The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009436	Enterobacter sp. 638, complete sequence	4518712	871691	913745	4518712	integrase,plate,tail	Salmonella_phage(40.91%)	56	875560:875599	912703:912742
WP_012016174.1|871691_872744_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.1e-119
WP_012016175.1|873049_874153_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	6.9e-61
WP_012016176.1|874163_875417_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	1.3e-95
875560:875599	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
WP_012016177.1|875619_876783_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.4	1.3e-153
WP_012016178.1|877047_877287_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	83.5	3.6e-31
WP_012016179.1|877283_878522_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	74.4	4.4e-96
WP_012016180.1|878599_879334_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.4	1.8e-25
WP_190275380.1|879350_880019_-	AAA family ATPase	NA	G9L667	Escherichia_phage	46.1	2.5e-50
WP_012016182.1|880018_880690_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.4	4.6e-15
WP_170227409.1|880673_880841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016183.1|880922_881195_-	hypothetical protein	NA	S4TU79	Salmonella_phage	62.2	1.6e-27
WP_012016184.1|881205_881403_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_041689285.1|881402_881603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689288.1|881960_882716_-	helix-turn-helix domain-containing protein	NA	G8C7L8	Escherichia_phage	58.7	6.2e-77
WP_012016187.1|882752_882980_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	54.7	6.2e-17
WP_012016188.1|883018_883339_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	85.8	7.9e-42
WP_012016189.1|883342_883597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166495015.1|883670_883817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016190.1|883809_884619_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	43.7	1.1e-55
WP_012016191.1|884615_886013_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	63.2	5.3e-167
WP_041689289.1|886012_886192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016192.1|886300_887245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016194.1|887577_888030_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	52.4	1.3e-37
WP_041689290.1|888019_888319_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	85.9	7.4e-42
WP_012016196.1|888315_888675_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.8	1.8e-39
WP_041689291.1|889498_890050_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	42.9	7.7e-37
WP_012016199.1|890043_890985_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	49.5	1.4e-73
WP_012016200.1|890890_891505_+	hypothetical protein	NA	H2BDB7	Pseudomonas_virus	50.3	5.8e-49
WP_041689292.1|891549_891870_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.8	3.7e-39
WP_041689596.1|891862_892384_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.2	1.9e-48
WP_012016202.1|892380_892926_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	72.8	1.3e-57
WP_041689293.1|892992_893247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016204.1|893488_894109_+	hypothetical protein	NA	I6S676	Salmonella_phage	72.7	2.7e-86
WP_012016205.1|894140_894614_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	71.3	6.8e-50
WP_041689294.1|894649_894988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689600.1|896814_897348_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	58.7	1.2e-47
WP_190275366.1|897451_897616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016208.1|897669_898941_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	41.8	9.4e-78
WP_012016209.1|898952_899456_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.6	2.2e-30
WP_012016211.1|899856_900387_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	49.1	5.3e-43
WP_012016212.1|900390_901536_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	2.2e-163
WP_012016213.1|901547_901988_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	4.1e-57
WP_012016214.1|901991_902444_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.0	2.2e-61
WP_012016215.1|902621_904631_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	91.0	0.0e+00
WP_012016216.1|904630_905218_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.7	5.6e-86
WP_012016217.1|905217_905520_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	7.7e-47
WP_012016218.1|905522_906587_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	4.3e-161
WP_012016219.1|906589_906937_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	82.4	2.4e-28
WP_150099556.1|907160_907925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689296.1|907908_908292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016221.1|908354_909107_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.8	3.2e-86
WP_012016222.1|909106_909460_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	91.5	2.1e-56
WP_012016223.1|909460_910660_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	88.5	8.3e-193
WP_012016224.1|910656_911337_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.5	3.6e-108
WP_012016226.1|912135_912564_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	51.7	8.1e-34
WP_012016227.1|912986_913745_+	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	33.1	2.9e-10
