The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	105662	142467	3217726	portal,capsid,head,terminase,integrase	Stenotrophomonas_phage(18.18%)	41	118564:118582	143353:143371
WP_011907170.1|105662_106043_-|head	head decoration protein	head	NA	NA	NA	NA
WP_011907171.1|106102_107122_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	36.7	9.3e-52
WP_011907172.1|107138_108524_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	42.4	4.8e-51
WP_152334747.1|108516_108783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907173.1|108979_109522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907174.1|109518_109893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907175.1|110108_110672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044247640.1|110664_111018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907177.1|111018_111648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044247648.1|111657_112515_-	helix-turn-helix domain-containing protein	NA	F8TUQ7	EBPR_podovirus	50.0	4.6e-12
WP_152334748.1|112515_112737_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011907179.1|112860_113577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907180.1|113576_114818_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	27.6	3.2e-30
WP_152334749.1|114969_115287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907182.1|115781_117083_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011907183.1|117079_118816_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	1.4e-20
118564:118582	attL	CGCGGGCGCGGGCATGGTC	NA	NA	NA	NA
WP_011907184.1|119024_119810_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011907185.1|119799_120423_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044247652.1|120532_122800_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011907187.1|123061_123400_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011907188.1|123427_124780_+	ammonium transporter	NA	NA	NA	NA	NA
WP_044247653.1|124941_126126_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011907190.1|126133_126982_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_011907191.1|127074_127548_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.7	5.6e-28
WP_011907192.1|127677_128550_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_044247658.1|128701_130672_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	42.9	1.5e-26
WP_044248493.1|130973_131261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907195.1|131257_132427_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	38.6	3.8e-33
WP_044247661.1|132827_133103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044247664.1|133105_133294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907198.1|133388_133880_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_011907199.1|133866_135645_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	35.7	1.4e-92
WP_011907200.1|135922_136189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011907201.1|136247_136490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907202.1|136479_136839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907203.1|136933_137458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907204.1|137454_138786_+|portal	phage portal protein	portal	Q9JMM5	Wolbachia_phage	35.7	4.1e-68
WP_011907205.1|138782_140543_+	peptidase U35	NA	B7SYD7	Stenotrophomonas_phage	29.5	3.8e-53
WP_011907206.1|140542_140761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907207.1|140762_141092_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_152334785.1|141402_142467_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
143353:143371	attR	CGCGGGCGCGGGCATGGTC	NA	NA	NA	NA
>prophage 2
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	424865	474442	3217726	tRNA,protease,transposase	uncultured_Mediterranean_phage(27.27%)	50	NA	NA
WP_011907238.1|424865_426437_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011907237.1|426505_426859_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085996597.1|426855_427155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_044247758.1|427359_427605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907491.1|427601_427919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907492.1|427908_428871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044247760.1|428870_429098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907493.1|429279_430128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044247762.1|430138_430336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907494.1|430590_431517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907495.1|431579_432038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907496.1|432099_432696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907497.1|432692_434957_+	hypothetical protein	NA	K7ZLE6	Xanthomonas_citri_phage	32.3	5.5e-20
WP_152334751.1|435121_435496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907499.1|435492_437601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907500.1|437597_440435_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	31.2	4.1e-25
WP_011907501.1|440431_442924_+	hypothetical protein	NA	A0A0F7L5T6	uncultured_marine_virus	32.2	5.7e-103
WP_011907502.1|443020_444853_+	hypothetical protein	NA	A0A2I7R619	Vibrio_phage	53.7	3.6e-06
WP_044247764.1|444912_445176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080517412.1|445261_445534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907505.1|445547_445793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334752.1|445773_446256_+	glycoside hydrolase family protein	NA	NA	NA	NA	NA
WP_011907507.1|446252_446597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334753.1|446544_446772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907508.1|447679_448168_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	76.7	5.6e-47
WP_011907509.1|448380_448995_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.2	2.7e-22
WP_011907510.1|449051_450344_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	8.9e-92
WP_011907511.1|450431_451004_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_011907512.1|451251_451581_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	54.4	2.5e-19
WP_011907513.1|451598_453263_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011907514.1|453272_454247_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.7	4.7e-53
WP_011907515.1|454410_454764_+	membrane protein	NA	NA	NA	NA	NA
WP_011907516.1|454857_455496_+	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	29.3	1.6e-09
WP_011907517.1|455492_456149_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011907518.1|456197_456926_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011907519.1|456922_457084_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011907520.1|457076_457616_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011907521.1|457772_460457_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011907522.1|460679_461387_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_011907523.1|461541_462585_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011907524.1|462676_463363_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011907525.1|463370_464912_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_011907526.1|464908_467701_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011907527.1|467684_468860_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_011907528.1|468941_469829_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011907529.1|469825_470179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085996543.1|470231_471182_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011907531.1|471520_472573_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011907532.1|473012_473237_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517414.1|473341_474442_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	734888	752082	3217726	integrase,transposase	Bacillus_phage(50.0%)	8	730331:730346	760256:760271
