The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	588273	612652	5619607	integrase,transposase	Acanthamoeba_polyphaga_mimivirus(33.33%)	19	596843:596858	616003:616018
WP_085977995.1|588273_589502_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036349499.1|589576_590701_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_011891540.1|591078_591576_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011777805.1|591569_592751_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011855460.1|592747_593833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011559050.1|593847_594873_-	2,3-butanediol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.5	3.1e-15
WP_041799743.1|594930_595758_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_011855462.1|595777_597154_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
596843:596858	attL	ACCACGGTGGCGACAA	NA	NA	NA	NA
WP_011891542.1|597216_597726_-	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011891543.1|598283_599744_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011767827.1|599939_600230_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011559041.1|600226_601999_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_011777800.1|602121_602631_-	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_085976237.1|603662_604855_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
WP_085981117.1|604993_606222_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011891548.1|607548_609192_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011777793.1|609216_609531_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011777792.1|609527_610595_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_110797900.1|611755_612652_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.7	1.9e-16
616003:616018	attR	ACCACGGTGGCGACAA	NA	NA	NA	NA
>prophage 2
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	624742	641999	5619607	integrase,transposase	Mycobacterium_phage(20.0%)	12	629579:629594	638909:638924
WP_011891562.1|624742_626149_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	44.3	2.7e-86
WP_085981119.1|627985_629132_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	2.7e-31
629579:629594	attL	TCAGATCGGATGAGAA	NA	NA	NA	NA
WP_063840634.1|629737_630133_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011891568.1|630129_632097_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.2	2.9e-102
WP_085977995.1|632310_633539_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011891571.1|634140_635004_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011891572.1|635006_636020_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_036372924.1|636007_637960_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_109489628.1|638097_638727_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_011891575.1|638908_639373_-|transposase	transposase	transposase	U5P429	Shigella_phage	30.5	1.2e-09
638909:638924	attR	TCAGATCGGATGAGAA	NA	NA	NA	NA
WP_041799750.1|639785_640016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085976237.1|640807_641999_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
>prophage 3
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	685483	748811	5619607	transposase	Corynebacterium_phage(42.86%)	52	NA	NA
WP_085981120.1|685483_686765_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.6	8.9e-60
WP_011891543.1|687422_688883_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011767827.1|689078_689369_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011559041.1|689365_691138_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_011777800.1|691260_691770_-	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011891550.1|694208_695234_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_011559038.1|695401_695788_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011891551.1|695833_696724_-	VOC family protein	NA	NA	NA	NA	NA
WP_011891552.1|696742_697741_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_011891592.1|698668_699904_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.1	8.5e-108
WP_011891554.1|700881_702123_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011891555.1|702119_702320_-	ferredoxin	NA	NA	NA	NA	NA
WP_011891556.1|702348_703152_-	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_011891557.1|703148_703454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891594.1|703450_704047_-	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011891595.1|704043_705498_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011891596.1|705972_706773_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011777780.1|706772_707276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011891597.1|707717_708953_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.1	1.0e-81
WP_011891598.1|709290_710343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011891602.1|712306_712750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891603.1|713908_714676_+	pirin family protein	NA	NA	NA	NA	NA
WP_011891604.1|714653_715985_+	gluconolaconase	NA	NA	NA	NA	NA
WP_011891605.1|716114_717221_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_011891606.1|717617_718019_-	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
WP_041799755.1|718717_719953_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.5	6.1e-82
WP_011891609.1|720816_721746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891610.1|721712_722285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891611.1|722281_723265_-	RDD family protein	NA	NA	NA	NA	NA
WP_011891612.1|723261_723891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891613.1|723860_725423_-	MCE family protein	NA	NA	NA	NA	NA