912703:912742	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCG	NA	NA	NA	NA
>prophage 2
NC_009436	Enterobacter sp. 638, complete sequence	4518712	1107863	1134649	4518712	terminase,integrase	Enterobacteria_phage(33.33%)	54	1104944:1104959	1111309:1111324
1104944:1104959	attL	TGCACGCATAGCGCGC	NA	NA	NA	NA
WP_150099607.1|1107863_1109021_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	90.9	3.1e-213
WP_071818718.1|1108903_1109239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_190275367.1|1109251_1109404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689311.1|1109433_1109781_-	hypothetical protein	NA	I6R980	Salmonella_phage	80.5	4.0e-47
WP_012016401.1|1110096_1110954_-	hypothetical protein	NA	M4MB35	Vibrio_phage	41.7	3.6e-57
WP_041689313.1|1111057_1111297_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	70.9	1.9e-24
WP_041689314.1|1111305_1111542_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
1111309:1111324	attR	TGCACGCATAGCGCGC	NA	NA	NA	NA
WP_150099558.1|1111504_1111912_-	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	38.9	2.5e-08
WP_041689315.1|1111982_1112204_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	49.3	9.1e-13
WP_012016403.1|1112193_1112664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016404.1|1112665_1112881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689316.1|1112877_1113186_-	anti-RecBCD protein 1	NA	A0A192Y7Y0	Salmonella_phage	54.8	8.4e-25
WP_012016405.1|1113189_1113870_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	75.1	8.8e-99
WP_012016406.1|1113866_1114778_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	84.1	1.3e-145
WP_012016407.1|1114794_1115073_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	64.5	1.1e-26
WP_041689317.1|1115150_1115426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016409.1|1115425_1115737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689318.1|1115733_1115931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190275368.1|1116074_1116227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016411.1|1116276_1116507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150099559.1|1116526_1116868_-	hypothetical protein	NA	A0A077KC43	Edwardsiella_phage	42.9	2.6e-06
WP_041689319.1|1117140_1117347_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	94.1	1.3e-29
WP_012016413.1|1117674_1118022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041689320.1|1118286_1119051_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	63.0	9.0e-92
WP_012016415.1|1119135_1119363_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	84.9	1.9e-29
WP_012016416.1|1119477_1119762_+	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	63.8	2.3e-24
WP_012016417.1|1119861_1120788_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	67.7	1.9e-48
WP_012016418.1|1120784_1121471_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	76.9	2.3e-99
WP_071818719.1|1121472_1121817_+	Ren protein	NA	K7P7J0	Enterobacteria_phage	58.2	3.1e-28
WP_041689322.1|1122121_1122364_+	flagellar FlbD family protein	NA	NA	NA	NA	NA
WP_012016419.1|1122360_1122807_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	48.5	7.4e-30
WP_041689323.1|1122803_1122998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016420.1|1122994_1123615_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	33.3	1.4e-18
WP_012016421.1|1123617_1124091_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	4.3e-68
WP_012016422.1|1124094_1124463_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.3	7.9e-62
WP_041689324.1|1124464_1124701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016423.1|1124697_1125183_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	47.3	2.6e-12
WP_012016424.1|1125182_1125452_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	59.0	3.0e-10
WP_190275369.1|1125448_1125607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689325.1|1125659_1125869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012016425.1|1126177_1126609_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	46.0	4.2e-30
WP_049759287.1|1126601_1127183_+	HNH endonuclease	NA	A0A0B5HDZ3	Vibrio_phage	41.2	7.7e-19
WP_041689326.1|1127182_1127347_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	68.5	3.7e-11
WP_012016426.1|1127339_1127960_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	52.8	3.6e-51
WP_041689327.1|1127956_1128139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016427.1|1128242_1128743_+	late gene antiterminator protein	NA	G8C7V7	Escherichia_phage	89.0	8.5e-83
WP_049759289.1|1129262_1129574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689328.1|1129563_1129878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016429.1|1129898_1130441_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	70.1	3.5e-74
WP_049759421.1|1130443_1130650_+	hypothetical protein	NA	A0A2P0PAP7	Pectobacterium_phage	33.3	7.4e-09
WP_012016430.1|1130646_1130934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016431.1|1131150_1131891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689330.1|1131892_1133215_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.6	6.8e-156
WP_012016433.1|1133227_1134649_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.1	1.2e-86
>prophage 3
NC_009436	Enterobacter sp. 638, complete sequence	4518712	1138011	1153813	4518712	plate,tail	Escherichia_phage(75.0%)	19	NA	NA
