The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	256397	321588	3608104	transposase,tRNA	Paramecium_bursaria_Chlorella_virus(25.0%)	51	NA	NA
WP_011876642.1|256397_257141_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_011876643.1|257407_257839_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011876644.1|257872_258265_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011876645.1|258606_260388_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_011876646.1|260640_261843_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_011876647.1|261877_263062_+	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_011876648.1|263092_264517_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_011876649.1|264546_265953_+	cytosine/purines uracil thiamine allantoin permease	NA	NA	NA	NA	NA
WP_011876650.1|266017_267619_+	D-aminoacylase	NA	NA	NA	NA	NA
WP_011876651.1|267683_268052_+	RidA family protein	NA	NA	NA	NA	NA
WP_156779704.1|268332_269061_+	cell wall hydrolase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	33.2	6.2e-26
WP_011876653.1|269208_270375_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011876656.1|271655_273059_+	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
WP_011876657.1|273098_273959_+	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_011876658.1|274299_275340_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011876659.1|275351_276569_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_011876660.1|276637_277501_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011876661.1|277514_278705_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.7	9.8e-29
WP_011876662.1|278716_281941_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011876663.1|282035_282983_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	29.1	7.9e-21
WP_011876664.1|283234_284440_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011876665.1|284574_285957_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011876666.1|286096_287188_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041274369.1|287927_289589_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_041274370.1|289677_291339_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.0	3.5e-64
WP_011876669.1|291354_291867_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_011876670.1|291869_292862_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011876671.1|293057_294725_+	biosynthetic-type acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_011876672.1|294749_296267_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.9	9.7e-05
WP_041274371.1|296290_297553_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011876674.1|297553_298054_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011876675.1|298046_299117_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011876676.1|299269_300811_+	citramalate synthase	NA	NA	NA	NA	NA
WP_011876677.1|300963_302193_-	DUF4127 family protein	NA	NA	NA	NA	NA
WP_011876678.1|302578_303820_-|transposase	IS4-like element ISDre1 family transposase	transposase	NA	NA	NA	NA
WP_156779551.1|303981_304119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011876679.1|304237_305062_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_011876680.1|305058_306063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011876681.1|306234_307569_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011876682.1|307918_309748_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	42.3	3.2e-119
WP_011876683.1|309967_311422_+|transposase	IS1380-like element ISDre2 family transposase	transposase	NA	NA	NA	NA
WP_041274372.1|312013_312868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041274373.1|312969_314625_+	DNA mismatch repair enzyme (ATPase)	NA	NA	NA	NA	NA
WP_156779552.1|314760_314922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011876686.1|314990_315770_-	ATPase AAA	NA	A0A2L1IVB6	Escherichia_phage	31.1	3.2e-28
WP_011876687.1|315766_317356_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011876688.1|317711_318155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041274374.1|318206_318950_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011876690.1|318942_320502_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.4	1.1e-06
WP_156779553.1|320638_320776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011876692.1|320772_321588_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	350739	357142	3608104	protease	Caulobacter_phage(50.0%)	7	NA	NA
WP_011876722.1|350739_351312_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	34.1	2.5e-22
WP_011876723.1|351328_351931_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.8	1.7e-24
WP_011876724.1|351960_352539_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.4	7.6e-27
WP_083755202.1|352797_353484_+	TerC family protein	NA	S5MAL1	Bacillus_phage	54.5	8.1e-60
WP_041274380.1|353480_354668_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_156779705.1|354660_355983_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	29.8	3.7e-16
WP_049755920.1|355945_357142_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.1	1.3e-41
>prophage 3
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	809587	818774	3608104	protease,tRNA	Bacillus_phage(25.0%)	9	NA	NA
WP_011877131.1|809587_811390_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	27.9	2.4e-10
WP_011877132.1|811973_813101_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	3.8e-22
