The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	119200	183516	3495687	tRNA,transposase,integrase	Leptospira_phage(25.0%)	58	134379:134438	182349:183545
WP_004189587.1|119200_119692_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_004189721.1|119800_120412_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004189237.1|120641_121127_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_004534288.1|121263_122313_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_004190177.1|122505_123435_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.7	4.1e-22
WP_004534369.1|123671_124184_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_004189743.1|124412_124691_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004266891.1|125095_126646_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_004189739.1|126655_127498_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004189909.1|127756_128515_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|128726_130190_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|130348_131959_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|131971_132154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|132126_133386_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|133653_134232_+	pseudouridine synthase	NA	NA	NA	NA	NA
134379:134438	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_038802950.1|134425_135546_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189968.1|135576_136248_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.1	1.3e-46
WP_011203829.1|136474_136567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|136961_138082_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004557196.1|138454_138667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203825.1|138663_139257_-	chorismate mutase	NA	NA	NA	NA	NA
WP_011203824.1|139782_140259_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004188913.1|140405_142742_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004554214.1|142729_144001_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004203540.1|143997_144486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205188.1|144772_145120_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004550102.1|145777_146026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|146194_146671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|146693_146954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186184.1|147295_148516_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
WP_004189384.1|148863_149880_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.4	5.4e-52
WP_004189234.1|150009_150942_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189599.1|151058_153353_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004189239.1|153709_156412_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_004189242.1|156436_156574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189569.1|156632_157346_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004189913.1|157679_158252_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_004189253.1|158248_158659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189962.1|158739_160050_-	guanine deaminase	NA	NA	NA	NA	NA
WP_004189169.1|160075_161452_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_004189005.1|161549_162575_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_004189595.1|162616_163639_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	37.8	1.1e-44
WP_011203822.1|163633_163984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189653.1|164147_164657_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004550105.1|164765_166142_-	amidase	NA	NA	NA	NA	NA
WP_011203821.1|166138_166876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011203820.1|167008_168079_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_073699190.1|168289_168514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188918.1|168567_169863_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.5	3.2e-65
WP_011203819.1|170251_172132_-	tetratricopeptide repeat protein	NA	F2Y1J7	Organic_Lake_phycodnavirus	32.2	1.7e-11
WP_004200810.1|172279_173896_+	FAD-binding monooxygenase	NA	NA	NA	NA	NA
WP_004195994.1|174532_177487_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_004189204.1|177501_179067_-	formate dehydrogenase beta subunit	NA	NA	NA	NA	NA
WP_004189882.1|179063_179537_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_004195993.1|179667_180774_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004189371.1|180875_181139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200808.1|181319_182006_-	phospholipid methyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|182395_183516_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
182349:183545	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCATTGCTTCGGCCAGCAGTTTCTTCAGTCGGGCATTCTCCACCTCGAGGCCCTTGAGCCGGCGGGCTTCCGAGACTTCCATGCCGCCGAACTTCGCGCGCCAGGTGTAGAACGACGCGTCACTGAACCCATGCTTCCTGCACAGTTCCTTGACCGGCATACCGGCCTCGGCTTCCTTCAGAAACCCGATGATTTGCTGTTCCGTAAAGCGCTTCTTCATGTTCGTCTTCTTCTCCGAAAACGAACTTT	NA	NA	NA	NA
>prophage 2
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	201395	210231	3495687		Bacillus_phage(16.67%)	9	NA	NA
WP_004189214.1|201395_202796_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004203554.1|202764_203751_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	1.8e-15
WP_004190173.1|203809_204802_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|204873_205191_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004204273.1|205203_205503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532363.1|205514_206417_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_085962626.1|206642_207995_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|208122_209046_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|209388_210231_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 3
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	233112	290795	3495687	transposase,protease	Streptococcus_phage(16.67%)	56	NA	NA
WP_004188997.1|233112_234483_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004191998.1|234619_236083_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189313.1|236211_236715_-	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.4	9.6e-26
WP_080518661.1|236922_238725_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832229.1|238986_240264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201791.1|240260_240629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195958.1|240893_241190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189039.1|241151_242537_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189921.1|242593_243565_+	thymidylate synthase	NA	A0A1V0DY05	Yersinia_phage	36.1	2.9e-47