WP_012016437.1|1138011_1139043_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.1	2.3e-74
WP_012016438.1|1139107_1139590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016439.1|1139586_1140015_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	41.7	3.8e-23
WP_041689331.1|1140011_1140446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016441.1|1140429_1141371_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	38.3	2.2e-52
WP_012016442.1|1141375_1142770_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.1	9.7e-60
WP_012016443.1|1142773_1143211_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	35.4	3.3e-22
WP_012016444.1|1143213_1143792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016445.1|1143915_1145736_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	37.6	8.9e-21
WP_012016446.1|1145735_1146452_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.6	4.5e-29
WP_012016447.1|1146448_1146724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016448.1|1146723_1147743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016449.1|1147739_1148456_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	35.5	7.5e-24
WP_012016450.1|1148452_1148785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016451.1|1148781_1150200_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	40.4	1.7e-43
WP_012016452.1|1150201_1150906_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	40.6	3.4e-29
WP_012016454.1|1151959_1152382_+|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	37.2	8.9e-09
WP_012016455.1|1152378_1153071_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012016456.1|1153099_1153813_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	57.3	2.5e-59
>prophage 4
NC_009436	Enterobacter sp. 638, complete sequence	4518712	1474787	1531023	4518712	portal,terminase,protease,tail,integrase	Salmonella_phage(44.44%)	58	1473771:1473795	1492401:1492425
1473771:1473795	attL	GAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_012016740.1|1474787_1475807_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	4.7e-104
WP_012016741.1|1475889_1477566_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	57.1	5.0e-79
WP_012016742.1|1477586_1478183_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	8.1e-40
WP_012016743.1|1478278_1478500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016744.1|1478532_1479042_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
WP_012016745.1|1479049_1479250_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	8.1e-29
WP_012016746.1|1479213_1479555_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	3.5e-48
WP_012016747.1|1479622_1479859_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	50.0	3.7e-12
WP_012016748.1|1479858_1480086_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	77.3	1.1e-26
WP_012016749.1|1480082_1481093_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.8	8.3e-69
WP_190275381.1|1481098_1483501_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.2	0.0e+00
WP_012016752.1|1484124_1484877_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_012016753.1|1484869_1485529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150099564.1|1485464_1486019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012016755.1|1486034_1487066_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.3	8.4e-178
WP_083764544.1|1487065_1487869_-|terminase	terminase-like protein	terminase	E5G6M4	Salmonella_phage	97.8	7.8e-155
WP_012016757.1|1487904_1489557_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	61.9	1.8e-174
WP_012016758.1|1489553_1490039_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	86.2	1.6e-70
WP_012016759.1|1490035_1491136_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	88.3	3.5e-182
WP_012016760.1|1491203_1491419_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	1.2e-22
WP_041689355.1|1491519_1492323_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_012016762.1|1492570_1494256_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1492401:1492425	attR	GAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_041689356.1|1494532_1494901_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_012016764.1|1494931_1495201_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	4.2e-28
WP_012016765.1|1495386_1496109_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_012016766.1|1496178_1497081_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	5.2e-38
WP_012016767.1|1497136_1497616_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_012016768.1|1497973_1499086_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_012016769.1|1499193_1500327_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	1.3e-30
WP_012016770.1|1500336_1501290_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_012016771.1|1501286_1502132_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_150099565.1|1502174_1502672_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_012016773.1|1502836_1503964_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	3.5e-28
WP_012016774.1|1504036_1504753_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.2e-34
WP_012016775.1|1504736_1506209_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.5	6.9e-24