WP_011877133.1|813141_813813_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	1.4e-40
WP_011877134.1|813812_815237_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.6	1.1e-26
WP_041274777.1|815283_815994_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	36.9	9.1e-22
WP_011877136.1|816097_816424_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	50.6	5.1e-20
WP_011877137.1|816651_817101_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011877138.1|817124_818369_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.6	4.8e-42
WP_011877139.1|818402_818774_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	56.1	3.3e-31
>prophage 4
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	906144	934254	3608104	transposase	Pandoravirus(33.33%)	23	NA	NA
WP_011876735.1|906144_907428_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156779556.1|907442_907586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274454.1|907820_908045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877223.1|908279_909197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779718.1|909528_910341_+	M48 family peptidase	NA	NA	NA	NA	NA
WP_011877225.1|910654_911386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877226.1|911440_912187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877227.1|912200_912716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011876735.1|913000_914284_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156779556.1|914298_914442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779589.1|914676_914823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877228.1|914826_915492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877229.1|916275_916683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877231.1|917199_918441_-|transposase	IS4-like element ISDre1 family transposase	transposase	NA	NA	NA	NA
WP_011877233.1|919364_920264_+	site-specific DNA-methyltransferase	NA	S4VZJ3	Pandoravirus	56.5	9.5e-93
WP_041274456.1|920226_921225_+	XcyI family restriction endonuclease	NA	NA	NA	NA	NA
WP_011877235.1|921259_922564_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	43.4	3.5e-104
WP_011877236.1|923546_926141_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011877237.1|926153_927671_-	site-specific DNA-methyltransferase	NA	B3RH19	Escherichia_phage	35.7	5.8e-58
WP_011877238.1|927852_929628_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011877239.1|929835_930657_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_011877240.1|931090_932332_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011876859.1|932799_934254_+|transposase	IS1380-like element ISDre2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	1255343	1305344	3608104	portal,tail,integrase,protease,plate,capsid,head,terminase	Vibrio_phage(19.51%)	60	1258534:1258582	1308184:1308232
WP_011877540.1|1255343_1256138_+	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	30.4	1.4e-18
WP_011877541.1|1256452_1258318_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.7	1.7e-14
1258534:1258582	attL	TACCTTGGGGTGGTAGAGGTCGCAGGTTCAACTCCTGTCGCTCCGACCA	NA	NA	NA	NA
WP_011877542.1|1258678_1259809_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	26.7	1.0e-22
WP_156779610.1|1259809_1259974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011877543.1|1259976_1260609_-	helix-turn-helix domain-containing protein	NA	E5DV74	Deep-sea_thermophilic_phage	45.5	6.2e-30
WP_011877544.1|1260783_1261038_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVA3	Bacillus_phage	50.7	3.0e-12
WP_156779611.1|1261066_1261243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011877545.1|1261448_1261799_+	hypothetical protein	NA	A0A097BY30	Enterococcus_phage	45.1	4.2e-12
WP_041274834.1|1261854_1262541_+	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	42.3	1.3e-46
WP_011877547.1|1262626_1263142_+	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	30.2	1.3e-06
WP_011877548.1|1263141_1264335_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.9	1.9e-133
WP_011877549.1|1264446_1265004_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	68.5	8.3e-71
WP_011877550.1|1265067_1265328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779612.1|1265339_1265477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877551.1|1265473_1267426_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	66.3	1.5e-244
WP_011877552.1|1267467_1268838_+	helicase	NA	F4YCV3	Synechococcus_phage	54.9	6.7e-138
WP_011877553.1|1268827_1269820_+	DNA methylase	NA	F4YCV3	Synechococcus_phage	59.7	1.3e-106
WP_041274502.1|1269816_1270272_+	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_041274503.1|1270355_1270709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049755861.1|1270725_1271043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877555.1|1270927_1271914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877556.1|1272082_1274539_+	virulence-associated E family protein	NA	A0A1S7FZ15	Listeria_phage	52.2	3.3e-244
WP_041274504.1|1274938_1275148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877557.1|1275144_1275426_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.6	1.4e-21
WP_011877558.1|1275422_1276787_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	64.7	1.4e-172
WP_041274505.1|1276805_1276985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877559.1|1276988_1277468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041274506.1|1277442_1278120_+	FAD-dependent thymidylate synthase	NA	A0A125SJ60	Acidianus_tailed_spindle_virus	30.8	1.2e-23