WP_004191998.1|243696_245160_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189917.1|247998_248709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004197804.1|249272_249467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190145.1|249654_250161_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004189867.1|250639_252034_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_011203828.1|252036_252222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|252417_253538_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011857877.1|253933_255103_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004194783.1|255165_255939_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	4.8e-16
WP_004185649.1|255938_256655_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.4	2.4e-14
WP_024900363.1|256951_257620_+	DUF2278 family protein	NA	NA	NA	NA	NA
WP_004186487.1|257792_258263_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004185932.1|258267_259452_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	8.6e-25
WP_004185343.1|259728_260760_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_073699251.1|260842_261868_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011204920.1|261860_262133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185598.1|262165_262888_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_004204344.1|263035_263401_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_011832225.1|263412_264375_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186473.1|264576_265473_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186242.1|265594_266491_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004185849.1|266693_267383_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_004186540.1|267397_268294_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_004186330.1|268375_269158_-	aldolase	NA	NA	NA	NA	NA
WP_004185798.1|269289_269853_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011204067.1|269937_270384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|270680_271801_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004194779.1|271869_273051_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004186089.1|273111_274020_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004186239.1|274120_274804_-	VOC family protein	NA	NA	NA	NA	NA
WP_004185957.1|274954_276409_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_009919375.1|276410_276548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185742.1|276544_278443_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.5	3.0e-120
WP_004550738.1|278451_279045_+	chorismate lyase	NA	NA	NA	NA	NA
WP_011204944.1|279041_279521_+	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_004185567.1|279771_280701_+	spermidine synthase	NA	NA	NA	NA	NA
WP_004194775.1|280892_281132_+	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_004186395.1|281128_282679_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_004186249.1|282804_283239_-	VOC family protein	NA	NA	NA	NA	NA
WP_004186409.1|283604_284558_-	transaldolase	NA	A0A0E3F5V4	Synechococcus_phage	29.6	4.3e-11
WP_011204065.1|284625_284982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186095.1|284959_286177_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_004186167.1|286260_287436_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004186676.1|287648_288491_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_004185759.1|288724_289084_+	cytochrome c	NA	NA	NA	NA	NA
WP_004194773.1|289124_289493_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_004187628.1|289574_290795_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 4
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	643408	687701	3495687	coat,tRNA,transposase	Leptospira_phage(33.33%)	38	NA	NA
WP_038802950.1|643408_644529_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193365.1|644623_645016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193170.1|645275_646589_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_011203888.1|646637_646814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203889.1|647105_647360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552605.1|647444_647753_+	lipoprotein	NA	NA	NA	NA	NA
WP_004193855.1|648005_648287_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009937836.1|648286_648547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192394.1|648754_649747_-	hydrolase	NA	NA	NA	NA	NA
WP_004196700.1|649791_650988_-	MFS transporter	NA	NA	NA	NA	NA
WP_009920897.1|651143_651281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|651494_652388_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|652725_652947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|653032_653218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|653204_653750_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|653802_654363_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|654439_654964_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191504.1|654981_655821_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004196717.1|658293_659259_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004552891.1|659669_661751_+	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004192810.1|661751_662384_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192651.1|664373_665993_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004191546.1|666165_667353_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004196723.1|667592_667913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266854.1|667971_669165_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004521730.1|669362_671036_-	acid phosphatase	NA	NA	NA	NA	NA
WP_011203890.1|671470_672595_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004192265.1|672638_673499_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004196725.1|673495_673675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193860.1|675976_676363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203891.1|676390_676864_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193654.1|677195_678905_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_011203892.1|679121_679586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204969.1|679715_680936_-	CoA transferase	NA	NA	NA	NA	NA
WP_004204967.1|681594_684219_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004192193.1|684722_685688_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011807697.1|685834_686551_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_038802950.1|686581_687701_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	1482718	1548488	3495687	transposase,protease	Streptococcus_phage(36.36%)	49	NA	NA
WP_004191998.1|1482718_1484182_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|1484290_1484860_-	phasin family protein	NA	NA	NA	NA	NA