WP_012016776.1|1506250_1506982_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_012016777.1|1507160_1507829_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_012016778.1|1507828_1508545_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_012016779.1|1508551_1509283_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012016780.1|1509302_1510031_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	8.7e-28
WP_012016781.1|1510248_1510767_-	lipoprotein	NA	NA	NA	NA	NA
WP_012016782.1|1510933_1511257_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012016783.1|1511253_1512084_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_041689633.1|1512090_1513104_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012016785.1|1513196_1514633_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012016786.1|1514643_1515645_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_012016787.1|1515791_1517510_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	4.0e-31
WP_012016788.1|1517662_1518097_+	DoxX family protein	NA	NA	NA	NA	NA
WP_012016789.1|1519405_1520374_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_012016790.1|1520383_1522036_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_012016791.1|1522179_1523079_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_012016792.1|1523204_1523900_-	aquaporin Z	NA	NA	NA	NA	NA
WP_012016793.1|1524269_1525928_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_012016794.1|1525924_1526881_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_012016795.1|1527040_1528156_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_012016796.1|1528152_1530093_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.6	2.6e-39
WP_012016797.1|1530161_1530383_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	8.7e-16
WP_012016798.1|1530702_1531023_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
>prophage 5
NC_009436	Enterobacter sp. 638, complete sequence	4518712	1880499	1887034	4518712		Geobacillus_virus(16.67%)	8	NA	NA
WP_003857805.1|1880499_1880799_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_041689645.1|1880898_1881879_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_012017126.1|1881911_1882463_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	2.4e-14
WP_012017127.1|1882462_1883218_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	28.9	8.5e-10
WP_012017128.1|1883290_1883755_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	40.2	6.6e-13
WP_012017129.1|1884040_1884754_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_012017130.1|1884815_1886258_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	41.9	1.1e-53
WP_012017131.1|1886254_1887034_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	1.6e-11
>prophage 6
NC_009436	Enterobacter sp. 638, complete sequence	4518712	2388914	2451788	4518712	terminase,protease,lysis,tail,capsid,integrase,holin,head	Salmonella_phage(28.85%)	69	2401055:2401073	2451929:2451947
WP_012017588.1|2388914_2389958_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.8	9.6e-20
WP_012017589.1|2390212_2390974_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.8	8.0e-08
WP_012017590.1|2390970_2391561_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012017591.1|2391596_2392472_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_012017592.1|2392571_2393192_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_041689663.1|2393188_2394073_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_012017594.1|2394350_2395913_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_012017595.1|2395912_2397508_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	43.0	4.7e-50
WP_012017596.1|2397511_2398870_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	7.3e-36
WP_012017597.1|2398880_2400074_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012017598.1|2400073_2400883_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
2401055:2401073	attL	CATACACCTTCTGAGTTCA	NA	NA	NA	NA
WP_150099577.1|2402054_2403170_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_012017602.1|2403233_2404502_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.3e-232
WP_012017603.1|2404504_2404924_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.4e-35
WP_012017604.1|2405496_2406780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689420.1|2406807_2407350_-	colicin immunity protein Cui	NA	NA	NA	NA	NA
WP_012017605.1|2407570_2408842_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	66.3	8.0e-53
WP_012017606.1|2408900_2409140_-	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	56.8	2.7e-18
WP_041689421.1|2409247_2409922_-	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	88.8	4.0e-112
WP_012017608.1|2410223_2413409_-	host specificity protein J	NA	O64335	Escherichia_phage	85.9	0.0e+00
WP_012017609.1|2413461_2414061_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	72.4	1.2e-72
WP_041689423.1|2414114_2414537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012017610.1|2414565_2415276_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	89.0	6.7e-134
WP_012017611.1|2415277_2416033_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	91.6	5.0e-135
WP_012017612.1|2416029_2416368_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	87.5	4.1e-57
WP_012017613.1|2416368_2419656_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	87.6	0.0e+00