WP_049755865.1|1278312_1278855_+	hypothetical protein	NA	I2E8Y5	Clostridium_phage	38.6	5.7e-24
WP_011877562.1|1279244_1279796_+	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	43.8	1.3e-23
WP_156779727.1|1279800_1281621_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	53.5	1.3e-181
WP_041274507.1|1281639_1281873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877564.1|1281891_1283487_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	54.2	5.5e-152
WP_083755144.1|1283479_1284691_+|protease	Clp protease ClpP	protease	A6M950	Geobacillus_virus	59.6	8.7e-73
WP_011877566.1|1284690_1285068_+|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	45.1	3.3e-15
WP_041274508.1|1285105_1286149_+|capsid	phage capsid protein	capsid	A0A0C5ABI0	Bacteriophage	42.1	2.0e-73
WP_041274509.1|1286161_1286398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877568.1|1286397_1286706_+	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	43.4	2.9e-17
WP_011877569.1|1286702_1287260_+	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	46.9	1.1e-27
WP_011877570.1|1287256_1287727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877571.1|1287716_1288031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877572.1|1288030_1289488_+|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	57.8	7.3e-167
WP_156779613.1|1289500_1290031_+|tail	phage tail protein	tail	A0A067ZJA9	Vibrio_phage	48.0	4.4e-37
WP_011877574.1|1290087_1290414_+	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	51.2	5.8e-16
WP_011877575.1|1290526_1293619_+|tail	phage tail tape measure protein	tail	A0A0K1Y5T7	Streptomyces_phage	38.9	1.6e-30
WP_041274511.1|1293608_1293824_+	hypothetical protein	NA	A0A2K9V482	Faecalibacterium_phage	44.3	1.4e-10
WP_011877576.1|1293820_1294840_+	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	36.0	4.0e-55
WP_011877577.1|1294840_1295320_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_011877578.1|1295323_1295713_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	48.8	1.5e-31
WP_011877579.1|1295728_1296043_+	GPW/gp25 family protein	NA	A0A067ZJ13	Vibrio_phage	46.9	5.2e-14
WP_011877580.1|1296029_1297154_+|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	50.1	1.3e-94
WP_011877581.1|1297146_1299096_+	hypothetical protein	NA	A0A0C5AJ63	Bacteriophage	45.3	2.7e-31
WP_011877582.1|1299114_1299573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877583.1|1299596_1300034_+	hypothetical protein	NA	R9TNJ7	Vibrio_phage	50.0	1.7e-07
WP_011877584.1|1300075_1300444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877585.1|1300444_1301947_+	hypothetical protein	NA	A0A2H4J4Y6	uncultured_Caudovirales_phage	32.6	5.4e-16
WP_011877586.1|1302072_1302375_+	diversity-generating retroelement protein Avd	NA	A0A0N7ACE0	Bacillus_phage	61.6	7.2e-29
WP_011877587.1|1302698_1303727_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	49.0	4.0e-95
WP_041274513.1|1303758_1304022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011877588.1|1304027_1305344_+	cell wall hydrolase/autolysin	NA	G3MB92	Bacillus_virus	31.8	3.3e-70
1308184:1308232	attR	TACCTTGGGGTGGTAGAGGTCGCAGGTTCAACTCCTGTCGCTCCGACCA	NA	NA	NA	NA
>prophage 6
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	1941191	2003428	3608104	protease,integrase,transposase	Ostreococcus_lucimarinus_virus(14.29%)	53	1952240:1952255	1998081:1998096
WP_011876820.1|1941191_1942646_-|transposase	IS1380-like element ISDre3 family transposase	transposase	NA	NA	NA	NA
WP_041274562.1|1943156_1945244_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_011878115.1|1945705_1947742_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011878116.1|1948295_1949063_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011878117.1|1949077_1950055_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_156779632.1|1950118_1950292_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011878118.1|1950489_1951344_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011878119.1|1951360_1952143_+	short-chain-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011878120.1|1952228_1953368_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
1952240:1952255	attL	ATTAACTGAAGAACAA	NA	NA	NA	NA
WP_011878121.1|1953784_1954945_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_011878122.1|1955298_1956483_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011878123.1|1956775_1958116_+	4-hydroxybutyrate CoA-transferase	NA	NA	NA	NA	NA
WP_011878124.1|1958267_1958885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878125.1|1959689_1960676_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_011878126.1|1960572_1961406_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.0	4.4e-52
WP_011878127.1|1961497_1962343_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011878128.1|1962347_1962731_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_083755155.1|1962672_1963647_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_156779633.1|1963695_1963860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878130.1|1963919_1964135_-	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
WP_156779634.1|1964886_1965498_+	MFS transporter	NA	NA	NA	NA	NA