730331:730346	attL	TCTCGGCATCGACGAA	NA	NA	NA	NA
WP_011907778.1|734888_737888_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
WP_011907779.1|737874_739368_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_044247843.1|740427_740790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011907782.1|741839_743123_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.3	1.1e-20
WP_080517452.1|747483_748506_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011907789.1|748785_749388_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_080517417.1|749481_749916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085996547.1|750856_752082_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	50.0	5.0e-68
760256:760271	attR	TTCGTCGATGCCGAGA	NA	NA	NA	NA
>prophage 4
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	860980	870780	3217726	tRNA	Vibrio_phage(16.67%)	12	NA	NA
WP_011907891.1|860980_862984_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.3	1.5e-34
WP_011907892.1|862995_863376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907893.1|863646_864114_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011907894.1|864128_865199_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.7	7.0e-34
WP_011907895.1|865235_865664_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011907896.1|865871_866768_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	48.8	5.8e-74
WP_011907897.1|866767_867247_+	dihydrofolate reductase	NA	A0A0K2QQK4	Ralstonia_phage	41.2	1.9e-23
WP_011907898.1|867284_867689_+	DUF2177 family protein	NA	NA	NA	NA	NA
WP_011907899.1|867754_868081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002720550.1|868136_868343_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.5e-11
WP_152334760.1|868611_868815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011907900.1|868839_870780_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	1.2e-116
>prophage 5
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	1103574	1115657	3217726	protease,portal,tail,capsid,head	Paracoccus_phage(50.0%)	15	NA	NA
WP_011908113.1|1103574_1104741_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	1.2e-58
WP_011908114.1|1104742_1104976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908115.1|1104980_1105544_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	47.9	7.2e-30
WP_044247934.1|1105576_1106773_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	40.1	2.8e-63
WP_011908117.1|1106862_1107462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908118.1|1107461_1107797_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011908119.1|1107793_1108192_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011908120.1|1108225_1108639_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_011908121.1|1108638_1108956_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_011908122.1|1108957_1109158_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_044247936.1|1109150_1109801_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	27.2	1.1e-08
WP_011908124.1|1109810_1110443_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	53.1	1.0e-61
WP_011908125.1|1110442_1111327_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.5	5.4e-64
WP_011908126.1|1111323_1111764_+	peptidase	NA	F4YXU4	Roseobacter_phage	47.5	6.2e-29
WP_011908127.1|1111763_1115657_+	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	39.5	1.4e-220
>prophage 6
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	1313513	1447540	3217726	protease,portal,tail,capsid,head,tRNA,terminase,integrase,transposase	Rhodobacter_phage(16.95%)	148	1386198:1386239	1403231:1403272
WP_011909091.1|1313513_1314209_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6N0	Pelagibaca_phage	49.8	6.1e-55
WP_011909090.1|1314295_1314595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248651.1|1314615_1314879_+	DNA-binding protein	NA	Q2A099	Sodalis_phage	41.2	3.5e-11
WP_152334767.1|1314927_1315338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908314.1|1315563_1315839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908315.1|1315838_1316123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908316.1|1316124_1316991_+	chromosome partitioning protein ParB	NA	A0A1B0T6M1	Pelagibaca_phage	62.7	2.1e-84
WP_011908317.1|1316987_1319105_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P6Z4	Rhodovulum_phage	46.9	4.6e-186
WP_011908318.1|1319149_1319932_+	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	47.3	2.1e-59
WP_011908319.1|1319934_1320516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908320.1|1320512_1320893_+	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	57.1	9.1e-37
WP_011908321.1|1320889_1321351_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011908322.1|1321531_1322194_+	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	70.4	1.1e-85
WP_044247978.1|1322201_1322399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044247979.1|1322402_1322636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908324.1|1322632_1323070_+	regulatory protein GemA	NA	A0A1B1P720	Rhodovulum_phage	67.1	1.1e-46
WP_011908326.1|1323374_1323980_+	S-adenosylmethionine-binding protein	NA	M4SPS7	Rhodobacter_phage	67.5	1.9e-73
WP_011908327.1|1323976_1324348_+	hypothetical protein	NA	M4SNV1	Rhodobacter_phage	54.0	3.4e-28
WP_011908328.1|1324371_1325418_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	25.4	3.8e-24
WP_011908329.1|1325606_1326479_+	SH3 domain-containing protein	NA	A0A1B0T6L3	Pelagibaca_phage	64.1	4.1e-101
WP_011908330.1|1326491_1326923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908331.1|1326919_1327270_+	DUF2730 family protein	NA	A0A1B0T6K8	Pelagibaca_phage	47.9	1.1e-17
WP_011908332.1|1327266_1327572_+	hypothetical protein	NA	A0A1B1P718	Rhodovulum_phage	58.4	6.6e-22
WP_011908333.1|1327573_1328113_+	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	78.8	3.3e-72
WP_152334768.1|1328109_1328778_+	DUF2786 domain-containing protein	NA	G8GWD1	Rhodobacter_phage	65.3	7.1e-69
WP_011908335.1|1328774_1330205_+|terminase	terminase	terminase	A0A1B1P714	Rhodovulum_phage	80.9	7.0e-207
WP_011908336.1|1330204_1330549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908337.1|1330550_1332182_+	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	60.5	6.9e-182
WP_044248655.1|1332168_1333392_+|head	phage head protein	head	A0A1B0T6H8	Thiobacimonas_phage	69.6	3.9e-105
WP_152334769.1|1333316_1333886_+	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	45.8	1.2e-32
WP_052292669.1|1334035_1335043_+	hypothetical protein	NA	M4SNT6	Rhodobacter_phage	49.1	2.0e-70
WP_011908341.1|1335042_1335489_+	hypothetical protein	NA	M4ST95	Rhodobacter_phage	63.1	7.9e-40
WP_011908342.1|1335500_1336397_+|head	head protein	head	M4SRT6	Rhodobacter_phage	74.5	8.2e-129
WP_011908343.1|1336406_1336802_+	hypothetical protein	NA	A0A1B0T6E5	Thiobacimonas_phage	64.4	7.5e-10
WP_011908344.1|1336905_1337334_+	DUF1320 domain-containing protein	NA	M4SPQ8	Rhodobacter_phage	50.7	1.5e-32
WP_011908345.1|1337333_1337765_+	hypothetical protein	NA	M4SNT0	Rhodobacter_phage	39.4	1.6e-21
WP_011908346.1|1337906_1338839_+	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	53.5	1.3e-92
WP_011908347.1|1338858_1339188_+	hypothetical protein	NA	G8EY05	Synechococcus_phage	36.6	3.8e-07
WP_011908348.1|1339253_1339541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908349.1|1339537_1341745_+	hypothetical protein	NA	A0A1B0T6D4	Thiobacimonas_phage	31.5	3.3e-22