WP_011891614.1|725426_726572_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_011891615.1|726568_728200_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_011891616.1|728212_729784_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_011891617.1|729780_730812_-	virulence factor Mce family protein	NA	NA	NA	NA	NA
WP_011891618.1|730808_732026_-	MCE family protein	NA	NA	NA	NA	NA
WP_011891619.1|732031_732904_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011891620.1|732905_733703_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049777181.1|733916_735599_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.6	1.3e-31
WP_041799757.1|735742_736429_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_011891623.1|736436_736877_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011891624.1|736914_737643_-	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	30.0	4.2e-22
WP_011891625.1|737693_738785_+	peptidase M42	NA	NA	NA	NA	NA
WP_013470333.1|738768_739437_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041799759.1|739670_740105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891628.1|740162_740972_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	1.3e-24
WP_011891629.1|740955_741993_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041799761.1|741989_742862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011891631.1|742927_744019_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011891632.1|744198_745746_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_011891633.1|745758_747198_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011891634.1|747263_748811_+|transposase	IS1182-like element ISMgi4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	3364869	3383240	5619607	integrase,transposase	Red_sea_bream_iridovirus(16.67%)	12	3354447:3354463	3387608:3387624
3354447:3354463	attL	TCGGTCAGCAGATCGGT	NA	NA	NA	NA
WP_036372924.1|3364869_3366822_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_109489628.1|3366959_3367589_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_085981130.1|3368294_3370004_+	macro domain-containing protein	NA	F1SVT2	Red_sea_bream_iridovirus	45.7	4.7e-24
WP_041799926.1|3370170_3371526_-|transposase	IS1380-like element ISMgi1 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	92.2	4.1e-241
WP_011894058.1|3371898_3372879_+	hypothetical protein	NA	A0A1P8DIG7	Virus_Rctr197k	54.0	2.4e-12
WP_085975375.1|3373353_3374492_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.8	6.3e-33
WP_011894059.1|3374748_3375219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041800102.1|3375295_3375559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011891592.1|3375727_3376963_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.1	8.5e-108
WP_011894061.1|3376959_3378357_-	GTPase domain-containing protein	NA	NA	NA	NA	NA
WP_041800104.1|3378349_3382021_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_085978014.1|3382078_3383240_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.5	5.4e-32
3387608:3387624	attR	TCGGTCAGCAGATCGGT	NA	NA	NA	NA
>prophage 5
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	4574893	4583556	5619607		Lactococcus_phage(14.29%)	9	NA	NA
WP_041800248.1|4574893_4577062_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	8.2e-207
WP_011895150.1|4577028_4577475_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	31.7	5.0e-10
WP_013472213.1|4577525_4577780_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	67.6	3.6e-21
WP_011895152.1|4578360_4578912_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.4	5.8e-08
WP_085978064.1|4579029_4579626_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011895154.1|4579622_4580696_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	29.6	3.3e-23
WP_011895155.1|4580749_4581466_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011895156.1|4581513_4582680_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	34.9	1.6e-52
WP_011895157.1|4582683_4583556_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.9	6.6e-06
>prophage 6
NC_009338	Mycolicibacterium gilvum PYR-GCK, complete sequence	5619607	4918194	4943604	5619607	integrase,transposase	Acinetobacter_phage(75.0%)	19	4935243:4935302	4946102:4946409
WP_085976237.1|4918194_4919386_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
WP_011895461.1|4919771_4921064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_131805205.1|4921082_4921382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011895462.1|4921848_4922748_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011895463.1|4922800_4923235_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_011895464.1|4923283_4923877_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041800306.1|4924057_4925551_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_011895466.1|4925547_4926645_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_011895467.1|4926704_4927256_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_052537336.1|4927287_4927836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011895469.1|4928015_4928885_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011895470.1|4928987_4929629_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085981140.1|4929720_4930362_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085976237.1|4932518_4933711_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
4935243:4935302	attL	TGAAGCGCCCCAGGTTTGATGCCGCATCTTTCTGAGTTGGAAGGATGCAAGCCATGCCGA	NA	NA	NA	NA
WP_011895474.1|4935295_4935601_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_049777473.1|4935755_4937054_+|transposase	IS256-like element IS1295 family transposase	transposase	NA	NA	NA	NA
WP_142360580.1|4937341_4938184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085976237.1|4940241_4941434_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
WP_011895480.1|4941690_4943604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.1	7.2e-05
