The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009525	Mycobacterium tuberculosis H37Ra, complete sequence	4419977	1989482	2045418	4419977	transposase,protease,integrase	Burkholderia_virus(57.14%)	42	2001756:2001774	2055282:2055300
WP_087902221.1|1989482_1990744_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899004.1|1991402_1992548_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003911638.1|1992773_1993877_+	sulfite oxidase	NA	NA	NA	NA	NA
WP_003916884.1|1994077_1996915_+	RND family transporter	NA	NA	NA	NA	NA
WP_087902221.1|1997428_1998690_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009934708.1|1998725_1999250_+	cutinase family protein	NA	NA	NA	NA	NA
2001756:2001774	attL	CCGGCCCCGCCGTTGCCGA	NA	NA	NA	NA
WP_003911649.1|2002939_2004346_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003899008.1|2004355_2004739_-	DUF5073 family protein	NA	NA	NA	NA	NA
WP_003899009.1|2004738_2005527_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2005836_2007097_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003912798.1|2007219_2007345_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003408734.1|2009073_2009289_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	45.8	4.5e-09
WP_099171721.1|2009346_2009475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899012.1|2009668_2009938_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_003408743.1|2010005_2010365_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003905649.1|2010545_2012402_+	PE family protein	NA	NA	NA	NA	NA
WP_003904700.1|2012557_2013802_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_003911655.1|2013890_2015096_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_003408749.1|2015092_2016379_+	L-gulono-1,4-lactone dehydrogenase	NA	NA	NA	NA	NA
WP_003408753.1|2016567_2016879_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_003408754.1|2016951_2017698_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003899017.1|2017763_2019104_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003408760.1|2019103_2019922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899018.1|2019926_2020487_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003911660.1|2020677_2021892_+	cytochrome P450 Cyp144	NA	NA	NA	NA	NA
WP_003408775.1|2022012_2022462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003408781.1|2022617_2024411_-	DUF4407 domain-containing protein	NA	NA	NA	NA	NA
WP_003408792.1|2024630_2025194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003408795.1|2025233_2027408_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_003899021.1|2027671_2029192_+	type VII secretion system ESX-5 subunit EccB5	NA	V5UN45	Mycobacterium_phage	38.1	4.7e-76
WP_003408799.1|2029188_2033364_+	type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5	NA	V5UPA0	Mycobacterium_phage	27.0	2.6e-116
WP_003408802.1|2033378_2034560_-	cytochrome P450	NA	NA	NA	NA	NA
WP_003408803.1|2034759_2034963_+	ferredoxin	NA	NA	NA	NA	NA
WP_003901254.1|2035232_2036330_+	type VII secretion system ESX-5 target PPE25	NA	NA	NA	NA	NA
WP_003408976.1|2036408_2036708_+	type VII secretion system ESX-5 target PE18	NA	NA	NA	NA	NA
WP_003408979.1|2036721_2037903_+	type VII secretion system ESX-5 target PPE26	NA	NA	NA	NA	NA
WP_003408805.1|2038356_2039409_+	type VII secretion system ESX-5 target PPE27	NA	NA	NA	NA	NA
WP_003408807.1|2039835_2040135_+	type VII secretion system ESX-5 target PE19	NA	NA	NA	NA	NA
WP_003408840.1|2040625_2040910_+	effector	NA	NA	NA	NA	NA
WP_003408846.1|2040997_2041900_+	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_003900411.1|2042171_2043683_+	type VII secretion system ESX-5 subunit EccD5	NA	NA	NA	NA	NA
WP_003408854.1|2043660_2045418_+|protease	type VII secretion system ESX-5 serine protease mycosin MycP5	protease	V5UPA7	Mycobacterium_phage	34.3	7.4e-73
2055282:2055300	attR	CCGGCCCCGCCGTTGCCGA	NA	NA	NA	NA
>prophage 2
NC_009525	Mycobacterium tuberculosis H37Ra, complete sequence	4419977	2953156	2988387	4419977	capsid,integrase,terminase,head,protease,tRNA,transposase	Tupanvirus(12.5%)	40	2981957:2981984	2992939:2992966
WP_003413486.1|2953156_2955235_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2955343_2955571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2955567_2956953_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2957297_2957798_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2957814_2958255_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2958350_2959079_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2959063_2959417_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2959429_2959855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2959851_2960526_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2960603_2961425_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2961560_2962454_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2962456_2963275_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2963289_2964471_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2964529_2964961_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2965474_2966716_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2967130_2967388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2967734_2968859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2968860_2969400_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2970876_2971158_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2971302_2971788_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2971814_2972069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2972072_2974409_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2974437_2974680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2974680_2975358_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2975553_2976210_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2976372_2976819_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2976993_2977326_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2977445_2977805_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2977906_2978365_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2978500_2978881_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2978877_2980374_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2980608_2980800_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2981957:2981984	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2982090_2982522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2982518_2983517_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2983530_2983995_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_143711313.1|2984127_2985388_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.7	2.1e-82
WP_009935348.1|2985415_2985601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935349.1|2985762_2987202_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2987209_2987743_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2987895_2988387_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
2992939:2992966	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NC_009525	Mycobacterium tuberculosis H37Ra, complete sequence	4419977	3721273	3805484	4419977	tRNA,transposase,protease	Burkholderia_virus(33.33%)	49	NA	NA
WP_087902221.1|3721273_3722534_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003905037.1|3722589_3724302_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009935306.1|3724234_3725173_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003917150.1|3725181_3726549_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
WP_003417415.1|3726617_3727835_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3727930_3729439_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3729435_3730587_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3730777_3731623_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|3732097_3732538_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3732571_3733441_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3733461_3734472_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003905041.1|3734744_3735389_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3735455_3736685_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3736967_3738317_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3738328_3739468_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3739464_3740196_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012054209.1|3740204_3746048_-	PPE family protein	NA	NA	NA	NA	NA
WP_009938644.1|3746096_3747113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886165.1|3747270_3751887_-	PE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3752310_3752568_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_010886166.1|3752823_3762297_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3762922_3763369_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003900675.1|3763405_3764146_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3764440_3764728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3778224_3778614_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3778627_3778921_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3778917_3779763_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3779886_3780162_+	type II toxin-antitoxin system antitoxin RelJ	NA	NA	NA	NA	NA
WP_003417760.1|3780158_3780416_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3780457_3781648_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3781764_3782133_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3782129_3782681_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3782687_3783269_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3783249_3783618_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3783595_3783988_-	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_003900676.1|3783984_3786615_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003417878.1|3786850_3787315_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3787681_3789457_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3789457_3790102_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003912209.1|3790124_3790535_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003417885.1|3790623_3793899_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.7e-118
WP_003900036.1|3794054_3795395_+	diacyglycerol O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3795436_3796612_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3796665_3796770_+	PE family protein	NA	NA	NA	NA	NA
WP_003417900.1|3797743_3799171_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3799278_3799932_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3799970_3801476_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3801480_3802371_-	diterpene synthase	NA	NA	NA	NA	NA
WP_087902221.1|3804222_3805484_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