WP_011908350.1|1341744_1342401_+	hypothetical protein	NA	G8DH55	Emiliania_huxleyi_virus	43.7	1.9e-34
WP_011908351.1|1342405_1343062_+	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	42.1	1.6e-36
WP_011908352.1|1343058_1343466_+	hypothetical protein	NA	G8DH57	Emiliania_huxleyi_virus	54.8	1.1e-32
WP_011908353.1|1343462_1347128_+	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	41.8	2.3e-137
WP_011908354.1|1347127_1347721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248198.1|1347717_1349010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908356.1|1349018_1349351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908357.1|1349350_1350403_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	36.9	1.9e-55
WP_011908358.1|1350470_1350821_+	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	56.0	2.4e-28
WP_152334770.1|1350813_1351110_+	hypothetical protein	NA	A0A1I9KFG3	Aeromonas_phage	64.1	1.9e-13
WP_011908359.1|1351109_1352210_+	RNA-directed DNA polymerase	NA	D4HTV9	Vibrio_phage	49.8	3.5e-89
WP_085996560.1|1352464_1352986_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_011908361.1|1353013_1353835_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.7	5.8e-20
WP_011908362.1|1353831_1354164_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_011908363.1|1354160_1355108_+	D-glycerate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	27.6	2.4e-17
WP_011908364.1|1361631_1361823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908365.1|1362035_1363112_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011908366.1|1363692_1364730_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.0	5.1e-74
WP_011908367.1|1364722_1365715_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.6	4.8e-45
WP_011908368.1|1365698_1367582_+	glycosyltransferase	NA	M1GWE6	Acanthocystis_turfacea_Chlorella_virus	41.1	5.3e-77
WP_085996605.1|1367624_1368509_+	beta-mannosidase	NA	NA	NA	NA	NA
WP_044247992.1|1368729_1369014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908370.1|1369114_1370254_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011908371.1|1370250_1371285_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011908372.1|1371281_1372154_+	3-hydroxyisobutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	31.3	1.6e-20
WP_011908373.1|1372341_1373019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908374.1|1373131_1374442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908375.1|1374438_1375557_-	AAA family ATPase	NA	A0A223W083	Agrobacterium_phage	34.7	8.1e-25
WP_011908376.1|1375867_1377355_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011908377.1|1377351_1377789_+	response regulator	NA	NA	NA	NA	NA
WP_011908378.1|1377785_1378838_+	response regulator	NA	NA	NA	NA	NA
WP_011908379.1|1378920_1380330_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011908380.1|1380411_1380750_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_044247996.1|1380948_1381623_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_044247998.1|1381619_1382447_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_011908381.1|1382463_1382934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908382.1|1383243_1384578_+	trigger factor	NA	NA	NA	NA	NA
WP_011908383.1|1384780_1385350_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002720283.1|1385360_1385588_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011908384.1|1385608_1386007_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
1386198:1386239	attL	GCTCCGGCGGGTTGGCGGAGAGGTTACGCAGCGGATTGCAAA	NA	NA	NA	NA
WP_011908385.1|1386542_1386827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908386.1|1386823_1388236_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	43.9	4.5e-97
WP_152334771.1|1388724_1388955_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011908388.1|1389039_1390221_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	30.3	4.8e-36
WP_011908389.1|1390210_1390606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908390.1|1390605_1391121_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PIR7	Moraxella_phage	39.4	2.6e-18
WP_011908391.1|1391120_1392278_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	33.2	3.1e-51
WP_152334772.1|1392289_1392649_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6G2	Thiobacimonas_phage	48.1	4.0e-18
WP_011908393.1|1392661_1393039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908394.1|1393038_1393395_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	55.8	9.5e-20
WP_011908395.1|1393394_1393874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908396.1|1393878_1394343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908397.1|1394352_1394664_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011908398.1|1394663_1395077_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_011908399.1|1395073_1395487_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011908400.1|1395486_1395810_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_011908401.1|1395809_1396241_+|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	34.5	6.3e-10
WP_011908402.1|1396237_1397845_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	34.8	7.2e-75
WP_011908403.1|1397854_1400239_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	53.3	1.5e-55
WP_011908404.1|1400242_1400596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908405.1|1400600_1401128_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044248004.1|1401184_1401445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908406.1|1401441_1401873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248006.1|1401936_1402140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334791.1|1402463_1403147_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011908408.1|1403632_1404856_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
1403231:1403272	attR	GCTCCGGCGGGTTGGCGGAGAGGTTACGCAGCGGATTGCAAA	NA	NA	NA	NA
WP_011908409.1|1405025_1406069_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_011908410.1|1406171_1407191_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011908411.1|1407218_1408019_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011908412.1|1408011_1408902_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011908414.1|1410445_1412413_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044248674.1|1412399_1413260_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011908416.1|1413256_1414246_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011908417.1|1414242_1414995_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.1	2.9e-10
WP_011908418.1|1414991_1415636_+	adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
WP_011908419.1|1415702_1416704_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011908420.1|1417057_1418029_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011908421.1|1418492_1419992_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011908422.1|1420094_1420988_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011908423.1|1421038_1421473_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011908424.1|1421542_1422031_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	48.1	1.2e-33
WP_011908425.1|1422116_1422272_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_011908426.1|1422511_1423273_+	MotA/TolQ/ExbB proton channel	NA	NA	NA	NA	NA
WP_011908427.1|1423280_1424384_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011908428.1|1424588_1424996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908429.1|1425015_1426860_+	flagellin biosynthesis protein FlgM	NA	NA	NA	NA	NA
WP_011908430.1|1426983_1427970_+	hemin-degrading factor	NA	NA	NA	NA	NA
