The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009337	Chlorobium phaeovibrioides DSM 265, complete genome	1966858	96402	154611	1966858	integrase,protease,transposase	Leptospira_phage(20.0%)	57	111480:111494	132548:132562
WP_011889339.1|96402_97389_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011889340.1|98044_98659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889341.1|99163_99832_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_081424449.1|100652_100865_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.0	6.2e-11
WP_011889342.1|100914_102894_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_041469954.1|102877_104281_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011889344.1|104369_105395_-	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_011889345.1|105502_106048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889347.1|106496_107591_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_011889348.1|107698_108136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155811630.1|108125_108275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889349.1|108297_109245_+	ADP-ribosylglycohydrolase family protein	NA	M1HKZ0	Acanthocystis_turfacea_Chlorella_virus	26.5	1.2e-24
WP_011889350.1|109285_109975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041469662.1|109983_110232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889351.1|110384_111266_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	36.8	7.5e-34
WP_155811631.1|111347_111521_+	hypothetical protein	NA	NA	NA	NA	NA
111480:111494	attL	TTGAAGAGTTCCTCC	NA	NA	NA	NA
WP_011889352.1|112111_117964_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_155811670.1|118909_119389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889355.1|120505_121198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889356.1|121240_122752_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_041469666.1|122876_123299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889358.1|123943_124405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155811632.1|124614_124785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889360.1|124785_125316_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011889361.1|125509_126658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011358431.1|128281_128566_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011358432.1|128657_128993_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011889363.1|129317_130175_+	ModD protein	NA	NA	NA	NA	NA
WP_011358434.1|130187_130961_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011889364.1|130974_131661_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011358436.1|131657_132713_+	molybdenum ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	3.8e-16
132548:132562	attR	GGAGGAACTCTTCAA	NA	NA	NA	NA
WP_155811633.1|132802_133916_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	3.3e-42
WP_011889367.1|133994_134732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041469669.1|134896_135280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155811634.1|135664_136153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889369.1|136202_136577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041469971.1|136615_137065_+	5'-3'-deoxyribonucleotidase	NA	I6X231	Vibriophage	57.9	1.1e-44
WP_011889371.1|137154_137760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889372.1|137866_138271_-	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_011889373.1|138906_139491_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_011889374.1|139522_140155_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041469976.1|140313_140916_+	VWA domain-containing protein	NA	A0A0P0YMY2	Yellowstone_lake_phycodnavirus	39.8	3.3e-25
WP_011889376.1|141052_141409_+	DUF3127 domain-containing protein	NA	NA	NA	NA	NA
WP_049752382.1|141597_142419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889378.1|142465_143311_+	DUF4412 domain-containing protein	NA	NA	NA	NA	NA
WP_011889379.1|143341_143818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889380.1|144023_144212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889381.1|144217_144673_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	6.4e-29
WP_011889382.1|144684_145950_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	45.0	9.6e-91
WP_011889383.1|146087_147452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889384.1|147836_149063_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011889385.1|149243_150698_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011889386.1|150752_150911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889387.1|151012_151549_-	nitroreductase	NA	NA	NA	NA	NA
WP_011889388.1|151545_152157_-	DUF1997 domain-containing protein	NA	NA	NA	NA	NA
WP_011889389.1|152207_153281_-	peptide chain release factor 1	NA	A0A2I2MPK0	Mycobacterium_phage	47.7	2.7e-09
WP_011889390.1|153297_154611_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 2
NC_009337	Chlorobium phaeovibrioides DSM 265, complete genome	1966858	547010	556603	1966858	tRNA	Enterobacteria_phage(42.86%)	8	NA	NA
WP_011889718.1|547010_547889_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.8	9.0e-104
WP_011889719.1|547949_548534_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	3.0e-47
WP_011889720.1|548530_549391_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.5	6.4e-38
WP_011889721.1|549403_550456_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.8	7.5e-89
WP_011889722.1|550474_551443_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.3	1.5e-43