WP_004557110.1|1485529_1486651_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_004191998.1|1486770_1488234_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|1488490_1490260_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|1490567_1492157_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|1492289_1494986_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011204038.1|1495129_1497769_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|1497765_1498404_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|1498720_1499578_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_011204039.1|1499815_1500139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|1500255_1502355_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_009931175.1|1502584_1503799_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|1503739_1504024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|1504509_1505790_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|1505833_1507219_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|1507469_1511195_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|1511191_1512745_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|1512741_1513446_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|1513482_1514169_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|1514310_1516233_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|1516268_1516970_+	response regulator	NA	NA	NA	NA	NA
WP_011204042.1|1516941_1517118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193531.1|1517116_1517893_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|1518175_1519639_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|1519772_1521308_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004532137.1|1521345_1522440_-	nitrogen regulation protein NR(II)	NA	NA	NA	NA	NA
WP_004192601.1|1522654_1524070_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|1524474_1524939_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|1525191_1526010_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|1526006_1526840_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_009966722.1|1526895_1527168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192998.1|1527383_1528373_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|1528389_1529382_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|1529483_1533611_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|1533634_1535011_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|1535063_1535339_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_076882745.1|1535511_1536855_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|1537051_1538578_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|1538574_1540368_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|1540476_1541379_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|1541780_1543244_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|1543360_1543927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1544070_1545191_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|1545300_1545777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009970291.1|1545875_1546217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|1546233_1546458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|1546714_1547851_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|1547948_1548488_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	2060178	2115776	3495687	tRNA,transposase,protease	Leptospira_phage(18.75%)	53	NA	NA
WP_038802950.1|2060178_2061299_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004550771.1|2061581_2062103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191998.1|2062368_2063832_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004186453.1|2063954_2064935_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004186190.1|2064937_2065393_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004185928.1|2065531_2066368_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|2066661_2066895_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004185395.1|2066912_2067080_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004554550.1|2067202_2068849_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004197485.1|2068820_2069039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185611.1|2069040_2069925_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_004185886.1|2069921_2071058_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_004186237.1|2071226_2072423_-	aminotransferase	NA	NA	NA	NA	NA
WP_004186398.1|2072619_2073972_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004186079.1|2073983_2075246_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004185746.1|2075242_2075905_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	1.6e-25
WP_004535897.1|2076029_2077022_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004185348.1|2077133_2079971_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.6e-80
WP_004186086.1|2079970_2080471_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004186216.1|2080532_2081744_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-41
WP_004186718.1|2081807_2082254_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	7.9e-48
WP_004185819.1|2082342_2083125_-	membrane protein	NA	NA	NA	NA	NA
WP_011832233.1|2083289_2084033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325437.1|2084293_2085413_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|2085609_2085828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|2086025_2086535_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|2086835_2088950_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_009936593.1|2089231_2089438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038796688.1|2090122_2091601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|2092145_2092991_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|2093159_2093906_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|2094621_2095983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|2095955_2096291_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|2096587_2098027_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004200476.1|2098709_2099984_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|2100115_2100721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011204108.1|2101020_2101182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186428.1|2101260_2102283_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|2102298_2102826_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|2102910_2103666_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|2103899_2105105_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|2105193_2106314_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|2107376_2107955_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|2108151_2109534_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|2109528_2109759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|2109991_2111020_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|2111000_2111207_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|2111380_2112172_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_009929233.1|2112192_2112390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185840.1|2112380_2113043_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|2113158_2114622_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|2114725_2114929_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|2115461_2115776_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 7
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	2165922	2175159	3495687		unidentified_phage(16.67%)	7	NA	NA
