The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	372814	383813	4448856		Acinetobacter_phage(42.86%)	10	NA	NA
WP_011803827.1|372814_374557_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.7e-14
WP_011803828.1|374678_375281_-	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_041835856.1|375637_377137_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	30.1	3.7e-41
WP_011803830.1|377133_377478_+	chorismate mutase	NA	NA	NA	NA	NA
WP_011803831.1|377474_378047_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.6	1.1e-65
WP_011803832.1|378144_379179_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	46.5	4.3e-81
WP_172205614.1|379189_379363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011803833.1|379433_380234_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.5	2.2e-64
WP_011803834.1|380372_383045_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	1.5e-16
WP_011803835.1|383099_383813_+	uracil-DNA glycosylase	NA	A0A1L5JKJ8	Bubaline_alphaherpesvirus	47.1	7.7e-45
>prophage 2
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	549686	604310	4448856	tRNA,transposase,integrase,tail	Escherichia_phage(30.0%)	47	552605:552624	609666:609685
WP_011803986.1|549686_550640_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011803987.1|550670_552833_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
552605:552624	attL	CGCCGCGCTGCAGCGCTTCG	NA	NA	NA	NA
WP_011803988.1|552917_553493_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_011803989.1|553570_554320_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011803990.1|554321_555242_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041836166.1|555280_555721_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_011803992.1|555814_556303_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_011803993.1|556459_557236_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_011803994.1|557266_557920_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011803995.1|558012_558486_-	phasin family protein	NA	NA	NA	NA	NA
WP_011803996.1|558674_559736_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.4	4.9e-88
WP_011803997.1|559732_560611_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.2	2.5e-21
WP_011803998.1|560619_561504_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	59.6	5.5e-101
WP_011803999.1|561511_562060_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.8	7.7e-53
WP_011804000.1|562151_563054_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011804001.1|563099_566051_+	glycosyltransferase	NA	F5B3W0	Synechococcus_phage	26.7	1.3e-05
WP_172734527.1|566186_567431_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_172205794.1|567543_568287_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011804004.1|568276_570727_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	8.6e-11
WP_011804005.1|570723_571374_+	acetyltransferase	NA	NA	NA	NA	NA
WP_011804006.1|571413_572862_+	DUF2142 domain-containing protein	NA	NA	NA	NA	NA
WP_005801445.1|572938_574018_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011804007.1|574052_575018_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011804008.1|575014_575398_+	GtrA family protein	NA	NA	NA	NA	NA
WP_011804009.1|575680_576832_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_083766721.1|577216_579193_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011804011.1|579204_580149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011804012.1|580145_582173_+	response regulator	NA	NA	NA	NA	NA
WP_041835869.1|582204_582882_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011804014.1|582918_583968_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011804015.1|583985_585107_+	acyltransferase	NA	NA	NA	NA	NA
WP_011804016.1|585392_591035_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_011804017.1|591447_592710_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011804018.1|592731_592977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011804019.1|593024_593528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011804020.1|593580_594693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011804022.1|595153_595924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041835870.1|596173_596386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083766722.1|596643_597951_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	34.0	3.9e-10
WP_011804025.1|598012_598489_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011804026.1|598488_598941_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011804027.1|598998_599304_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	85.9	6.6e-30
WP_041835871.1|599586_599994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011804029.1|600014_600326_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011804030.1|600406_601921_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.3	2.3e-115
WP_085947529.1|602086_602770_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	33.8	5.0e-17
WP_011804031.1|602918_604310_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
609666:609685	attR	CGCCGCGCTGCAGCGCTTCG	NA	NA	NA	NA
>prophage 3
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	733925	742894	4448856		uncultured_virus(33.33%)	7	NA	NA
WP_011804146.1|733925_735401_-	glucose-6-phosphate dehydrogenase	NA	M4QQY0	Cyanophage	33.3	1.9e-61
WP_011804147.1|735596_736547_+	transaldolase	NA	A0A1D8KSY7	Synechococcus_phage	33.3	2.4e-09
WP_011804148.1|736543_738160_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011804149.1|738190_739357_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	6.7e-14
WP_011804150.1|739627_741268_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	4.6e-170
WP_011804151.1|741358_741649_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	46.8	2.9e-19
WP_011804152.1|741859_742894_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	41.5	6.9e-63
>prophage 4
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	1236281	1302671	4448856	tRNA,transposase,protease,integrase	Pandoravirus(10.0%)	49	1265130:1265146	1310613:1310629
WP_011804603.1|1236281_1237571_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011804604.1|1237584_1238262_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011804605.1|1238258_1239410_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011804606.1|1239429_1240773_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011804607.1|1240850_1241102_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_011804608.1|1241165_1242344_+	GTPase HflX	NA	NA	NA	NA	NA
WP_011804609.1|1242395_1243751_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011804610.1|1243760_1244666_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011804611.1|1244695_1244875_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_011804612.1|1244950_1246099_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_011804613.1|1246128_1247505_+	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	32.8	7.3e-60