WP_044248009.1|1428173_1428395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908432.1|1428507_1429701_+	cytochrome	NA	NA	NA	NA	NA
WP_011908433.1|1429815_1430388_-	YceI family protein	NA	NA	NA	NA	NA
WP_011908434.1|1430815_1431979_-	MFS transporter	NA	NA	NA	NA	NA
WP_011908435.1|1431975_1432689_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.6	9.9e-85
WP_011908436.1|1432685_1433723_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011908437.1|1433722_1434166_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011908438.1|1434158_1434491_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011908439.1|1434722_1435001_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	41.9	1.9e-12
WP_011908440.1|1434997_1435996_+	permease	NA	NA	NA	NA	NA
WP_011908441.1|1436011_1436239_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011908442.1|1436352_1437165_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_011908443.1|1437164_1438172_+	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044248683.1|1438281_1439517_+	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_152334792.1|1439999_1441052_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.9	3.5e-38
WP_011908446.1|1441876_1443982_-	TniQ family protein	NA	NA	NA	NA	NA
WP_085996597.1|1444553_1444853_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517426.1|1444750_1445104_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085996597.1|1445250_1445550_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011907237.1|1445546_1445900_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011907238.1|1445968_1447540_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
>prophage 7
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	1463931	1515882	3217726	tRNA,protease,transposase	Bacillus_phage(37.5%)	50	NA	NA
WP_011908457.1|1463931_1465578_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_080517427.1|1466284_1467496_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	26.6	7.2e-11
WP_011908460.1|1467826_1469044_-|transposase	IS5-like element ISRhsp7 family transposase	transposase	NA	NA	NA	NA
WP_080517428.1|1470451_1470673_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011908466.1|1473189_1474131_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011908467.1|1474171_1475491_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_044248024.1|1475576_1476044_-	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	33.1	5.1e-13
WP_011908469.1|1476109_1476769_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_011908470.1|1476765_1478454_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011908471.1|1478450_1479656_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044248026.1|1479768_1480377_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011908473.1|1480520_1481153_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	61.5	1.8e-61
WP_011908474.1|1481277_1482543_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	4.1e-134
WP_011908475.1|1482668_1483043_+	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_011908476.1|1483042_1483513_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011908477.1|1483509_1483881_+	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_011908478.1|1483829_1484474_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011908479.1|1484493_1485840_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011908480.1|1485847_1486339_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_085996561.1|1486609_1487947_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011908482.1|1488010_1488550_+	DedA family protein	NA	NA	NA	NA	NA
WP_011908483.1|1488622_1489927_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_011908484.1|1489939_1490551_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011908485.1|1490716_1491349_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011908486.1|1491484_1492744_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_011908487.1|1492870_1494322_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_011908488.1|1494321_1495119_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011908489.1|1495128_1495992_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011908490.1|1495988_1496840_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011908491.1|1496868_1497849_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011908492.1|1497982_1499764_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_011908493.1|1499832_1500774_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_011908494.1|1500990_1501734_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.9e-17
WP_011908495.1|1501743_1502589_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011908496.1|1502708_1503995_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011908497.1|1504122_1504491_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.7e-16
WP_011908498.1|1504487_1504778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908499.1|1504777_1507462_+	sodium:solute symporter	NA	W8CYF6	Bacillus_phage	28.7	2.2e-20
WP_044248030.1|1507517_1508468_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_011908501.1|1508478_1508910_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_011908502.1|1509079_1509397_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_152334793.1|1509384_1509603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908504.1|1509667_1509883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908505.1|1510042_1510297_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	76.6	4.1e-25
WP_011908506.1|1510470_1512144_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011908507.1|1512448_1512922_-	CinA family protein	NA	NA	NA	NA	NA
WP_011908508.1|1512918_1513416_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_011908509.1|1513412_1513892_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011908510.1|1514010_1514688_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011908511.1|1514901_1515882_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 8
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	1767787	1799435	3217726	portal,tail,capsid,head,terminase,integrase	Rhodobacter_phage(41.67%)	51	1770099:1770143	1807408:1807452
WP_011908741.1|1767787_1768561_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.7e-10
WP_085996613.1|1768560_1769625_-	MlaE family lipid ABC transporter permease subunit	NA	NA	NA	NA	NA
1770099:1770143	attL	TTTACACCGAGGATGTCGGGGGTTCGAGCCCCTCACCACCCACCA	NA	NA	NA	NA
WP_011908743.1|1770206_1771205_-|integrase	site-specific integrase	integrase	A0A1B1IVT4	uncultured_Mediterranean_phage	25.7	3.4e-06
WP_011908744.1|1771356_1771626_-	DUF4031 domain-containing protein	NA	D4FUN1	Pseudomonas_phage	56.5	1.8e-18
WP_011908745.1|1771622_1771874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908746.1|1771870_1772515_-	HNH endonuclease	NA	A0A1S5SEZ9	Streptococcus_phage	38.7	9.1e-21
WP_011908747.1|1772511_1772751_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	52.2	1.5e-08
WP_011908748.1|1772747_1773053_-	hypothetical protein	NA	A0A1B0T6L5	Pelagibaca_phage	36.7	2.5e-05
WP_011908749.1|1773045_1773390_-	DUF4326 domain-containing protein	NA	A0A088FBM0	Mycobacterium_phage	44.3	1.8e-20
WP_044248098.1|1773382_1773622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908750.1|1773614_1774805_-	phage Gp37/Gp68 family protein	NA	I3UM26	Rhodobacter_phage	48.6	2.5e-93
WP_052292673.1|1774797_1775076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248100.1|1775077_1775257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908752.1|1775249_1775738_-	restriction alleviation protein, Lar family	NA	L7TKP8	Pseudomonas_virus	41.6	3.5e-25
