence	137010	86	69618	137010	terminase,tail,transposase	Salmonella_phage(91.04%)	70	NA	NA
WP_011901829.1|86_1109_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1108_1888_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|2021_2630_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|2931_5820_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|5900_6479_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_011901830.1|6535_11167_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
WP_002211773.1|11188_11776_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|11763_12561_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|12553_13252_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|13341_13677_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|13718_18296_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|18303_18528_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|18653_18971_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|19030_19777_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|19851_20235_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|20236_20710_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|20700_21045_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|21142_21976_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|21975_22410_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|22453_23116_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|23190_24066_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|24092_24989_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476623.1|25011_26586_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002211787.1|26619_27876_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|27878_28520_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|28715_28982_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|28991_29882_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|29887_30142_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|30134_30773_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|30769_31438_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|31437_32136_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|32204_33764_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|33766_34045_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|34104_34527_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|34531_35059_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|35382_36033_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|36117_36345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|36570_37029_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211801.1|37704_38187_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|38392_38674_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213775.1|38873_39332_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|39570_40326_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|40524_41667_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|41774_44090_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_011201798.1|44167_44737_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002213303.1|44749_45496_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|45485_45845_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|47631_48717_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|49132_50155_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|50514_50739_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|51923_52988_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|53556_53769_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|53768_54104_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|54100_54280_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|54320_54596_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|54663_55074_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|55057_55429_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|55582_56413_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|56416_56617_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|56707_57739_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|57786_58053_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|58052_58997_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|59057_60086_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|60205_60637_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|60857_61109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201800.1|61181_61745_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002425587.1|61774_62200_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|62214_65739_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|65919_67155_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|67251_69618_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
>prophage 2
NC_009378	Yersinia pestis Pestoides F plasmid MT, complete sequence	137010	78088	83841	137010	transposase	Salmonella_phage(83.33%)	7	NA	NA
WP_002224363.1|78088_78394_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|78539_78755_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_011901835.1|78914_80237_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	8.1e-258
WP_016256030.1|80271_80529_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002224265.1|80829_81624_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|81876_82599_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|82632_83841_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