WP_011804614.1|1247576_1248101_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011804615.1|1253889_1254627_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011804616.1|1254786_1255761_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_011804617.1|1255747_1256587_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011804618.1|1256637_1257636_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_011804619.1|1257651_1258554_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_011804620.1|1258550_1259372_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_011804621.1|1259528_1260944_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011804622.1|1261150_1261654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047351613.1|1261688_1262759_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.1	5.6e-07
WP_011804624.1|1262810_1264346_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011804625.1|1264527_1265481_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
1265130:1265146	attL	CGAACTCAAGAGCCTGC	NA	NA	NA	NA
WP_011804626.1|1265521_1266298_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_011804627.1|1266368_1266863_-	dihydrofolate reductase	NA	A0A0K2QQK4	Ralstonia_phage	47.0	2.4e-29
WP_011804628.1|1266865_1267561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804629.1|1267598_1268432_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	65.1	3.2e-103
WP_011804630.1|1268484_1269909_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011804631.1|1269950_1270367_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_011804632.1|1270388_1271678_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_011804633.1|1271702_1273007_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011804634.1|1273003_1273843_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_011804635.1|1273990_1274881_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	46.5	6.0e-63
WP_011804636.1|1274886_1276053_+	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_011804637.1|1276138_1277029_-	squalene synthase HpnC	NA	NA	NA	NA	NA
WP_011804639.1|1278380_1281530_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011804640.1|1281784_1283095_+	trigger factor	NA	NA	NA	NA	NA
WP_011804641.1|1283218_1283827_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	1.7e-53
WP_011804642.1|1283924_1285190_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.7	1.4e-126
WP_011804643.1|1285329_1287750_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	6.5e-213
WP_011804189.1|1289443_1290976_+|transposase	IS21-like element ISAisp6 family transposase	transposase	NA	NA	NA	NA
WP_008903250.1|1290965_1291787_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.9	4.7e-30
WP_009516242.1|1294230_1295220_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011804646.1|1295244_1295880_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011804647.1|1296053_1296671_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011804648.1|1296667_1298338_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041835933.1|1298328_1299231_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011804650.1|1299302_1300721_+	TniQ family protein	NA	NA	NA	NA	NA
WP_011803789.1|1301444_1302671_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
1310613:1310629	attR	GCAGGCTCTTGAGTTCG	NA	NA	NA	NA
>prophage 5
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	1389796	1449467	4448856	transposase,integrase	Streptococcus_phage(20.0%)	54	1401106:1401121	1421211:1421226
WP_041836223.1|1389796_1392736_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.6	2.5e-57
WP_011804706.1|1392821_1393073_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_041835938.1|1393069_1393396_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011804707.1|1393643_1393961_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	58.8	2.9e-28
WP_011804708.1|1393965_1394502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804709.1|1394507_1394894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804710.1|1394933_1398053_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.4	1.5e-68
WP_011804711.1|1398054_1399173_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011804712.1|1399169_1399730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172734591.1|1399788_1401096_-	TolC family protein	NA	NA	NA	NA	NA
1401106:1401121	attL	TCGGTGCATCCGATGC	NA	NA	NA	NA
WP_011804714.1|1401278_1401641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804715.1|1401704_1402415_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_011804716.1|1402422_1404684_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.1	4.8e-125
WP_011804717.1|1404761_1405202_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011804718.1|1405500_1407198_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011804719.1|1407236_1407821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011804279.1|1410397_1411162_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	26.2	3.7e-05
WP_034303860.1|1411158_1412763_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011347496.1|1413517_1414159_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011804647.1|1414332_1414950_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011804648.1|1414946_1416617_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041835933.1|1416607_1417510_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011804650.1|1417581_1419000_+	TniQ family protein	NA	NA	NA	NA	NA
WP_011347497.1|1419137_1419431_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011347498.1|1419437_1420328_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011347499.1|1420364_1420688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011347500.1|1420725_1422093_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
1421211:1421226	attR	TCGGTGCATCCGATGC	NA	NA	NA	NA
WP_011347501.1|1422133_1422940_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011347502.1|1422958_1423471_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_011347503.1|1423566_1424340_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_011347504.1|1424342_1425179_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011804721.1|1425178_1427017_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_011347506.1|1427163_1427832_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011347507.1|1427828_1429187_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011347508.1|1429250_1430210_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	3.8e-63
WP_011804723.1|1430251_1430770_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011347510.1|1430853_1431174_-	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.3	3.7e-15
WP_011347511.1|1431364_1432048_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_011347512.1|1432065_1432710_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011347513.1|1432773_1433673_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011347514.1|1433811_1434276_-	DsrE family protein	NA	NA	NA	NA	NA
WP_011347515.1|1434385_1435363_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_011347516.1|1435450_1435708_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_083766790.1|1435866_1436979_-	MFS transporter	NA	NA	NA	NA	NA
WP_011347529.1|1437273_1438275_-	cation transporter	NA	A0A1V0SED0	Indivirus	26.4	4.1e-20
