The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009077	Mycobacterium sp. JLS, complete genome	6048425	1892661	1900387	6048425		Bacillus_phage(16.67%)	8	NA	NA
WP_011855252.1|1892661_1893519_+	short chain dehydrogenase	NA	W8CYX9	Bacillus_phage	38.5	1.3e-06
WP_011855253.1|1893526_1894699_-	ATP-binding protein	NA	A0A077SLJ9	Escherichia_phage	35.7	4.2e-56
WP_011559212.1|1894708_1895776_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	26.5	1.0e-13
WP_011559213.1|1895779_1896382_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011559214.1|1896477_1897044_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.1	1.2e-08
WP_011559215.1|1897509_1897761_+	NrdH-redoxin	NA	V5UN81	Mycobacterium_phage	64.5	1.6e-21
WP_011559216.1|1897793_1898252_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_082947857.1|1898218_1900387_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.5e-205
>prophage 2
NC_009077	Mycobacterium sp. JLS, complete genome	6048425	2313268	2357956	6048425	integrase,transposase	Mycobacterium_phage(14.29%)	31	2313059:2313082	2369680:2369703
2313059:2313082	attL	GTGGTGCGCGATACTGGGATTGAA	NA	NA	NA	NA
WP_011855447.1|2313268_2314435_+|integrase	site-specific integrase	integrase	A0A076YKK3	Mycobacterium_phage	36.6	2.1e-55
WP_011855448.1|2314492_2315443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011855449.1|2315497_2316265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085976251.1|2319274_2320536_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	60.3	2.3e-84
WP_041925035.1|2320492_2320963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011855454.1|2320959_2321856_-	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_011855455.1|2321855_2323211_-	restriction modification system DNA specificity subunit	NA	NA	NA	NA	NA
WP_083776349.1|2323207_2324353_-	SAM-dependent methyltransferase	NA	A0A220A2U5	Liberibacter_phage	29.0	3.0e-06
WP_085976247.1|2324622_2325851_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011768155.1|2325925_2327068_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_011855458.1|2327427_2327925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011855459.1|2327918_2329100_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011855460.1|2329096_2330182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011559050.1|2330196_2331222_-	zinc-binding alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.5	3.1e-15
WP_041925036.1|2331279_2332107_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011855462.1|2332126_2333503_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
WP_011855463.1|2333565_2334075_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011855464.1|2334632_2336093_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011559042.1|2336288_2336579_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011559041.1|2336575_2338348_-	succinate dehydrogenase/fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_085976237.1|2338449_2339641_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	8.9e-46
WP_011777800.1|2339771_2340281_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_085975380.1|2341342_2342571_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011855466.1|2342741_2343044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011855467.1|2343122_2345873_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011855468.1|2345950_2348740_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.1	9.4e-147
WP_011855469.1|2348736_2352039_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	28.1	2.6e-39
WP_011855470.1|2352126_2352540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011855471.1|2352536_2354681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011855472.1|2354677_2356498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011855473.1|2356501_2357956_-|integrase	integrase	integrase	NA	NA	NA	NA
2369680:2369703	attR	GTGGTGCGCGATACTGGGATTGAA	NA	NA	NA	NA
>prophage 3
NC_009077	Mycobacterium sp. JLS, complete genome	6048425	4575375	4583561	6048425		Gordonia_phage(16.67%)	10	NA	NA
WP_011856683.1|4575375_4576611_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.5	6.5e-68
WP_011561486.1|4576597_4576810_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011856684.1|4576873_4577989_+	steroid Delta-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.3	4.1e-29
WP_041925139.1|4577999_4578320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011856686.1|4578394_4579111_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.4	2.4e-14
WP_011856687.1|4579195_4579465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041925140.1|4579424_4580969_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	51.7	4.7e-156
WP_011856689.1|4580968_4581877_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011856690.1|4581869_4582745_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	28.9	1.3e-14
WP_011856691.1|4582790_4583561_+	NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	42.5	2.1e-11