WP_011878132.1|1965580_1966969_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011877240.1|1967366_1968608_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011878133.1|1968986_1969925_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_041274563.1|1970223_1970418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878134.1|1970447_1973246_+	UPF0182 family protein	NA	NA	NA	NA	NA
WP_011878135.1|1973352_1974429_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011878136.1|1974454_1974727_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_011878137.1|1974802_1975975_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011878138.1|1975993_1976623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878139.1|1976770_1977058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878140.1|1977415_1979542_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011878141.1|1979622_1980060_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.6	2.1e-08
WP_011878142.1|1980167_1980494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878143.1|1980646_1980895_+	YgiT-type zinc finger protein	NA	NA	NA	NA	NA
WP_011878144.1|1981044_1981842_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_011878145.1|1981851_1982493_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.4	2.2e-11
WP_011878146.1|1982837_1983203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156779746.1|1983199_1984462_-	hexokinase	NA	NA	NA	NA	NA
WP_011878148.1|1984803_1985064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878149.1|1985129_1986686_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	31.0	4.0e-54
WP_156779747.1|1986748_1987240_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011878151.1|1987688_1989608_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	3.3e-50
WP_011878152.1|1989792_1991268_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_156779635.1|1991279_1991453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878153.1|1991633_1993313_+	ribonuclease J	NA	NA	NA	NA	NA
WP_011878154.1|1993602_1995378_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_156779748.1|1995476_1996277_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011878156.1|1996327_1996801_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011878157.1|1997193_1998045_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.7	1.5e-07
WP_041274566.1|2001058_2001322_+	hypothetical protein	NA	NA	NA	NA	NA
1998081:1998096	attR	ATTAACTGAAGAACAA	NA	NA	NA	NA
WP_011878160.1|2001318_2001693_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_011878161.1|2002216_2003428_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	55.3	9.6e-56
>prophage 7
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	2119503	2175708	3608104	protease,coat,transposase,tRNA	Bacillus_virus(37.5%)	55	NA	NA
WP_011876859.1|2119503_2120958_-|transposase	IS1380-like element ISDre2 family transposase	transposase	NA	NA	NA	NA
WP_041274915.1|2121223_2121409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878262.1|2121920_2122676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011878263.1|2122620_2123748_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_011878264.1|2123965_2126248_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	3.3e-89
WP_041274578.1|2126406_2126619_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011878265.1|2126636_2127083_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_041274579.1|2127336_2127546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274916.1|2127542_2128367_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_011878267.1|2128625_2130290_-	ribonuclease J	NA	NA	NA	NA	NA
WP_011878268.1|2130523_2131414_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_011878269.1|2131439_2132666_-	aspartate kinase	NA	NA	NA	NA	NA
WP_011878270.1|2132668_2133691_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011878271.1|2133740_2134325_-	dipicolinate synthase subunit B	NA	NA	NA	NA	NA
WP_011878272.1|2134348_2135251_-	dipicolinate synthase subunit DpsA	NA	NA	NA	NA	NA
WP_011878273.1|2135360_2136158_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011878274.1|2136371_2136641_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_041274580.1|2136653_2136995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878276.1|2137101_2138370_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	33.1	3.3e-59
WP_011878277.1|2138498_2139248_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011878278.1|2139378_2140053_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	35.7	1.2e-20
WP_011878279.1|2140298_2142521_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_011878280.1|2142669_2142939_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_041274581.1|2143027_2143249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274582.1|2143261_2143492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878281.1|2143614_2144550_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011878282.1|2144640_2145573_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_011878283.1|2145574_2146546_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	34.0	6.8e-36
WP_011878284.1|2146538_2146901_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_011878285.1|2146931_2149889_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	27.6	2.5e-25
WP_011878286.1|2149925_2150237_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011878287.1|2150237_2150504_-	YlxR family protein	NA	NA	NA	NA	NA