WP_011347528.1|1438463_1438817_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011347527.1|1438984_1441486_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.9	1.4e-88
WP_011347526.1|1441501_1441981_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011347525.1|1442054_1443284_-	MFS transporter	NA	NA	NA	NA	NA
WP_011347524.1|1443336_1444365_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	30.0	4.7e-27
WP_011347523.1|1444401_1445580_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011347522.1|1445598_1446747_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005801445.1|1447205_1448285_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005801445.1|1448387_1449467_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	1794946	1820370	4448856	tRNA,transposase	Wolbachia_phage(40.0%)	24	NA	NA
WP_011804996.1|1794946_1795729_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011804997.1|1796104_1796374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804998.1|1796360_1796789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011804999.1|1796810_1797251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805001.1|1797985_1798288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805002.1|1798284_1798722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805003.1|1798804_1799542_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	59.0	8.7e-76
WP_011803789.1|1800833_1802060_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011805005.1|1802999_1803251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078465000.1|1803719_1804685_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.0	5.4e-17
WP_011805007.1|1806940_1807093_+	DUF3096 domain-containing protein	NA	NA	NA	NA	NA
WP_011805008.1|1807099_1808614_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011805009.1|1808610_1809390_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011805010.1|1809388_1810168_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011805011.1|1810204_1810651_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	51.1	3.1e-36
WP_011805012.1|1810677_1811013_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011805013.1|1811095_1812454_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011805014.1|1812480_1813116_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_011805015.1|1813176_1814313_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_041835970.1|1814459_1815302_+	type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005801445.1|1815688_1816768_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005801445.1|1816870_1817950_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011805017.1|1818154_1819138_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.6	7.4e-115
WP_011805018.1|1819284_1820370_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	1863852	1972641	4448856	tRNA,transposase,protease,integrase	Planktothrix_phage(13.33%)	89	1862685:1862702	1979674:1979690
1862685:1862702	attL	GCGGCCGGCCGGCGGGCC	NA	NA	NA	NA
WP_011805060.1|1863852_1865772_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
1862685:1862702	attL	GCGGCCGGCCGGCGGGCC	NA	NA	NA	NA
WP_011805061.1|1865807_1866473_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_011805062.1|1866881_1867154_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_041835972.1|1867292_1868312_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011805064.1|1868513_1869212_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011805065.1|1869255_1870722_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.4	4.7e-57
WP_172734543.1|1871038_1872670_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011805067.1|1873050_1873632_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	38.8	2.9e-26
WP_041835974.1|1874163_1874916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172734544.1|1874971_1875718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172734545.1|1875800_1876157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172734546.1|1876175_1876574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805070.1|1876843_1877104_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172734547.1|1877111_1877741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805072.1|1878687_1879488_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011805073.1|1879577_1881452_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011805074.1|1881459_1882497_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011805075.1|1882500_1883598_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011805076.1|1883619_1885257_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-16
WP_011805077.1|1885584_1886751_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_011805078.1|1886828_1887656_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_011805079.1|1888041_1888908_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.8	8.4e-46
WP_011805080.1|1889056_1889989_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805081.1|1890085_1891438_+	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_011805082.1|1891447_1891810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805083.1|1891854_1892841_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_041835977.1|1892909_1893968_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011805085.1|1894184_1897061_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011805086.1|1897110_1898376_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011805087.1|1898465_1899893_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	2.8e-46
WP_041836257.1|1899976_1901074_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011805089.1|1901073_1901760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805090.1|1901819_1902623_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011805091.1|1902793_1904860_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.2	2.6e-69
1904445:1904462	attR	GCGGCCGGCCGGCGGGCC	NA	NA	NA	NA
WP_015913419.1|1904822_1905620_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
1904445:1904462	attR	GCGGCCGGCCGGCGGGCC	NA	NA	NA	NA
WP_041835978.1|1905754_1909294_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.9	7.4e-181
WP_015913417.1|1909371_1909740_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.4	1.7e-11
WP_011805095.1|1909799_1912148_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	6.2e-168
WP_011805096.1|1912398_1913007_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805097.1|1913003_1914155_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011805098.1|1914151_1915351_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011805099.1|1915361_1916072_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.2e-31
WP_049756519.1|1916164_1917550_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011805101.1|1917633_1919073_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011805102.1|1919081_1919966_+	NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
WP_011805103.1|1920036_1922040_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805104.1|1922295_1922643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805105.1|1922639_1925678_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.9	6.5e-69