WP_041689424.1|2419736_2420174_-	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	56.6	7.5e-43
WP_041689425.1|2420182_2420755_-	hypothetical protein	NA	G8C7Q8	Escherichia_phage	49.5	1.3e-42
WP_041689426.1|2421178_2421442_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	88.5	1.7e-37
WP_012017616.1|2421465_2421867_-|tail	phage tail assembly chaperone	tail	K7P7C2	Enterobacteria_phage	93.2	5.4e-64
WP_012017617.1|2421920_2422391_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	92.9	3.2e-76
WP_012017618.1|2422445_2422793_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	91.3	2.6e-54
WP_012017619.1|2422789_2423239_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	90.6	7.4e-70
WP_012017620.1|2423235_2423574_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	9.6e-38
WP_012017621.1|2423584_2423917_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	56.4	5.3e-25
WP_012017624.1|2426296_2426464_-	hypothetical protein	NA	S4TR49	Salmonella_phage	65.5	2.4e-10
WP_012017625.1|2426501_2428442_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	88.6	0.0e+00
WP_012017626.1|2428500_2430159_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	70.4	4.2e-235
WP_012017627.1|2430162_2430663_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	70.3	1.2e-52
WP_012017628.1|2430839_2431208_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	81.1	1.8e-53
WP_041689427.1|2431200_2431791_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	70.6	7.4e-78
WP_012017630.1|2431851_2432160_+	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_041689428.1|2432463_2432679_+	hypothetical protein	NA	H6WRV6	Salmonella_phage	41.5	1.6e-09
WP_012017632.1|2432761_2434219_-	glycosyl transferase	NA	A0A220NRM5	Escherichia_phage	86.8	3.6e-259
WP_012017633.1|2434496_2435024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012017634.1|2435448_2435916_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	74.2	6.7e-58
WP_012017635.1|2435912_2436449_-	lysozyme	NA	K7PM52	Enterobacteria_phage	77.5	1.2e-79
WP_012017636.1|2436448_2436664_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	78.9	2.2e-27
WP_012017637.1|2436735_2437782_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	76.3	4.4e-166
WP_012017638.1|2437931_2438123_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	68.3	8.3e-15
WP_012017639.1|2438472_2439078_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.8	4.9e-77
WP_012017640.1|2439091_2440111_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	7.2e-97
WP_041689430.1|2440095_2440467_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	62.1	5.9e-41
WP_041689431.1|2440463_2440670_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	49.2	3.0e-10
WP_041689665.1|2440800_2441046_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.3	5.3e-22
WP_012017642.1|2441092_2441326_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	75.3	1.4e-27
WP_041689433.1|2442239_2442494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190275348.1|2442582_2442744_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	82.4	1.4e-15
WP_012017645.1|2443276_2443537_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	58.8	1.6e-24
WP_012017646.1|2443523_2443958_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_190275388.1|2443972_2444518_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.5	4.4e-69
WP_071818744.1|2444429_2445383_-	hypothetical protein	NA	T1SA92	Salmonella_phage	51.4	1.9e-62
WP_012017649.1|2445432_2445987_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	34.1	4.4e-16
WP_041689669.1|2445989_2446220_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	59.2	8.0e-20
WP_041689670.1|2446342_2446747_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	60.9	8.7e-38
WP_041689435.1|2447148_2447331_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_041689436.1|2447376_2447718_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012017651.1|2447858_2450363_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	52.8	1.3e-171
WP_012017653.1|2450669_2451788_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	45.4	5.2e-80
2451929:2451947	attR	CATACACCTTCTGAGTTCA	NA	NA	NA	NA
>prophage 7
NC_009436	Enterobacter sp. 638, complete sequence	4518712	2789290	2824258	4518712	portal,plate,terminase,protease,lysis,tail,capsid,integrase,holin,head	Shigella_phage(36.59%)	49	2785422:2785436	2824509:2824523
2785422:2785436	attL	GGACAGGCCATCGCA	NA	NA	NA	NA
WP_015959583.1|2789290_2789980_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.3	4.2e-48
WP_015959584.1|2789991_2790573_-	YmfQ family protein	NA	O22003	Shigella_phage	78.8	8.3e-90
WP_015959585.1|2790563_2791622_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	75.5	6.5e-157
WP_015959586.1|2791608_2792034_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	81.6	1.2e-66
WP_015959587.1|2792033_2792576_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	74.7	2.1e-74
WP_015959588.1|2792575_2793655_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	83.3	4.1e-175
WP_041689688.1|2793651_2794953_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	73.3	5.6e-187
WP_015959590.1|2795016_2796807_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	76.6	6.3e-229
WP_015959591.1|2796948_2797218_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	78.7	1.6e-35
WP_015959592.1|2797217_2797574_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	93.2	9.4e-60