WP_011908753.1|1775724_1775982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908754.1|1775978_1776242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908755.1|1776246_1776633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085996567.1|1776629_1776776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248740.1|1777006_1777282_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	68.9	4.4e-25
WP_011908757.1|1777398_1777722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248103.1|1777718_1777958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908758.1|1777954_1778434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908759.1|1778646_1779381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248107.1|1779501_1779861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334796.1|1780096_1780357_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152334775.1|1780467_1780692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908763.1|1780691_1781030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908764.1|1781026_1781269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908765.1|1781581_1782055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908766.1|1782051_1782345_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011908767.1|1782334_1782979_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_011908768.1|1783198_1783792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248743.1|1783791_1784460_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	40.4	8.0e-36
WP_044248112.1|1784567_1784933_+	HNH endonuclease	NA	I3ULZ4	Rhodobacter_phage	76.7	5.3e-34
WP_011908771.1|1785026_1785521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908772.1|1785520_1787233_+|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	45.7	6.0e-128
WP_011908773.1|1787235_1788498_+|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	65.7	4.8e-159
WP_011908774.1|1788509_1789454_+	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	67.0	1.8e-102
WP_011908775.1|1789456_1790764_+|capsid	phage major capsid protein	capsid	I3ULZ9	Rhodobacter_phage	73.0	7.9e-173
WP_011908776.1|1790831_1791293_+	hypothetical protein	NA	I3UM00	Rhodobacter_phage	69.1	9.6e-49
WP_011908777.1|1791507_1791990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908778.1|1791989_1792346_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011908779.1|1792342_1792750_+	DUF3168 domain-containing protein	NA	A0A141GEW7	Brucella_phage	44.8	3.4e-21
WP_011908780.1|1792891_1793335_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	37.9	1.3e-15
WP_152334776.1|1793388_1793847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248114.1|1793843_1794260_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_152334777.1|1794427_1794988_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	45.6	5.5e-06
WP_011908783.1|1795010_1797776_+|tail	phage tail tape measure protein	tail	A0A2H4GY14	Pseudomonas_phage	39.4	3.6e-42
WP_011908784.1|1797775_1798435_+	hypothetical protein	NA	I3UM12	Rhodobacter_phage	51.6	1.2e-52
WP_011908785.1|1798431_1799019_+	hypothetical protein	NA	I3UM13	Rhodobacter_phage	47.3	6.3e-45
WP_052292660.1|1799015_1799435_+	hypothetical protein	NA	I3UM14	Rhodobacter_phage	46.7	1.4e-30
1807408:1807452	attR	TTTACACCGAGGATGTCGGGGGTTCGAGCCCCTCACCACCCACCA	NA	NA	NA	NA
>prophage 9
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	1845386	1870786	3217726	transposase	Bacillus_phage(25.0%)	23	NA	NA
WP_152334798.1|1845386_1845830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011908822.1|1845795_1847079_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.3	1.4e-20
WP_044248129.1|1849154_1849607_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_080517433.1|1850419_1850656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908826.1|1851043_1851445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085996597.1|1851664_1851964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011907237.1|1851960_1852314_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011908828.1|1853475_1854207_-	ATPase AAA	NA	K4HZD4	Acidithiobacillus_phage	52.1	8.9e-65
WP_152334779.1|1854219_1855737_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	49.6	1.6e-132
WP_044248131.1|1856718_1857180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011907123.1|1857249_1858209_+|transposase	IS481 family transposase	transposase	A0A126QCH6	Murine_leukemia_virus	31.2	8.0e-05
WP_011908832.1|1859333_1859732_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	64.1	1.5e-45
WP_044248133.1|1859745_1859946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248135.1|1860014_1860293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908834.1|1860289_1860928_-	exonuclease	NA	K7ZRM9	Xanthomonas_citri_phage	48.3	2.6e-44
WP_011908835.1|1860924_1861662_-	DNA single-strand annealing protein	NA	K7ZLF1	Xanthomonas_citri_phage	36.9	2.2e-26
WP_080517434.1|1862490_1862913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334799.1|1863007_1865806_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_044248138.1|1866158_1866746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334780.1|1867247_1867451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908839.1|1867541_1867796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908840.1|1867800_1868109_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011908822.1|1869502_1870786_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.3	1.4e-20
>prophage 10
NC_009428	Rhodobacter sphaeroides ATCC 17025, complete genome	3217726	2122461	2159351	3217726	head,terminase,integrase,transposase	Rhodobacter_phage(29.41%)	48	2126924:2126940	2166641:2166657
WP_011908357.1|2122461_2123514_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	36.9	1.9e-55
WP_011908356.1|2123513_2123846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044248198.1|2123854_2125147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908354.1|2125143_2125737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908353.1|2125736_2129402_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	41.8	2.3e-137
2126924:2126940	attL	CCGAGATGCGCGCCACC	NA	NA	NA	NA
WP_011908352.1|2129398_2129806_-	hypothetical protein	NA	G8DH57	Emiliania_huxleyi_virus	54.8	1.1e-32
WP_011908351.1|2129802_2130459_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	42.1	1.6e-36
WP_011908350.1|2130463_2131120_-	hypothetical protein	NA	G8DH55	Emiliania_huxleyi_virus	43.7	1.9e-34
WP_011908349.1|2131119_2133327_-	hypothetical protein	NA	A0A1B0T6D4	Thiobacimonas_phage	31.5	3.3e-22
WP_011908348.1|2133323_2133611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908347.1|2133676_2134006_-	hypothetical protein	NA	G8EY05	Synechococcus_phage	36.6	3.8e-07
WP_011908346.1|2134025_2134958_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	53.5	1.3e-92
WP_011908345.1|2135099_2135531_-	hypothetical protein	NA	M4SNT0	Rhodobacter_phage	39.4	1.6e-21
WP_011908344.1|2135530_2135959_-	DUF1320 domain-containing protein	NA	M4SPQ8	Rhodobacter_phage	50.7	1.5e-32
WP_011908343.1|2136062_2136458_-	hypothetical protein	NA	A0A1B0T6E5	Thiobacimonas_phage	64.4	7.5e-10
WP_011908342.1|2136467_2137364_-|head	head protein	head	M4SRT6	Rhodobacter_phage	74.5	8.2e-129
WP_011908341.1|2137375_2137822_-	hypothetical protein	NA	M4ST95	Rhodobacter_phage	63.1	7.9e-40
WP_052292669.1|2137821_2138829_-	hypothetical protein	NA	M4SNT6	Rhodobacter_phage	49.1	2.0e-70
WP_152334769.1|2138978_2139548_-	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	45.8	1.2e-32
WP_044248655.1|2139472_2140696_-|head	phage head protein	head	A0A1B0T6H8	Thiobacimonas_phage	69.6	3.9e-105
WP_011908337.1|2140682_2142314_-	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	60.5	6.9e-182