WP_085947521.1|1926334_1927485_-|transposase	IS3-like element ISAisp2 family transposase	transposase	U5P429	Shigella_phage	63.1	6.7e-99
WP_011805108.1|1927592_1927952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805109.1|1928109_1929465_+	TolC family protein	NA	NA	NA	NA	NA
WP_041836260.1|1929473_1931084_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011805111.1|1931099_1934288_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_011805112.1|1934351_1934732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041836261.1|1935232_1935658_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_041835979.1|1936374_1936638_+	DUF3703 domain-containing protein	NA	NA	NA	NA	NA
WP_011805114.1|1936715_1939004_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_011805003.1|1939129_1939867_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	59.0	8.7e-76
WP_041835980.1|1939903_1941448_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	56.3	2.7e-159
WP_161555629.1|1942501_1942654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805116.1|1942831_1943149_-	copper-binding protein	NA	NA	NA	NA	NA
WP_011805117.1|1943298_1944963_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_011805118.1|1945077_1945509_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_114655505.1|1945752_1946943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805120.1|1946959_1947619_+	TerD family protein	NA	NA	NA	NA	NA
WP_011805121.1|1947627_1948608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805018.1|1948686_1949772_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_161555630.1|1949786_1950590_+	transporter	NA	NA	NA	NA	NA
WP_049756469.1|1950644_1951790_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011805124.1|1951882_1952227_+	sigma E regulatory protein, MucB/RseB	NA	NA	NA	NA	NA
WP_011804549.1|1952207_1953434_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_049756470.1|1953550_1954768_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_114655507.1|1955050_1955614_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_011803559.1|1955962_1957051_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083766745.1|1957133_1957457_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011805127.1|1957629_1958301_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005801445.1|1958490_1959570_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011805128.1|1959655_1960156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041836269.1|1960243_1961035_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011805130.1|1961441_1962671_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_011805131.1|1962743_1965386_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	41.3	1.8e-123
WP_114655503.1|1965450_1966851_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_067513095.1|1967218_1967539_-	copper-binding protein	NA	NA	NA	NA	NA
WP_049756471.1|1967929_1968223_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_011805134.1|1968233_1969934_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011805135.1|1969946_1970276_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805136.1|1970272_1970656_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083766746.1|1970732_1971044_+	DUF3703 domain-containing protein	NA	NA	NA	NA	NA
WP_049756472.1|1971444_1972641_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1979674:1979690	attR	GTGCAGCGCGAGGTGGA	NA	NA	NA	NA
>prophage 8
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	2006980	2077232	4448856	transposase,integrase	Wolbachia_phage(18.18%)	59	2064846:2064862	2078670:2078686
WP_011803559.1|2006980_2008069_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011805167.1|2008239_2009181_-	CysB family HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_011805168.1|2009255_2009639_-	CbiX/SirB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011805169.1|2009657_2010767_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011805170.1|2010763_2011855_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011805171.1|2011878_2013369_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	5.0e-46
WP_011805172.1|2013394_2013835_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011805173.1|2013831_2014263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005801445.1|2014341_2015421_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011805174.1|2015584_2016718_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011805175.1|2016795_2017803_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1V0SBV6	Catovirus	28.7	5.6e-17
WP_049756523.1|2018065_2018578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011805177.1|2018713_2019466_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_011805178.1|2019560_2020001_+	universal stress protein	NA	NA	NA	NA	NA
WP_011805179.1|2020096_2021089_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011805180.1|2021238_2022423_-	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_011805181.1|2022532_2023315_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011805182.1|2023346_2024015_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_011805183.1|2024070_2026233_-	response regulator	NA	NA	NA	NA	NA
WP_011805184.1|2026308_2026710_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011805185.1|2026780_2029675_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.8	1.5e-259
WP_011805186.1|2029743_2030118_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_011805187.1|2030221_2031352_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_011805188.1|2031629_2032907_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_011805189.1|2032989_2033484_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_011805190.1|2033561_2034533_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_041836275.1|2034826_2035285_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805192.1|2035307_2036432_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011803789.1|2036752_2037979_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011805193.1|2038021_2038924_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011805194.1|2039037_2040051_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011805195.1|2040141_2040936_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.2	3.5e-06
WP_011805196.1|2040952_2041840_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011805197.1|2041945_2042914_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011805198.1|2043132_2044839_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_041835985.1|2045372_2046929_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	5.6e-16
WP_011805200.1|2046998_2048354_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011805201.1|2048350_2049031_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	6.4e-25