WP_011878288.1|2150516_2151671_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_011878289.1|2151693_2152155_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_011878290.1|2152496_2153528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274583.1|2153687_2154641_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011878292.1|2154870_2156160_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011878293.1|2156193_2160474_-	PolC-type DNA polymerase III	NA	U5Q053	Bacillus_virus	33.3	3.8e-14
WP_011878294.1|2160531_2161695_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011878295.1|2161708_2163418_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011878296.1|2163482_2164532_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011878297.1|2164543_2165587_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_041274584.1|2165597_2166758_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011878299.1|2166779_2167868_-	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_011878300.1|2167894_2168680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274917.1|2168693_2169482_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	48.1	3.8e-29
WP_041274585.1|2169537_2169702_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_041274586.1|2169691_2169907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878303.1|2169908_2170463_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011878304.1|2170455_2171184_-	UMP kinase	NA	NA	NA	NA	NA
WP_011878305.1|2171262_2171916_-	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_011878306.1|2172042_2172741_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011878307.1|2172944_2173730_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_011878308.1|2173751_2175152_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.5	5.4e-42
WP_011878309.1|2175177_2175708_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 8
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	2587202	2595822	3608104		Synechococcus_phage(50.0%)	8	NA	NA
WP_011878671.1|2587202_2587814_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	42.5	1.9e-31
WP_011878672.1|2587838_2588891_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FZ01	Synechococcus_phage	44.6	1.2e-67
WP_011878673.1|2588903_2590328_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	6.4e-59
WP_011878674.1|2590312_2592538_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.8	3.2e-166
WP_011878675.1|2592537_2593239_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011878676.1|2593242_2593491_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011878677.1|2593655_2594366_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	39.1	1.3e-39
WP_011878678.1|2594529_2595822_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.8e-20
>prophage 9
NC_009253	Desulfotomaculum reducens MI-1, complete genome	3608104	2787452	2858817	3608104	portal,tail,integrase,transposase,protease,plate,capsid,terminase	Bacillus_phage(18.75%)	89	2807658:2807674	2860361:2860377
WP_011878868.1|2787452_2789168_-|protease	ATP-dependent protease LonB	protease	NA	NA	NA	NA
WP_011878869.1|2789455_2790706_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.3	1.5e-144
WP_011878870.1|2790725_2791313_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.9	5.9e-59
WP_011878871.1|2791389_2792697_-	trigger factor	NA	NA	NA	NA	NA
WP_156779666.1|2793118_2793325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011878872.1|2794120_2794942_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	26.3	9.8e-12
WP_011878873.1|2794920_2795727_-	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_011878874.1|2795748_2796045_-	membrane protein	NA	NA	NA	NA	NA
WP_011878875.1|2796037_2796688_-	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_083755221.1|2797060_2797693_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_041274629.1|2797656_2797977_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_011878878.1|2798196_2801151_-	SMC family ATPase	NA	A0A223LFJ9	Aeromonas_phage	26.1	1.0e-10
WP_011878879.1|2801150_2802512_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_041274630.1|2802683_2802983_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011878881.1|2803034_2803256_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_041274631.1|2803336_2803525_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_011878882.1|2803521_2804580_-	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	51.8	6.4e-72
WP_011878883.1|2804764_2805124_+	DUF2680 domain-containing protein	NA	NA	NA	NA	NA
WP_011878884.1|2805264_2805987_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	27.6	1.5e-16
WP_011878885.1|2806451_2807264_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_011878886.1|2807436_2807796_+	hypothetical protein	NA	NA	NA	NA	NA
2807658:2807674	attL	TCGTATTAAATTAAACC	NA	NA	NA	NA
WP_011878887.1|2807994_2808378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878888.1|2808746_2808932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878889.1|2809292_2809508_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041274632.1|2809730_2810045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878890.1|2810111_2810789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878891.1|2810751_2811990_-	cell division protein FtsK	NA	S5YCL4	Bacillus_phage	28.5	1.0e-12