WP_004194112.1|2165922_2167470_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|2167506_2168034_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194274.1|2168030_2168714_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194137.1|2168778_2169594_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194350.1|2169769_2171776_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194374.1|2171809_2172940_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194034.1|2173206_2175159_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 8
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	2260115	2301285	3495687	tRNA,transposase,portal	Leptospira_phage(21.43%)	41	NA	NA
WP_004189649.1|2260115_2261900_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004189319.1|2262102_2262426_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_004191998.1|2262531_2263995_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_096325434.1|2264082_2265203_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197759.1|2265580_2266135_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_004197761.1|2266314_2266731_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004190110.1|2267132_2268227_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004200726.1|2268223_2269165_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004204797.1|2269336_2270938_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011832311.1|2270956_2272405_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_011203779.1|2272401_2272653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189689.1|2272668_2273217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189874.1|2273809_2274379_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189434.1|2274481_2275450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832313.1|2275592_2276687_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190014.1|2276715_2277828_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004189258.1|2277838_2278714_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_011203781.1|2278920_2279085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203781.1|2279892_2280057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188948.1|2280709_2281723_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.4	1.3e-194
WP_004188977.1|2281795_2282080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|2282076_2282559_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|2282609_2283730_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197759.1|2284107_2284662_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_004197761.1|2284841_2285258_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004190110.1|2285659_2286754_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004200726.1|2286750_2287692_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004204797.1|2287863_2289465_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011832311.1|2289483_2290932_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_011203779.1|2290928_2291180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189689.1|2291195_2291744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189874.1|2292336_2292906_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189434.1|2293008_2293977_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832313.1|2294119_2295214_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190014.1|2295242_2296355_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004189258.1|2296365_2297241_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_011203781.1|2297447_2297612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188948.1|2298264_2299278_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.4	1.3e-194
WP_004188977.1|2299350_2299635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|2299631_2300114_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|2300164_2301285_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 9
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	2695456	2700382	3495687	terminase,transposase,portal,protease	Burkholderia_virus(33.33%)	6	NA	NA
WP_096325434.1|2695456_2696577_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_076835668.1|2697357_2697681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	97.2	4.1e-54
WP_004202809.1|2697683_2698040_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199886.1|2698083_2699139_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004199888.1|2699135_2699633_-|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004539219.1|2699854_2700382_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
>prophage 10
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	3097848	3148923	3495687	transposase,plate,holin	Leptospira_phage(33.33%)	48	NA	NA
WP_004198632.1|3097848_3098202_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|3098219_3099050_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_004198630.1|3099233_3100724_-	6-aminohexanoate-cyclic-dimer hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|3100820_3101513_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_004198628.1|3101708_3101825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|3102888_3104008_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011205263.1|3104117_3104630_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004200010.1|3106504_3107605_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004202807.1|3107638_3110308_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.8e-89
WP_004200005.1|3110397_3111519_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004185296.1|3111717_3112650_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004200003.1|3112654_3113644_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004200001.1|3113640_3117534_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011204174.1|3117509_3117788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|3117805_3118771_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004199997.1|3118782_3119739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199995.1|3119949_3121398_-	TolC family protein	NA	NA	NA	NA	NA
WP_004199993.1|3121394_3123656_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	4.2e-36
WP_004199991.1|3123670_3124939_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012729786.1|3124964_3125321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3125554_3125785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|3125887_3126157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893038.1|3126199_3126598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204896.1|3127179_3129345_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_009922408.1|3129383_3129479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204170.1|3129910_3130453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202806.1|3130412_3130892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185303.1|3130890_3132009_+	acyltransferase	NA	NA	NA	NA	NA