WP_011805202.1|2049172_2049874_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_172734549.1|2050037_2051690_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_011805204.1|2051753_2052335_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_011805205.1|2052351_2053035_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_011805206.1|2053141_2054593_-	catalase	NA	A0A2K9L0T1	Tupanvirus	45.9	3.2e-98
WP_011805207.1|2054768_2056049_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011805208.1|2056168_2056714_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011805209.1|2056796_2057504_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011805210.1|2057507_2058146_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011805211.1|2058297_2059611_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011805212.1|2059745_2060747_+|transposase	IS1595-like element ISCsp2 family transposase	transposase	NA	NA	NA	NA
WP_011805213.1|2060822_2061590_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011805214.1|2061555_2062965_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011805215.1|2062961_2066156_+	error-prone DNA polymerase	NA	A0A0K1Y906	Streptomyces_phage	28.2	2.7e-81
2064846:2064862	attL	CGCGAGCGCCGGCGCCA	NA	NA	NA	NA
WP_011805216.1|2066219_2067473_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_011805217.1|2067508_2069254_-	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_011805218.1|2069348_2069768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805219.1|2069834_2070425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041835986.1|2070839_2071046_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_011805220.1|2073678_2075007_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	46.7	2.1e-104
WP_011805221.1|2075378_2077232_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	50.7	4.2e-103
2078670:2078686	attR	CGCGAGCGCCGGCGCCA	NA	NA	NA	NA
>prophage 9
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	2222165	2330218	4448856	transposase,holin,integrase	uncultured_Mediterranean_phage(10.53%)	88	2269679:2269738	2328968:2330394
WP_011804744.1|2222165_2223407_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011805343.1|2223365_2224919_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_028353231.1|2226596_2227196_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_011805345.1|2227362_2227854_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.3	3.1e-13
WP_083766749.1|2227864_2228305_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011805346.1|2228516_2230064_-|transposase	IS91-like element ISPps1 family transposase	transposase	NA	NA	NA	NA
WP_003084345.1|2231741_2232179_-	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_010793552.1|2232471_2233242_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011805349.1|2233313_2234006_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003084333.1|2234008_2234503_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_011805350.1|2234768_2235323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004577488.1|2237224_2238427_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011805352.1|2238620_2239160_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011803559.1|2240956_2242045_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011805354.1|2242332_2244216_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.8e-30
WP_011805355.1|2244232_2245936_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_011805356.1|2245955_2248652_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011805357.1|2248821_2251368_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_011805358.1|2251364_2251991_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011805359.1|2252069_2252918_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.7	1.0e-32
WP_011805360.1|2253005_2255039_+	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	23.7	2.1e-34
WP_011805361.1|2255153_2255810_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_011805362.1|2255860_2256550_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011805363.1|2256585_2257641_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011805364.1|2257698_2258022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805365.1|2258018_2258414_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015913196.1|2258481_2258790_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_011805367.1|2258920_2260036_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041835995.1|2260053_2261091_-	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	36.7	9.8e-41
WP_011805369.1|2261437_2262151_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	44.4	1.8e-38
WP_011805370.1|2262150_2262489_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011805371.1|2262522_2264391_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.3	1.9e-95
WP_011805372.1|2264457_2264976_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_011805373.1|2265044_2265368_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	55.1	4.7e-26
WP_011805374.1|2265373_2265775_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.2	8.1e-52
WP_011805375.1|2265812_2267033_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_011805376.1|2267137_2267674_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_011803789.1|2268367_2269594_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
2269679:2269738	attL	AGGCTCTGTTGAATTTCGAGTGGGTTACCGGGCATGAGGGTTGACCGCTGCGAAGTCGAG	NA	NA	NA	NA
WP_011804549.1|2269702_2270929_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011805377.1|2270921_2272013_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011805378.1|2272135_2274232_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011805379.1|2274340_2275537_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011805380.1|2275690_2277460_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.8	4.4e-09
WP_011805381.1|2277462_2278341_+	CoA transferase	NA	NA	NA	NA	NA
WP_172734596.1|2278459_2278843_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_172734597.1|2278955_2281727_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_011805383.1|2281796_2283050_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.2	5.6e-99
WP_011805384.1|2283177_2284206_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.3	1.0e-45
WP_049756475.1|2284417_2284963_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_041836300.1|2285030_2285273_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_011805387.1|2285406_2286117_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011805388.1|2286207_2287785_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_011805389.1|2287781_2290205_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_011805390.1|2290267_2291281_+	hydroxyacid dehydrogenase	NA	M1I539	Acanthocystis_turfacea_Chlorella_virus	36.6	1.6e-43
WP_041835997.1|2291331_2293728_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.2	1.7e-160
WP_011805392.1|2293772_2294813_+	type II glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011805393.1|2296120_2296687_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011805394.1|2296763_2297501_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011804647.1|2297675_2298293_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011805395.1|2298289_2299960_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041835933.1|2299950_2300853_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011804650.1|2300924_2302343_+	TniQ family protein	NA	NA	NA	NA	NA