WP_011908336.1|2142315_2142660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908335.1|2142659_2144090_-|terminase	terminase	terminase	A0A1B1P714	Rhodovulum_phage	80.9	7.0e-207
WP_152334768.1|2144086_2144755_-	DUF2786 domain-containing protein	NA	G8GWD1	Rhodobacter_phage	65.3	7.1e-69
WP_011908333.1|2144751_2145291_-	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	78.8	3.3e-72
WP_011908332.1|2145292_2145598_-	hypothetical protein	NA	A0A1B1P718	Rhodovulum_phage	58.4	6.6e-22
WP_011908331.1|2145594_2145945_-	DUF2730 family protein	NA	A0A1B0T6K8	Pelagibaca_phage	47.9	1.1e-17
WP_011908330.1|2145941_2146373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908329.1|2146385_2147258_-	SH3 domain-containing protein	NA	A0A1B0T6L3	Pelagibaca_phage	64.1	4.1e-101
WP_011908328.1|2147446_2148493_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	25.4	3.8e-24
WP_011908327.1|2148516_2148888_-	hypothetical protein	NA	M4SNV1	Rhodobacter_phage	54.0	3.4e-28
WP_011908326.1|2148884_2149490_-	S-adenosylmethionine-binding protein	NA	M4SPS7	Rhodobacter_phage	67.5	1.9e-73
WP_011908324.1|2149794_2150232_-	regulatory protein GemA	NA	A0A1B1P720	Rhodovulum_phage	67.1	1.1e-46
WP_044247979.1|2150228_2150462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044247978.1|2150465_2150663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908322.1|2150670_2151333_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	70.4	1.1e-85
WP_011908321.1|2151513_2151975_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011908320.1|2151971_2152352_-	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	57.1	9.1e-37
WP_011908319.1|2152348_2152930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908318.1|2152932_2153715_-	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	47.3	2.1e-59
WP_011908317.1|2153759_2155877_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P6Z4	Rhodovulum_phage	46.9	4.6e-186
WP_011908316.1|2155873_2156740_-	chromosome partitioning protein ParB	NA	A0A1B0T6M1	Pelagibaca_phage	62.7	2.1e-84
WP_011908315.1|2156741_2157026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011908314.1|2157025_2157301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334767.1|2157526_2157937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044248651.1|2157985_2158249_-	DNA-binding protein	NA	Q2A099	Sodalis_phage	41.2	3.5e-11
WP_011909090.1|2158269_2158569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011909091.1|2158655_2159351_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6N0	Pelagibaca_phage	49.8	6.1e-55
2166641:2166657	attR	CCGAGATGCGCGCCACC	NA	NA	NA	NA
>prophage 1
NC_009429	Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence	877879	327348	448267	877879	transposase	Leptospira_phage(16.0%)	83	NA	NA
WP_011910385.1|327348_327654_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011910387.1|328602_329820_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_011910388.1|329833_330040_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011910389.1|330042_330453_-	hypothetical protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.5	1.8e-06
WP_011910390.1|330454_330859_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_011910391.1|331332_332373_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_044249223.1|332480_332663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044249225.1|332667_333219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910393.1|333462_335268_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011910394.1|336035_337526_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	65.9	3.2e-170
WP_011910395.1|337537_338383_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.6	4.2e-50
WP_011910396.1|338692_339370_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_011910397.1|339711_340788_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_152334814.1|340817_342059_-	MFS transporter	NA	NA	NA	NA	NA
WP_011910399.1|342042_345096_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	19.2	1.4e-34
WP_011910400.1|345092_346178_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011910401.1|346174_346897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910403.1|347675_349478_+	SLC13 family permease	NA	Q6A201	Oenococcus_phage	32.5	5.0e-16
WP_044249232.1|351514_352798_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.1	2.4e-12
WP_011910409.1|353922_355131_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.0	5.5e-35
WP_152334815.1|356197_356662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011910412.1|357084_360924_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.2	6.2e-40
WP_011910413.1|360916_361480_-	YdcF family protein	NA	NA	NA	NA	NA
WP_011910414.1|361893_363252_-	GntP family permease	NA	NA	NA	NA	NA
WP_011910415.1|363812_364685_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011910416.1|365060_365333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910419.1|367419_368151_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011910420.1|368327_368567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334816.1|368690_369467_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_085996635.1|370051_378379_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_044249235.1|378437_378710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044249237.1|378715_379033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146172353.1|379599_379944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249243.1|379940_380333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910425.1|381872_382475_-	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	37.7	2.2e-32
WP_011907378.1|382699_383512_-	ATPase AAA	NA	A0A059NT77	Lactococcus_phage	36.0	1.2e-33
WP_080517471.1|385123_385573_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	51.2	3.0e-31
WP_011910429.1|387141_387645_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.9	2.4e-16
WP_011910430.1|387644_387932_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_152334817.1|387952_388309_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_044247894.1|388375_388780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517472.1|388776_388995_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011910433.1|389261_390314_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011910435.1|391745_392123_-	response regulator	NA	NA	NA	NA	NA
WP_080517473.1|392188_394003_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_080517474.1|393704_395714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910438.1|397869_398787_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011910439.1|398926_401188_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	65.3	2.7e-285
WP_011907238.1|401866_403438_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011907237.1|403506_403860_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085996597.1|403856_404156_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011908822.1|405243_406527_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.1	2.4e-12
WP_152334840.1|406492_406999_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	46.3	5.0e-14
WP_044249253.1|407127_407784_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_080517476.1|407776_408946_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011910447.1|409688_411662_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011910448.1|411658_413512_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_011910449.1|414018_414855_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_011910450.1|415444_417355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249255.1|417461_417932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334841.1|418587_421374_+	DUF3427 domain-containing protein	NA	A0A2I5ARD8	Synechococcus_phage	34.5	1.3e-39