WP_011204169.1|3132153_3132369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198067.1|3132365_3133502_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198065.1|3133629_3134526_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198063.1|3134610_3135234_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_011204168.1|3135230_3135581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198062.1|3135571_3136216_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198061.1|3136374_3137658_+	MFS transporter	NA	NA	NA	NA	NA
WP_004198060.1|3137617_3138193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202805.1|3138154_3138760_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198058.1|3139357_3140620_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004191998.1|3140829_3142293_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196861.1|3142416_3143304_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011204167.1|3143302_3143785_+	YraN family protein	NA	NA	NA	NA	NA
WP_004196857.1|3143907_3144486_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011857937.1|3144504_3145275_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004551036.1|3145301_3145637_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_004196848.1|3145950_3147357_-	amino acid permease	NA	NA	NA	NA	NA
WP_004196846.1|3147379_3147577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204166.1|3147560_3147692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|3147802_3148923_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 11
NC_009080	Burkholderia mallei NCTC 10247 chromosome I, complete sequence	3495687	3384411	3422752	3495687	transposase,protease	Burkholderia_phage(22.22%)	32	NA	NA
WP_004203414.1|3384411_3384948_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|3384957_3386301_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|3386727_3387270_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|3387289_3388570_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|3388587_3388839_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|3389163_3390063_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|3390059_3390863_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004198306.1|3390829_3391519_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198305.1|3391871_3393017_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004198304.1|3393013_3393628_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004198303.1|3393639_3394953_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_073699166.1|3395026_3395986_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004198301.1|3396359_3397304_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187628.1|3397449_3398670_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004198300.1|3398826_3399891_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.1	1.3e-80
WP_004191998.1|3400117_3401581_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196764.1|3401754_3402081_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_004545632.1|3402117_3402402_+	lipoprotein	NA	NA	NA	NA	NA
WP_004196768.1|3402412_3403684_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_004196773.1|3403942_3404656_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004196774.1|3404677_3405673_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_038802950.1|3405772_3406893_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198356.1|3407831_3409022_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.9	1.5e-13
WP_004185179.1|3409199_3409580_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_004198369.1|3409581_3410139_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_004198368.1|3410284_3410716_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004185135.1|3410716_3411415_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004199864.1|3411712_3412210_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004198366.1|3412273_3412648_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004198365.1|3413011_3417118_+	DNA-directed RNA polymerase subunit beta	NA	E3T4Z4	Cafeteria_roenbergensis_virus	21.4	4.6e-25
WP_011857943.1|3417139_3421378_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.9	2.3e-72
WP_004202761.1|3421531_3422752_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	1.3e-238
>prophage 1
NC_009079	Burkholderia mallei NCTC 10247 chromosome II, complete sequence	2352693	265468	317737	2352693	portal,transposase,integrase	Leptospira_phage(25.0%)	54	289912:289931	307852:307871
WP_004190269.1|265468_266473_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004195664.1|268239_268383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190833.1|268470_269550_+	putative membrane protein	NA	NA	NA	NA	NA
WP_038802950.1|269615_270735_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004190721.1|270763_271651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204313.1|271833_272196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533441.1|272390_273245_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_045597094.1|273307_273934_+	LysE family translocator	NA	NA	NA	NA	NA
WP_009934974.1|273917_274103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529060.1|274175_274613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190743.1|274838_276077_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004200616.1|276141_276624_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190582.1|277881_279525_+	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004553597.1|279683_280274_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190954.1|280309_281650_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190659.1|281735_282515_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190540.1|282607_283528_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004190343.1|283594_284470_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190990.1|284567_284951_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_011204315.1|285004_287071_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_011204316.1|287165_287954_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204318.1|288342_288519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190506.1|288497_289199_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190258.1|289200_289875_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195689.1|289887_290688_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
289912:289931	attL	CTTGAAGCCGTACTTCGCGA	NA	NA	NA	NA
WP_004204469.1|291128_291827_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195691.1|292122_293226_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004190391.1|293322_293481_+	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_011832128.1|293593_294013_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190487.1|294150_294603_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190292.1|294599_295109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190835.1|295105_295918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|295908_296904_-	homoserine kinase	NA	NA	NA	NA	NA