WP_003282197.1|2302480_2302780_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011805397.1|2302806_2304651_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_011805398.1|2304853_2305774_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_041835998.1|2305766_2306525_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_031754974.1|2306748_2307123_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_011805401.1|2307139_2308663_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003292115.1|2308678_2309032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805402.1|2309028_2310435_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805403.1|2310445_2311390_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805404.1|2311386_2311836_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_003292123.1|2312004_2312499_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_011805405.1|2312694_2313438_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011805406.1|2313451_2316340_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_011805407.1|2316339_2316774_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_011805408.1|2316754_2318188_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805409.1|2318177_2319092_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805410.1|2319088_2319781_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805411.1|2319777_2320188_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_011805412.1|2320200_2320569_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_003294214.1|2320591_2320831_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011805413.1|2320827_2321187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011805414.1|2321479_2321692_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	54.0	2.2e-16
WP_023657714.1|2321758_2322802_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.7	4.5e-110
WP_128576131.1|2322864_2323281_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	37.3	1.4e-11
WP_011805417.1|2323301_2326442_+	helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	29.2	1.1e-98
WP_011804549.1|2328991_2330218_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
2328968:2330394	attR	AGGCTCTGTTGAATTTCGAGTGGGTTACCGGGCATGAGGGTTGACCGCTGCGAAGTCGAGCTTGCCCGCGATCAGGAAGATGACGGTCCTGATCGTGTCGAAGCGCGTGAAGCCGCGCGCGCGACGCTTGGCGGCCTGGAACAGGCCGTTGAGTGCTTCGAGGAAGCCGTTGGTCTGACGGGTCTGCGCCCAGGCCACGATGCCCTCGAGATGGCGGCGCACCATGGCGGCGACCTCCTTCATGGGCTCGACCTTGGAGCGCATGACGCAGGTGCACCAGTGCTTGAGCATGTCGCGCACGACGTTGATCTGCTTGCGCTGGAGGATCTCGCGCAGCTGCTCCTTGTAGACCCAGGCGCGCGCGGTGCGCACGGTGGTCATGCGCGCGATGAGCGCATCCAGCTCGGCTGCGGCCTCGGGTTTGAGGCTGGCACGGTCCTTCAGCAGCGACCAGCGCATGCCCTTGAGGGACTTGTCGCGGCGCTGTTCGATGCGCCGCATCTTGTCCACCGCCGCGTTGGCGTGCCAGAGGACGTGGAACTTGTCGAACGTGATGCGCGCGTTGGGCAGCTCGTCGGCGCAGCCCTTGATGAACGCCGGCGACATGTCGATGCTGACCGACTCGATGCTCTCGGGCACACAGCCATGCTCGGCCAGCTCGGCGGCGATGGCAGCGATGGTCTTGGCCTCGCGCCCTTCGGCCACGGCCAGGACCCGGCGCTGCACAGCGTCAGCCGCCAGCGTGATGTAGTCGTGGCCACGCGCGCGCGAGGTCTCGTCGATGGCCAGCGCCCGGACGTGGCCGAAGTCCGCGGCCTGCAGCGCCAGCGCGACGTAGCGCCGGCAGATCGCCAGCACCCGGTACGGCGACAGGCCCACGATGCGGGCCACGGCAGCAAACGGCATCTGCGGCGCCAGCATCAGCACCAGCGCCTCGAACAGCAGCGTGAAGCCCGAGAGCTTGCCCGCAAACGGCGGCTTGACCAGGCGCACCGAACCGTCGGGCAGCTTCACGCGCGGCGTGCGCACCTCGAGCACGCACTCGTGCTGGAAGAAGTTCAGGTGCCGGTAGCTCTTGGTCACGGTGTCGTGGACCGGGTGCTCGCCGCTGGCGCCCTCGACCGCGAACCGGGTCCCCGCCGTGAAGTCGATGCCGACCGTCAAGACCTTGCTGGCCTCGTCGAAACGAACGCCGGCGACGAACCAAGGGGGCGCGATGCCCAGTGCCGCTTCGAACAACCTGTCATGCATACCAATCGCTCCTGCTCGTCATGGCCGATGCGTGAGCATGCCGCATCGGCCATGACGGCCAGCGTACGGGCCGGCAGCCGGCGTCAAGGGTTCGCTTCGCCGGGCTACGCCCGCCCTTGACCCCGTCCGCCAGCCAAAACACCACCGAATCCACCCACACGGAATTCAAGAGAGGC	NA	NA	NA	NA
>prophage 10
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	3035181	3095572	4448856	tRNA,transposase	Wolbachia_phage(25.0%)	58	NA	NA
WP_005801445.1|3035181_3036261_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011803559.1|3036369_3037458_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011806020.1|3037715_3038591_+	glutamate racemase	NA	NA	NA	NA	NA
WP_011806021.1|3038658_3039174_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041836343.1|3039238_3040225_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011806023.1|3040275_3041277_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011806024.1|3041313_3042297_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_011806025.1|3042293_3043514_-	CoA transferase	NA	NA	NA	NA	NA
WP_011806026.1|3043634_3044534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011806027.1|3044530_3045643_+	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_011806028.1|3045809_3046364_+	elongation factor P	NA	NA	NA	NA	NA
WP_041836050.1|3046478_3046946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806030.1|3047084_3049172_-	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
WP_011806031.1|3049164_3049482_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_011806032.1|3049502_3051893_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	1.9e-164
WP_011806033.1|3052116_3052947_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_011806034.1|3053047_3054604_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	31.1	3.2e-35
WP_011806035.1|3054709_3055273_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_011806036.1|3055510_3055987_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011806037.1|3056291_3056621_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_011806038.1|3056662_3057202_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_041836344.1|3057283_3057838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806040.1|3057852_3058467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806041.1|3058564_3060748_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_011806042.1|3060758_3063608_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_041836051.1|3063732_3064665_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011806044.1|3064667_3065486_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011806045.1|3065475_3066552_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011806046.1|3066575_3067859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078465000.1|3067875_3068841_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.0	5.4e-17
WP_011806047.1|3069220_3069841_+	VOC family protein	NA	NA	NA	NA	NA
WP_041836345.1|3069976_3072844_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.1	2.1e-149
WP_011806049.1|3072922_3073810_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.3	2.5e-69
WP_011806050.1|3073921_3074149_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_011806051.1|3074154_3074718_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011806052.1|3074833_3075739_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	38.8	2.2e-52