WP_041274633.1|2811993_2812230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274634.1|2812241_2812448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274635.1|2812709_2812913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156779667.1|2813223_2813493_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_011878893.1|2813449_2813839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878894.1|2813835_2814123_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_011878895.1|2814301_2814562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878896.1|2814693_2814930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878897.1|2814934_2815501_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	43.4	3.7e-34
WP_011878898.1|2815481_2815724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878899.1|2815720_2816035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878900.1|2816098_2816413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878901.1|2816409_2818977_-	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	37.7	1.3e-65
WP_041274637.1|2819028_2819301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274638.1|2819571_2819793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878903.1|2819797_2821585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878904.1|2821586_2822450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274639.1|2822456_2822765_-|plate	BppU family phage baseplate upper protein	plate	A0A0U4JWX9	Bacillus_phage	36.8	3.7e-12
WP_011878905.1|2822886_2823615_-|tail	phage tail family protein	tail	W8EK66	Geobacillus_phage	26.5	5.5e-14
WP_011878906.1|2823611_2825555_-	hypothetical protein	NA	A0A1S5SEV9	Streptococcus_phage	75.8	3.8e-22
WP_011878907.1|2825716_2826130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878908.1|2826142_2826928_-|tail	phi13 family phage major tail protein	tail	A0A2K5B294	Erysipelothrix_phage	35.0	1.2e-14
WP_011878909.1|2826935_2827352_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_041274641.1|2827348_2827660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878910.1|2827646_2828000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878911.1|2827971_2828280_-	hypothetical protein	NA	E2ELI6	Clostridium_phage	42.9	6.3e-12
WP_011878912.1|2828294_2829491_-|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	47.8	6.5e-89
WP_156779762.1|2829517_2830243_-|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	44.1	1.0e-44
WP_011878914.1|2830290_2831457_-|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	36.3	1.4e-72
WP_156779668.1|2831472_2833101_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	44.3	4.8e-119
WP_011878916.1|2833126_2833441_-	hypothetical protein	NA	E2ELI1	Clostridium_phage	51.5	2.3e-22
WP_041274643.1|2833551_2833908_-	hypothetical protein	NA	Q9AZZ0	Lactococcus_phage	32.1	5.0e-05
WP_041274644.1|2833956_2834466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878918.1|2834932_2835601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878919.1|2835774_2836296_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	30.9	1.4e-16
WP_041274645.1|2836303_2836507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878920.1|2836509_2836908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878921.1|2837224_2840188_-	DUF927 domain-containing protein	NA	I3VYX9	Thermoanaerobacterium_phage	33.0	3.5e-83
WP_011878922.1|2840251_2840497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274646.1|2840545_2840770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878923.1|2840777_2841143_-	VRR-NUC domain-containing protein	NA	A0A1X9I642	Streptococcus_phage	49.6	8.2e-19
WP_011878924.1|2841139_2842519_-	DEAD/DEAH box helicase	NA	V5YTP6	Pseudomonas_phage	41.2	1.7e-85
WP_011878925.1|2842522_2843197_-	single-stranded DNA-binding protein	NA	A0A2K9V3K2	Faecalibacterium_phage	41.9	7.8e-15
WP_011878926.1|2843199_2843844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878927.1|2843854_2844349_-	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	38.9	2.2e-19
WP_041274647.1|2844554_2844953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041274648.1|2844943_2845138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156779669.1|2845180_2845342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878929.1|2845560_2845935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878930.1|2846076_2846694_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	48.5	9.6e-44
WP_011878931.1|2846819_2847083_-	hypothetical protein	NA	A0A0S2MVA3	Bacillus_phage	41.9	3.2e-09
WP_156779670.1|2847199_2847883_+	helix-turn-helix domain-containing protein	NA	E5DV74	Deep-sea_thermophilic_phage	29.9	5.0e-17
WP_011878933.1|2847889_2849119_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	27.7	7.3e-27
WP_011878934.1|2849700_2850270_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_011878935.1|2850282_2850522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011878936.1|2850724_2852128_+|transposase	IS1380-like element ISDre4 family transposase	transposase	NA	NA	NA	NA
WP_041274649.1|2852400_2852712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011878937.1|2853039_2853267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156779763.1|2853765_2854074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041274969.1|2854417_2854948_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	53.8	1.9e-40
WP_011878941.1|2856048_2857152_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	4.1e-13
WP_011876859.1|2857362_2858817_+|transposase	IS1380-like element ISDre2 family transposase	transposase	NA	NA	NA	NA
2860361:2860377	attR	GGTTTAATTTAATACGA	NA	NA	NA	NA