WP_004190726.1|296997_297396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190957.1|297551_299078_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004195697.1|299161_299848_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_009950031.1|299844_300132_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004529037.1|300377_300515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|300688_301809_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950024.1|303541_303715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203322.1|303713_303977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204319.1|303901_304078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|304412_304904_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004190916.1|305563_305848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190924.1|305999_306269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|306265_307015_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190446.1|307016_309797_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.9e-71
307852:307871	attR	TCGCGAAGTACGGCTTCAAG	NA	NA	NA	NA
WP_004190401.1|310115_311498_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038763983.1|311838_313632_-	membrane protein	NA	NA	NA	NA	NA
WP_009934941.1|313806_313899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195712.1|313920_314193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|314345_315221_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|315279_316149_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_004191998.1|316273_317737_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 2
NC_009079	Burkholderia mallei NCTC 10247 chromosome II, complete sequence	2352693	386536	436218	2352693	plate,transposase	Leptospira_phage(25.0%)	39	NA	NA
WP_004190585.1|386536_387940_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|387955_389272_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|389274_392904_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004203277.1|392909_393806_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004190273.1|393790_394018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190797.1|394016_396614_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|396666_397746_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|397808_398387_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|398379_399888_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|399947_400439_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|400457_401018_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|401022_402894_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|402890_404369_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004203276.1|404347_407002_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004203275.1|406998_409203_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|409277_409931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204338.1|409890_410919_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038802950.1|410946_412067_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_045589205.1|411966_412728_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011204340.1|412740_413721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004190776.1|414237_415662_+	cytosine permease	NA	NA	NA	NA	NA
WP_004190245.1|415658_416597_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_011204341.1|416622_417237_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190588.1|417560_417704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190614.1|417692_419108_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_011204342.1|419306_419639_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_011204343.1|420077_420395_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204344.1|420673_421438_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_004190805.1|421568_422204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190603.1|422472_423009_+	cytochrome b	NA	NA	NA	NA	NA
WP_004190837.1|423169_423565_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190808.1|423652_425890_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004196164.1|426240_427266_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190433.1|427310_428345_+	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_004196166.1|428446_429967_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004190757.1|430084_431185_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	5.2e-24
WP_004190781.1|431259_432306_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196172.1|432406_433666_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038802950.1|435097_436218_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NC_009079	Burkholderia mallei NCTC 10247 chromosome II, complete sequence	2352693	1613197	1656654	2352693	plate,transposase	Agrobacterium_phage(20.0%)	36	NA	NA
WP_011857826.1|1613197_1613659_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004200971.1|1613695_1615438_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200970.1|1615425_1616448_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011857827.1|1616434_1619482_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.5	4.5e-78
WP_004184913.1|1619508_1622532_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-22
WP_004206518.1|1622557_1625200_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004206517.1|1625217_1626282_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004200968.1|1626278_1627040_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004200966.1|1627068_1627461_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004200965.1|1627470_1628268_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004206515.1|1628300_1629698_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184888.1|1629694_1630360_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004266677.1|1630371_1634331_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_011807503.1|1634863_1636288_+	peptidase	NA	NA	NA	NA	NA
WP_004201911.1|1636247_1636493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004551882.1|1636451_1636745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528803.1|1636749_1637382_+	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_096325434.1|1637975_1639095_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200959.1|1639170_1640091_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004201904.1|1640208_1640706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200955.1|1641127_1642444_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004266343.1|1642837_1643134_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004200952.1|1643278_1643521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011204409.1|1643500_1644013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201902.1|1644116_1645460_-	amino acid permease	NA	NA	NA	NA	NA
WP_011204408.1|1645496_1645964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200946.1|1646369_1647239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184941.1|1647254_1648031_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011204407.1|1648167_1648353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200944.1|1648435_1649644_-	MFS transporter	NA	NA	NA	NA	NA