WP_011806053.1|3076350_3076593_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_011806054.1|3076589_3077852_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_011806055.1|3077853_3078834_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_011806056.1|3078830_3079535_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_011806057.1|3079553_3080888_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_011806058.1|3080884_3081208_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011806059.1|3081219_3081948_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_011806060.1|3081944_3084380_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_011806061.1|3084389_3084662_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_011806062.1|3084658_3085036_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_011806063.1|3085032_3086067_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_011806064.1|3086063_3086510_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_011806065.1|3086506_3088504_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_125726996.1|3088539_3088773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806066.1|3088739_3089018_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_011804030.1|3089150_3090665_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.3	2.3e-115
WP_011804029.1|3090745_3091057_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041835871.1|3091077_3091485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011806067.1|3091526_3092432_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083766760.1|3092468_3092780_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_011806069.1|3092811_3093846_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_078465000.1|3094606_3095572_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.0	5.4e-17
>prophage 11
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	3210199	3266680	4448856	transposase,holin	Bacillus_phage(20.0%)	46	NA	NA
WP_003158660.1|3210199_3213115_+|transposase	Tn3-like element IS1071 family transposase	transposase	NA	NA	NA	NA
WP_011806182.1|3213208_3213571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172207623.1|3213567_3214254_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_011806183.1|3214480_3215617_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011806184.1|3216345_3217524_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011806185.1|3218128_3219667_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.8	1.1e-45
WP_011806186.1|3219857_3220658_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	31.6	9.6e-28
WP_011806187.1|3220650_3222165_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041836362.1|3222493_3222994_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.9	1.6e-28
WP_011806189.1|3223014_3223335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011806190.1|3223429_3224377_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_083766767.1|3224438_3226211_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.2	1.5e-28
WP_172207626.1|3226207_3227254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806193.1|3227226_3228342_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_011806194.1|3228439_3229213_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_172734602.1|3229243_3230107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806196.1|3230172_3231330_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011806197.1|3231412_3232336_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_041836068.1|3232370_3232814_+	HIT family protein	NA	NA	NA	NA	NA
WP_011806199.1|3232833_3234024_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_011806200.1|3234020_3235088_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_011806201.1|3235084_3236293_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011806202.1|3236299_3237427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806203.1|3237428_3238235_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_011806204.1|3238220_3239012_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_011806205.1|3239075_3239732_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011806206.1|3239795_3241109_+	cytochrome P450	NA	M1PWN0	Moumouvirus	21.8	6.8e-15
WP_011806207.1|3241128_3243090_+	non-ribosomal peptide synthetase	NA	A0A1V0SBX8	Catovirus	24.1	1.8e-11
WP_011806208.1|3243315_3245127_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_049756493.1|3245137_3245395_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_135148049.1|3245448_3246573_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	28.0	5.8e-31
WP_135148047.1|3246577_3247483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806212.1|3247670_3248555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806213.1|3248580_3249660_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_011806214.1|3249659_3250646_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049756531.1|3250792_3251047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806216.1|3251065_3251578_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011804279.1|3254995_3255760_-	ATP-binding protein	NA	A0A059VK34	Pseudomonas_phage	26.2	3.7e-05
WP_034303860.1|3255756_3257361_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_083766772.1|3257545_3259048_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.5	1.6e-15
WP_011806219.1|3259014_3259920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011806220.1|3260036_3261023_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_011806222.1|3261669_3261984_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011806223.1|3262072_3263416_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011806224.1|3263430_3264015_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011806097.1|3265717_3266680_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.2	1.8e-113
>prophage 12
NC_008782	Acidovorax sp. JS42, complete sequence	4448856	3527571	3632867	4448856	tRNA,transposase,protease,integrase	Wolbachia_phage(18.52%)	102	3553436:3553453	3572765:3572782
WP_011803559.1|3527571_3528660_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011806450.1|3528799_3529222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806451.1|3529214_3529529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041836399.1|3529525_3530011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806453.1|3530090_3530276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806455.1|3530669_3531491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806456.1|3531592_3531874_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	48.6	2.3e-08
WP_011806457.1|3531860_3532139_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_011806458.1|3532195_3533554_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	23.9	1.8e-10
WP_049756498.1|3533928_3534666_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_041836083.1|3534743_3535136_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_011806461.1|3535229_3535718_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_011806462.1|3535898_3537134_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.0	3.6e-26
WP_011806463.1|3537410_3539288_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	27.1	3.5e-36