4946102:4946409	attR	TCGGCATGGCTTGCATCCTTCCAACTCAGAAAGATGCGGCATCAAACCTGGGGCGCTTCATCCGTACCGCCCGCTCACGGGTCTCTGGGTCGAACTTCCTCGGCGCAGCCACAACCACATCCTCCTGGTGCGATCACGATCTCCACCAGACCCAGGACGGTTCATGTCGTCCACCCACCTGCCCTCACCGCGGCGGGGTCGGGCGGTAAAGGAGCCGCGACCACTATGGGTTGCAGACCCAGACCCCCGGGGCGAGACGCGTGGCCGCGGCCGGGCCGCTCAGGACGATGACCGTCGTCGCTATTCAC	NA	NA	NA	NA
>prophage 1
NC_009339	Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence	321253	87258	192284	321253	protease,integrase,transposase	Mycobacterium_phage(31.82%)	97	75894:75909	196727:196744
75894:75909	attL	CCATCGGCGAGCCAGT	NA	NA	NA	NA
WP_041801085.1|87258_88494_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.3	1.9e-83
75894:75909	attL	CCATCGGCGAGCCAGT	NA	NA	NA	NA
WP_049777491.1|90373_90553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896123.1|90682_90943_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_011767946.1|91223_92459_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.2	1.6e-106
WP_085981176.1|93767_94906_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.8	6.3e-33
WP_011896127.1|95536_96298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085981180.1|97060_97576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896129.1|97885_99799_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_041801145.1|99914_100685_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_011896131.1|100821_101778_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011896132.1|101851_102235_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011896133.1|102231_104190_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	9.0e-104
WP_011896134.1|104612_104894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896135.1|105499_106096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896136.1|106400_107222_-	cyclase	NA	NA	NA	NA	NA
WP_041801093.1|107218_109777_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	3.5e-108
WP_041801146.1|109959_110454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896139.1|110616_112362_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	39.4	9.4e-12
WP_011896140.1|112872_113892_+	M23 family metallopeptidase	NA	A0A2D1G842	Mycobacterium_phage	52.2	1.3e-24
WP_041801148.1|114131_114515_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011896142.1|114514_115459_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_041801094.1|116214_117153_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_041801095.1|117238_117856_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011896145.1|118237_118582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896146.1|118578_119172_-	heme-copper oxidase subunit III	NA	NA	NA	NA	NA
WP_041801097.1|119510_120557_+	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	46.4	2.0e-17
WP_011896149.1|121430_122747_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	92.3	4.9e-231
WP_011777812.1|123388_123865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011777813.1|123938_124307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011777814.1|124345_124753_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_011777815.1|124770_126753_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.0	5.3e-104
WP_011782545.1|126745_127123_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011777817.1|127277_127541_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_011777818.1|127546_128326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011777819.1|128338_128746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011777820.1|129168_129891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011777821.1|129940_131185_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	36.6	3.3e-11
WP_011777822.1|131207_132407_+|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	30.1	7.4e-08
WP_011777823.1|132415_134641_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011782546.1|134637_135072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041321994.1|135272_136037_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011767854.1|136617_137346_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011896150.1|137542_138334_+	CbtA family protein	NA	NA	NA	NA	NA
138037:138052	attR	ACTGGCTCGCCGATGG	NA	NA	NA	NA
WP_011767814.1|138682_139348_-	thioredoxin	NA	NA	NA	NA	NA
138037:138052	attR	ACTGGCTCGCCGATGG	NA	NA	NA	NA
WP_011896151.1|139825_141370_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
WP_049777496.1|141401_142718_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011767811.1|143044_144406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011767810.1|144402_144852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011767808.1|145431_145992_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_011767807.1|145988_146330_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_081437720.1|146713_147568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011767805.1|147681_147915_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_041321980.1|148247_148430_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011767804.1|148475_148814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011767803.1|148888_149641_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011767802.1|149804_150083_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011767801.1|150096_152646_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011767800.1|152642_153824_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011767799.1|153820_155968_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011767798.1|155964_156687_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_011896153.1|157300_158620_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041801098.1|158603_159836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896155.1|160026_161274_-	hypothetical protein	NA	V9SI46	Achromobacter_phage	27.5	2.2e-07