WP_011204406.1|1649832_1650879_-	cytochrome P460	NA	NA	NA	NA	NA
WP_011204405.1|1651048_1651195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200942.1|1651345_1652386_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004200941.1|1652635_1653475_+	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|1653656_1654151_+	universal stress protein	NA	NA	NA	NA	NA
WP_041277124.1|1655190_1656654_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 4
NC_009079	Burkholderia mallei NCTC 10247 chromosome II, complete sequence	2352693	1782148	1825234	2352693	holin,transposase	Leptospira_phage(33.33%)	34	NA	NA
WP_038802950.1|1782148_1783269_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011204369.1|1783548_1784664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204368.1|1784594_1785134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011857835.1|1785090_1785573_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004200846.1|1785667_1786282_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004200845.1|1786472_1787177_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004184805.1|1787255_1788146_+	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	58.1	7.3e-77
WP_011857836.1|1788168_1789560_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	44.0	2.5e-84
WP_004194988.1|1789556_1790198_+	aldolase	NA	A0A077SK32	Escherichia_phage	48.1	9.6e-39
WP_004201828.1|1790301_1791624_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184793.1|1791705_1792482_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_004266705.1|1792509_1793481_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004194984.1|1794429_1795122_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	36.3	2.6e-21
WP_011204366.1|1795252_1795723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204365.1|1795829_1796012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194983.1|1796002_1796902_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.6	1.4e-32
WP_004533171.1|1797291_1798242_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004199315.1|1798342_1799341_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004200833.1|1799463_1800366_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004533427.1|1800358_1801528_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	2.6e-26
WP_004555731.1|1802316_1802979_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004198711.1|1803005_1803197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|1803572_1803788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004266244.1|1803886_1804786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198701.1|1805257_1805593_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184724.1|1805589_1806069_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004184680.1|1806103_1806598_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_004266245.1|1806660_1807731_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|1808300_1809420_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_024900894.1|1818002_1818737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011326545.1|1818768_1819458_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_009967729.1|1819901_1820834_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_004184834.1|1822412_1823873_-	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_096325434.1|1824113_1825234_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NC_009079	Burkholderia mallei NCTC 10247 chromosome II, complete sequence	2352693	2113218	2165960	2352693	plate,transposase	Organic_Lake_phycodnavirus(25.0%)	44	NA	NA
WP_073699071.1|2113218_2114292_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004187986.1|2114303_2116193_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004187068.1|2116223_2116805_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187921.1|2116791_2117757_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004188539.1|2117753_2118500_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004196243.1|2121964_2122546_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188012.1|2122580_2124080_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004188308.1|2124196_2124682_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004187276.1|2124788_2125292_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188743.1|2125313_2126660_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011204670.1|2126733_2128014_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188288.1|2132137_2132368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204671.1|2132649_2132886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204672.1|2132874_2133225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011857853.1|2133337_2134300_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187006.1|2134542_2135469_-	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004187502.1|2135523_2136495_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004187879.1|2136523_2138392_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.9	3.0e-24
WP_004187705.1|2138437_2139922_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004188574.1|2139947_2140847_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_004188150.1|2140843_2141902_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187628.1|2142031_2143252_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_011204674.1|2143558_2143789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073699120.1|2143816_2146714_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004196252.1|2146988_2148905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187282.1|2149111_2149261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|2149346_2149712_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_009922971.1|2149793_2149904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202300.1|2149851_2150136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004529705.1|2150134_2150896_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004188170.1|2151440_2152373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196258.1|2152525_2153773_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004554722.1|2153936_2154836_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004557674.1|2155036_2155441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196262.1|2155428_2155869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188358.1|2156017_2156314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201242.1|2156370_2157411_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_080518649.1|2157541_2157757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004547820.1|2157749_2158559_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004187366.1|2158900_2159803_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187422.1|2159982_2161173_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004188653.1|2162560_2163190_+	porin	NA	NA	NA	NA	NA
WP_004202308.1|2163383_2164775_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.7	2.3e-45
WP_038802950.1|2164840_2165960_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