WP_015959593.1|2797573_2799067_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	U5P0H3	Shigella_phage	74.9	1.6e-214
WP_015959594.1|2799063_2799246_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	61.8	7.0e-11
WP_015959595.1|2799254_2799815_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	82.8	7.5e-88
WP_041689452.1|2799814_2800318_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	85.0	1.1e-77
WP_015959597.1|2800292_2800706_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	69.3	3.3e-48
WP_015959598.1|2800702_2801020_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	59.8	6.6e-33
WP_015959599.1|2801093_2802323_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	74.8	7.7e-170
WP_015959600.1|2802332_2802932_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.0	1.0e-87
WP_015959601.1|2802924_2804151_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	90.0	5.1e-222
WP_015959602.1|2804140_2804302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959603.1|2804298_2806020_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	64.2	2.7e-221
WP_015959604.1|2806022_2806481_-|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	52.9	3.3e-25
WP_015959605.1|2806680_2807031_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	76.7	4.6e-51
WP_041689453.1|2807142_2807529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959606.1|2807636_2807981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959607.1|2808384_2809074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959608.1|2809351_2809870_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	80.7	9.4e-77
WP_015959609.1|2810372_2810834_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	57.4	6.3e-40
WP_015959610.1|2810830_2811367_-	lysozyme	NA	K7PM52	Enterobacteria_phage	76.3	4.7e-79
WP_015959611.1|2811366_2811582_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	83.1	2.0e-28
WP_041689691.1|2811777_2811960_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	2.6e-10
WP_015959612.1|2812008_2812440_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	54.0	5.0e-31
WP_041689454.1|2812697_2813096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959613.1|2813092_2813860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015959614.1|2814221_2814800_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	6.2e-45
WP_015959615.1|2814812_2815802_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	77.2	6.7e-156
WP_015959617.1|2815973_2816894_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	76.4	3.5e-58
WP_071818752.1|2816850_2817063_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	3.0e-13
WP_015959619.1|2817305_2817776_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	93.6	2.1e-75
WP_041689455.1|2817798_2818056_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	77.5	1.0e-23
WP_041689456.1|2818153_2818849_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	70.0	6.0e-87
WP_049759357.1|2819963_2820317_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	71.9	7.0e-15
WP_015959623.1|2820316_2821351_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	91.0	1.1e-174
WP_049759451.1|2821442_2821901_+	hypothetical protein	NA	Q858D1	Salmonella_phage	71.5	2.9e-37
WP_015959625.1|2821897_2822329_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_041689457.1|2822330_2822525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041689458.1|2822551_2822821_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	76.4	3.0e-34
WP_041689459.1|2822904_2823096_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.8e-18
WP_015959626.1|2823076_2824258_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	85.8	9.3e-205
2824509:2824523	attR	GGACAGGCCATCGCA	NA	NA	NA	NA
>prophage 8
NC_009436	Enterobacter sp. 638, complete sequence	4518712	2851581	2858126	4518712		Enterobacteria_phage(50.0%)	7	NA	NA
WP_015959651.1|2851581_2852142_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.1	2.4e-46
WP_015959652.1|2852173_2853049_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.0	1.4e-101
WP_015959653.1|2853074_2854157_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	2.2e-99
WP_150099617.1|2854211_2854688_-	acyltransferase	NA	NA	NA	NA	NA
WP_041689461.1|2854782_2855301_-	acyltransferase	NA	A0A1V0SJ47	Klosneuvirus	30.3	1.0e-06
WP_015959655.1|2855661_2856558_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.5	3.7e-44
WP_015959656.1|2856734_2858126_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	1.7e-19
>prophage 9
NC_009436	Enterobacter sp. 638, complete sequence	4518712	3375315	3386099	4518712	integrase	Enterobacteria_phage(75.0%)	13	3375243:3375265	3386098:3386120
3375243:3375265	attL	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
WP_015960095.1|3375315_3376503_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.9	3.5e-103
WP_015960096.1|3376537_3378286_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015960097.1|3378676_3379243_-	phage polarity suppression	NA	Q7M2A1	Enterobacteria_phage	64.3	5.7e-59
WP_015960098.1|3379239_3379503_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	61.7	9.7e-22
WP_015960099.1|3379499_3380231_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	56.5	4.7e-66
WP_190275393.1|3380272_3380452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015960100.1|3380793_3381060_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.0	1.2e-27