WP_152334818.1|421285_421555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910455.1|422545_423991_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	30.8	5.8e-23
WP_011910456.1|423996_426444_-	DEAD/DEAH box helicase	NA	Q6NDX2	Leptospira_phage	27.1	4.5e-20
WP_011910457.1|427152_428511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910458.1|428597_429458_+	exonuclease	NA	NA	NA	NA	NA
WP_011910459.1|429640_430489_+|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	41.5	1.5e-47
WP_080517477.1|431668_431890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910461.1|432257_432692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910463.1|433003_433243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052292687.1|433617_433914_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	51.2	3.0e-11
WP_011910466.1|436774_437269_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_044249521.1|437540_437891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910468.1|438079_439207_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	7.2e-21
WP_011910469.1|439203_440109_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011910470.1|440108_440921_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011910471.1|440942_442226_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011910472.1|442293_443094_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_011910473.1|443125_443710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908822.1|445337_446621_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.1	2.4e-12
WP_152334842.1|446586_447093_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	45.1	8.5e-14
WP_011910475.1|447148_447373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011910476.1|447448_448267_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	7.2e-63
>prophage 2
NC_009429	Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence	877879	600655	675530	877879	protease,integrase,transposase	Stx2-converting_phage(29.17%)	63	669735:669794	693533:693718
WP_011910610.1|600655_601006_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.3	2.1e-27
WP_044249316.1|601063_602623_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.4	3.8e-105
WP_080517452.1|602684_603707_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011910612.1|603986_604589_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.8	5.7e-17
WP_080517481.1|604540_604765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152334826.1|604748_605855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910615.1|605943_606363_+	hypothetical protein	NA	G8DH50	Emiliania_huxleyi_virus	60.0	4.8e-39
WP_011910616.1|606387_607326_+	hypothetical protein	NA	G8DH51	Emiliania_huxleyi_virus	58.3	5.1e-97
WP_011910617.1|607337_607775_+	hypothetical protein	NA	G8DH52	Emiliania_huxleyi_virus	37.9	1.2e-11
WP_011910618.1|608029_610492_+	hypothetical protein	NA	A0A0U4JEA4	Pseudomonas_phage	53.0	1.6e-49
WP_011910619.1|610491_611118_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	54.6	1.1e-58
WP_011910620.1|611130_611421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910621.1|611441_612092_+	lysozyme	NA	F8TV87	EBPR_siphovirus	47.8	3.0e-40
WP_044249324.1|612088_612298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910622.1|612294_613179_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	45.0	1.4e-67
WP_011910623.1|613175_613622_+	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	48.1	1.5e-27
WP_011907238.1|617042_618614_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011907237.1|618682_619036_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085996597.1|619032_619332_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085996597.1|621640_621940_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011907237.1|621936_622290_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011907238.1|622358_623930_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011910628.1|624319_625903_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.2	3.7e-92
WP_011910629.1|625955_626309_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.9	1.0e-18
WP_011910632.1|627474_628449_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011910633.1|628474_630586_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_011910634.1|630597_633105_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_011910635.1|633097_636622_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_011910636.1|636621_637122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249327.1|637118_638306_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011910638.1|641829_642432_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_011910639.1|642428_643049_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_011910640.1|643045_643918_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_011910641.1|644039_645194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	36.5	7.8e-47
WP_011910642.1|645334_646852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011908457.1|647276_648923_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011907123.1|649648_650608_+|transposase	IS481 family transposase	transposase	A0A126QCH6	Murine_leukemia_virus	31.2	8.0e-05
WP_011910643.1|650939_651596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334848.1|651595_652267_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_011910645.1|652277_653222_+	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_011910646.1|653389_654355_-	helicase	NA	A0A0H5AWB1	Pseudomonas_phage	35.5	3.1e-41
WP_080517482.1|654357_655140_-	hypothetical protein	NA	F1C598	Cronobacter_phage	38.6	1.9e-36
WP_152334827.1|655911_656583_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011910650.1|656597_658247_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.5	1.3e-31
WP_085996639.1|658918_659425_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044249334.1|659441_659888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910653.1|659891_660611_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.0	3.1e-25
WP_011910654.1|660621_661488_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_011910655.1|661491_662325_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_044249337.1|662324_663332_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011910657.1|663433_663697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910658.1|664142_664619_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_085996597.1|665166_665466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011907237.1|665462_665816_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011907238.1|665884_667456_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_152334828.1|668417_669881_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.9	4.9e-38
669735:669794	attL	CACGAATGGCTGGACCTCTACATCTTCGAAACCATCGAGGAGGTGCAGCGGACCGCCACC	NA	NA	NA	NA
WP_044249570.1|670571_671480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011910665.1|671904_672090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910666.1|672154_672496_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_152334849.1|672648_672771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044249341.1|672857_673238_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	32.8	5.2e-08
WP_152334829.1|674953_675253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_152334850.1|675170_675530_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
693533:693718	attR	GGTGGCGGTCCGCTGCACCTCCTCGATGGTTTCGAAGATGTAGAGGTCCAGCCATTCGTGTCAACGCCGACACAAATTTCCCCAGAAGTGCCGAAGTAAAATTCCCCACTTCGGCGGGTCCGGCAATCAGCCGGGGTCAGTGATTGGCAGCTCCATTTTTGATTTTCGGCGGCCGCCCCCGGCGCT	NA	NA	NA	NA
>prophage 1