WP_011889723.1|551439_552855_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	5.0e-56
WP_011889724.1|552954_553182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041470035.1|553351_556603_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	32.8	1.5e-167
>prophage 3
NC_009337	Chlorobium phaeovibrioides DSM 265, complete genome	1966858	708657	764859	1966858	integrase,transposase	Escherichia_phage(11.76%)	60	715385:715405	766860:766880
WP_011889858.1|708657_710607_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7QY74	Vibrio_phage	25.1	4.7e-12
WP_011889859.1|710853_711672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889860.1|711668_712286_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011889861.1|712511_712922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011358595.1|713072_713312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889862.1|713823_715212_+	ATP-binding protein	NA	NA	NA	NA	NA
715385:715405	attL	GGCTGTTCGGACCCCGGCTGT	NA	NA	NA	NA
WP_041469732.1|715490_715814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041469734.1|715810_716773_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	52.2	4.7e-90
WP_011889864.1|716785_717901_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	67.2	5.6e-135
WP_155811677.1|718022_719726_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-21
WP_011889866.1|720062_721283_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041469736.1|721519_722239_+	hypothetical protein	NA	F2Y1U6	Organic_Lake_phycodnavirus	32.1	2.3e-09
WP_155811647.1|722413_723169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041469737.1|723193_723688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081424425.1|723654_723948_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_011889869.1|724015_725242_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_081424426.1|725314_725851_+	DUF268 domain-containing protein	NA	NA	NA	NA	NA
WP_011889870.1|726095_726821_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_011889871.1|726828_727686_+	alpha-1,2-fucosyltransferase	NA	NA	NA	NA	NA
WP_011889872.1|727682_728600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049752398.1|728596_729112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049752400.1|729095_729578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081424427.1|729472_731158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889874.1|731173_732121_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	49.5	1.5e-88
WP_011889875.1|732122_733670_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011889876.1|733713_734622_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011889877.1|734621_736541_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.9	4.3e-34
WP_041470068.1|736549_737341_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_011889879.1|737337_739119_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155811648.1|739127_739664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889881.1|739676_740270_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	33.0	7.6e-06
WP_155811649.1|740610_740970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889882.1|741131_742340_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	25.4	4.2e-19
WP_155811678.1|742351_742957_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_041469745.1|743071_743671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081424428.1|743919_744897_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	24.7	4.9e-10
WP_011889887.1|745644_747144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889888.1|747155_748304_+	O-antigen polymerase	NA	NA	NA	NA	NA
WP_081424429.1|748269_749088_+	glycosyltransferase family 2 protein	NA	A0A218M8U1	Mycobacterium_phage	35.2	5.2e-05
WP_011889890.1|749241_749727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011889891.1|749756_750623_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081424430.1|750789_750963_+	hypothetical protein	NA	A0A2H4UUT1	Bodo_saltans_virus	54.4	7.8e-12
WP_011889892.1|750975_751827_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_041470078.1|751936_752929_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.6	5.2e-07
WP_011889894.1|752977_753472_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155811679.1|753624_754158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011889896.1|755053_755389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011358561.1|756862_757201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889897.1|757212_757560_-	addiction module protein	NA	A0A141GEX6	Brucella_phage	37.2	2.7e-11
WP_081424431.1|757611_758079_+	hypothetical protein	NA	B0FIJ9	Escherichia_phage	37.3	1.9e-07
WP_011889899.1|758322_758955_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011889900.1|758986_759367_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011889901.1|759957_760914_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_011889902.1|760917_761241_-	phosphatidylinositol kinase	NA	NA	NA	NA	NA
WP_011889903.1|761244_761451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041469752.1|761778_761973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889904.1|761973_762267_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	45.2	3.0e-11
WP_011889905.1|762263_762569_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	45.7	2.2e-17
WP_011889906.1|763009_764518_-	Fic family protein	NA	NA	NA	NA	NA
WP_011889907.1|764568_764859_-|transposase	transposase	transposase	NA	NA	NA	NA
766860:766880	attR	ACAGCCGGGGTCCGAACAGCC	NA	NA	NA	NA