WP_015960101.1|3381056_3381608_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.1	1.0e-36
WP_015960102.1|3381604_3381832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015960103.1|3381828_3382149_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_015960104.1|3382163_3384497_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.1	0.0e+00
WP_041689498.1|3384613_3385117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015960106.1|3385598_3386099_+	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	61.3	3.0e-40
3386098:3386120	attR	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
>prophage 10
NC_009436	Enterobacter sp. 638, complete sequence	4518712	3777053	3814474	4518712	tRNA,portal,plate,lysis,terminase,tail,capsid,integrase,head	Erwinia_phage(45.24%)	45	3783443:3783493	3815488:3815538
WP_015960457.1|3777053_3778067_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	8.2e-109
WP_001144069.1|3778418_3778634_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015960458.1|3778816_3780562_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	2.1e-75
WP_041689526.1|3780833_3782672_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_015960460.1|3782780_3783287_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3783443:3783493	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
WP_015960461.1|3783632_3783851_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	79.2	4.7e-30
WP_015960462.1|3783919_3785083_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	78.3	1.2e-164
WP_015960463.1|3785079_3785544_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	75.5	5.0e-61
WP_015960464.1|3785558_3787988_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	73.2	1.1e-305
WP_015960465.1|3787977_3788100_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	9.4e-12
WP_015960466.1|3788132_3788447_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	64.3	1.9e-27
WP_015960467.1|3788503_3789022_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	7.2e-77
WP_015960468.1|3789034_3790222_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	3.0e-187
WP_015960469.1|3790345_3790942_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	71.1	1.7e-77
WP_015960470.1|3790941_3791964_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	72.6	2.0e-134
WP_015960471.1|3791960_3792569_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	92.6	6.6e-106
WP_015960472.1|3792561_3793470_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	84.8	2.2e-137
WP_015960473.1|3793475_3793826_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	2.4e-39
WP_015960474.1|3793822_3794464_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	78.9	9.8e-92
WP_150099588.1|3794894_3795104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015960475.1|3795366_3795831_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	5.3e-47
WP_015960476.1|3795823_3796291_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	2.5e-60
WP_041689528.1|3796386_3796803_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	72.1	1.2e-45
WP_015960478.1|3796802_3797231_-	hypothetical protein	NA	Q858W1	Yersinia_virus	33.8	9.0e-09
WP_015960479.1|3797227_3797740_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	8.7e-83
WP_015960480.1|3797723_3797945_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	76.4	6.5e-27
WP_015960481.1|3797935_3798139_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	83.6	5.0e-26
WP_015960482.1|3798138_3798642_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	4.9e-62
WP_015960483.1|3798741_3799497_-|terminase	terminase endonuclease subunit	terminase	A0A0M4QWM0	Salmonella_phage	71.8	2.3e-79
WP_015960484.1|3799500_3800595_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	82.0	4.2e-167
WP_015960485.1|3800651_3801509_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.7	5.0e-115
WP_015960486.1|3801674_3803444_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	3.6e-301
WP_015960487.1|3803445_3804462_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	85.7	1.7e-170
WP_041689722.1|3804803_3806630_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	29.5	1.6e-75
WP_041689529.1|3806863_3807304_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	60.6	3.2e-41
WP_015960490.1|3807419_3809642_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.6	0.0e+00
WP_015960491.1|3809638_3810931_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	34.8	1.3e-45
WP_015960492.1|3810931_3811153_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	86.1	1.5e-28
WP_015960493.1|3811152_3811380_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	4.4e-31
WP_015960494.1|3811447_3811786_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	86.6	1.4e-49
WP_015960495.1|3811749_3811950_-	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	85.5	3.2e-25
WP_015960496.1|3811957_3812467_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	91.1	2.5e-82
WP_001630878.1|3812497_3812761_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_041689530.1|3812891_3813464_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	87.8	7.2e-94
WP_015960498.1|3813463_3814474_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	2.6e-192
3815488:3815538	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