NC_009430	Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence	289489	37867	76231	289489	transposase,integrase	Wolbachia_phage(28.57%)	28	18081:18096	46914:46929
18081:18096	attL	CGAGGCGATCGACATG	NA	NA	NA	NA
WP_011911080.1|37867_38353_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517492.1|38381_39119_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011911078.1|39140_40190_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	29.0	3.9e-05
WP_011911077.1|40353_40935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080517493.1|41261_41558_+	transketolase	NA	NA	NA	NA	NA
WP_011911073.1|42679_43963_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011911072.1|44476_45472_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.3	1.0e-39
WP_011911071.1|45474_46353_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_011911070.1|46413_48387_+	transketolase	NA	NA	NA	NA	NA
46914:46929	attR	CGAGGCGATCGACATG	NA	NA	NA	NA
WP_011911069.1|48397_49399_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011911068.1|49479_50544_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_011911067.1|50570_51956_+	ribulose-bisphosphate carboxylase	NA	NA	NA	NA	NA
WP_044249665.1|52094_53411_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011911065.1|53420_53774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044249667.1|59882_60182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334857.1|60909_61227_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	47.9	7.7e-05
WP_011911055.1|61326_62739_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	33.3	1.0e-61
WP_011911062.1|62823_63063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334858.1|64349_65171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011911058.1|65167_65554_-	FixH family protein	NA	NA	NA	NA	NA
WP_044249669.1|65573_66677_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_152334859.1|66809_67196_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_011911055.1|67303_68716_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	33.3	1.0e-61
WP_011911054.1|68718_71703_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_011911053.1|71927_72497_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_152334872.1|72597_74163_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_101341203.1|74236_74707_-	dUTP diphosphatase	NA	G9E5L4	Ostreococcus_lucimarinus_virus	49.7	4.9e-32
WP_011911050.1|74884_76231_-|transposase	IS5-like element ISRhsp1 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	45.7	8.5e-53
>prophage 1
NC_009431	Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence	121962	10910	66723	121962	transposase,protease	Morganella_phage(18.18%)	50	NA	NA
WP_152334877.1|10910_11786_-|protease	viral aspartic protease	protease	NA	NA	NA	NA
WP_011911122.1|12041_13280_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_152334885.1|13586_13871_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_011911124.1|14080_14584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011911125.1|14698_15466_+	7-alpha-hydroxysteroid dehydrogenase	NA	A0A0M4JSW6	Mollivirus	34.4	5.6e-09
WP_011911126.1|15506_16301_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_152334878.1|16263_16674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011911127.1|16858_17065_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	54.0	2.7e-11
WP_011911128.1|17316_17691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249854.1|17787_18063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334879.1|18327_18600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249857.1|18586_18796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011911130.1|18992_19229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249885.1|19951_20287_-	DUF2218 domain-containing protein	NA	NA	NA	NA	NA
WP_011911132.1|20412_21294_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044249859.1|21290_22238_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	38.4	1.9e-46
WP_011911134.1|22230_23175_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_011911135.1|23171_23930_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	31.7	2.1e-16
WP_011911136.1|24083_26018_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011911138.1|26873_27569_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011911139.1|27661_28411_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_152334886.1|28737_30324_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011911141.1|30388_32872_+	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_044249865.1|33048_33984_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011911143.1|34212_34653_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_011911145.1|35334_37002_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_152334887.1|37262_37901_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011911147.1|37981_40792_+	EAL domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	33.7	3.4e-19
WP_152334880.1|40916_42464_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
WP_101342038.1|42584_44609_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.0	1.8e-14
WP_011911150.1|44881_46186_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011911151.1|46175_46604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011911153.1|48767_50831_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	4.0e-09
WP_011911155.1|52622_52829_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	54.0	7.9e-11
WP_152334888.1|52943_53222_+	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_080517502.1|53385_53610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044249869.1|53651_54035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011911160.1|55612_55837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011911161.1|55833_56226_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_011911162.1|56324_57005_+	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	45.4	5.6e-37
WP_152334881.1|58746_59310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152334882.1|59290_59971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085996646.1|59967_60162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044249872.1|60228_60441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085996597.1|60609_60909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011911165.1|60905_61259_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011907238.1|61327_62899_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011907238.1|64433_66005_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.0	4.4e-77
WP_011907237.1|66073_66427_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085996597.1|66423_66723_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_009433	Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA05, complete sequence	13873	143	7366	13873	transposase	Stx2-converting_phage(33.33%)	9	NA	NA
WP_011911245.1|143_824_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	41.9	1.2e-31
WP_152334897.1|1345_1606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152334898.1|1607_1904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085996643.1|2185_3410_+|transposase	IS3-like element ISRhsp2 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	50.0	3.4e-69
WP_044249966.1|3651_4311_+	recombinase family protein	NA	A0A2I7REZ1	Vibrio_phage	42.2	3.1e-40
WP_011911247.1|4365_4674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011910612.1|4760_5363_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.8	5.7e-17
WP_044249971.1|5359_6958_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.3	5.4e-107
WP_011910610.1|7015_7366_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.3	2.1e-27