WP_011896156.1|161270_162377_-	sigma 54-interacting transcriptional regulator	NA	M4SLY4	Vibrio_phage	27.6	1.6e-12
WP_011896157.1|162511_162868_-	hypothetical protein	NA	A0A222ZSS2	Mycobacterium_phage	41.5	8.6e-13
WP_011896158.1|163093_163987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142389927.1|164143_164695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896160.1|165040_166978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041801100.1|167150_168254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896162.1|168382_169216_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0N7CD74	Skermania_phage	30.4	1.9e-23
WP_099248873.1|169212_169686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896164.1|169682_170573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896165.1|170824_171502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896166.1|171523_171949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896167.1|171945_172812_+	hypothetical protein	NA	A0A0N7CDP5	Skermania_phage	32.4	2.1e-28
WP_011896168.1|172817_173531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022119.1|173905_174340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896170.1|175240_175771_-	DinB family protein	NA	NA	NA	NA	NA
WP_041801102.1|175823_176213_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_085981177.1|176666_177813_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011896174.1|177832_178294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081437722.1|178373_179468_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_011896176.1|179727_180252_+	glyoxalase	NA	NA	NA	NA	NA
WP_081437723.1|180476_180986_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085978045.1|180924_182149_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	43.2	9.4e-59
WP_049777502.1|182164_182443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041801157.1|182556_184044_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	23.6	6.6e-06
WP_011896180.1|184040_184856_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041801105.1|184888_185071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041801106.1|185185_185701_+	transferase	NA	NA	NA	NA	NA
WP_158022120.1|185954_186098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896182.1|186108_186492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896183.1|186594_187644_-	DUF2637 domain-containing protein	NA	A0A1D8EVB7	Mycobacterium_phage	34.1	9.3e-07
WP_011896184.1|187893_188379_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011896185.1|188447_188780_-	Lsr2 family protein	NA	S5W0B7	Mycobacterium_phage	38.7	8.8e-12
WP_011896186.1|188793_190902_-	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_041801108.1|190898_192284_-|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	41.6	8.1e-67
196727:196744	attR	GGCCAGCACCGCGTTGCG	NA	NA	NA	NA
>prophage 2
NC_009339	Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence	321253	218671	249382	321253	transposase	Saccharomonospora_phage(33.33%)	33	NA	NA
WP_011896210.1|218671_219922_-|transposase	transposase	transposase	I4AZI9	Saccharomonospora_phage	62.6	1.5e-136
WP_041801115.1|219925_220324_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	82.4	6.6e-62
WP_011896212.1|220680_220968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099249241.1|221556_222834_-|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	41.9	1.2e-59
WP_011896214.1|222882_223311_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	65.2	6.6e-44
WP_158022122.1|223671_223926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041801116.1|223990_224242_+	hypothetical protein	NA	A0A0A7HCT4	Mycobacterium_phage	56.0	9.9e-16
WP_011896216.1|224309_224744_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041801117.1|224776_225736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041801118.1|225759_226614_-	DUF1942 domain-containing protein	NA	NA	NA	NA	NA
WP_041801119.1|226957_227173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158022123.1|227156_227348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041801120.1|228658_229054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049777512.1|229046_229436_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_081437725.1|229472_230186_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_011896224.1|230113_230698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896225.1|230864_231557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896226.1|231558_232539_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_041801166.1|232562_234890_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_041801121.1|235061_235997_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085976237.1|236023_237215_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
WP_158022132.1|237529_238684_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	3.4e-10
WP_158022124.1|238698_239868_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_049777515.1|240030_240513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081437726.1|240663_243012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896233.1|243015_243828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896234.1|243824_244112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896235.1|244342_245527_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.4	3.9e-09
WP_011896236.1|246160_246637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896237.1|246660_247083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158022125.1|247181_247598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011896239.1|247591_247882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011896101.1|247975_249382_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	44.1	4.2e-87