WP_011806464.1|3539570_3540149_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.5	1.3e-26
WP_011806465.1|3540187_3541501_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011806466.1|3541497_3541836_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011806467.1|3541840_3542809_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011806468.1|3542874_3543861_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_041836400.1|3543939_3544623_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011806470.1|3544741_3545125_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011806471.1|3545238_3546006_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_041836401.1|3546024_3546597_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011806473.1|3546685_3546937_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011806474.1|3547064_3547586_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	39.0	1.3e-20
WP_011806475.1|3547608_3548055_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_011806476.1|3548191_3549202_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_011806477.1|3549261_3549909_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_011806478.1|3550080_3550443_-	DMT family protein	NA	NA	NA	NA	NA
WP_011806479.1|3550562_3551291_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.2	1.9e-11
WP_011806480.1|3551303_3552086_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	9.7e-17
WP_011806481.1|3552107_3553184_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011806482.1|3553197_3554127_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
3553436:3553453	attL	GGCAAGAAGCCCATGGTG	NA	NA	NA	NA
WP_011806483.1|3554483_3555812_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.5	2.6e-78
WP_011806484.1|3555808_3556807_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	46.4	4.1e-68
WP_011806097.1|3556982_3557945_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.2	1.8e-113
WP_011806485.1|3558134_3558434_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_011806486.1|3558443_3558713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011803789.1|3559012_3560239_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011806487.1|3560380_3560638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806488.1|3560706_3560952_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_011806489.1|3560968_3561250_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_011803789.1|3561461_3562688_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_172734569.1|3563258_3563672_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011803789.1|3563864_3565091_-|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011803789.1|3565485_3566712_-|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011806490.1|3567121_3567511_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_011806491.1|3567510_3568176_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_011806492.1|3568236_3568869_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011806493.1|3568930_3571261_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.3	2.2e-80
WP_011806494.1|3571553_3572507_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.3	2.4e-57
WP_003058229.1|3572740_3572974_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
3572765:3572782	attR	GGCAAGAAGCCCATGGTG	NA	NA	NA	NA
WP_011806495.1|3572994_3573165_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011806496.1|3573303_3574515_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_011806497.1|3574647_3575925_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_011806498.1|3575968_3577906_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_041836404.1|3577956_3578205_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	55.2	2.8e-10
WP_011806500.1|3578413_3578971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806501.1|3579035_3579620_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.3	5.7e-22
WP_011806502.1|3579643_3580321_+	YceH family protein	NA	NA	NA	NA	NA
WP_011806503.1|3580408_3581590_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011806504.1|3581602_3582718_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011806505.1|3583116_3584103_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	67.0	8.8e-116
WP_011806506.1|3584262_3585582_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011806507.1|3585645_3586203_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011806508.1|3586365_3587409_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_011806509.1|3587523_3590379_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.5	1.1e-78
WP_011806510.1|3590378_3590876_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011806511.1|3590970_3592641_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_011806512.1|3592631_3593621_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_011803789.1|3594078_3595305_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011806513.1|3595452_3596274_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011806514.1|3597388_3598291_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011806515.1|3600999_3602082_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011803559.1|3602539_3603628_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083766777.1|3603618_3604365_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011806516.1|3605043_3606555_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_011806517.1|3606571_3607060_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_011806518.1|3607361_3609158_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_011806519.1|3609178_3609940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756532.1|3609944_3610439_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_011806521.1|3610574_3611420_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011806522.1|3611529_3611727_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_011806523.1|3611782_3612091_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011806524.1|3612204_3612576_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011806525.1|3612631_3613312_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	1.1e-32
WP_011806526.1|3613304_3614558_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011806527.1|3614695_3615886_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011806528.1|3616002_3616959_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011806529.1|3616955_3618680_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0R6PDC6	Moraxella_phage	30.9	1.6e-27
WP_011806097.1|3619205_3620168_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	66.2	1.8e-113
WP_011806531.1|3620640_3621018_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_011806532.1|3621014_3621689_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_011806533.1|3621795_3623550_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.8	8.3e-08
WP_011806534.1|3623753_3624632_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011806535.1|3624647_3625283_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011806536.1|3625407_3627477_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011806537.1|3627479_3628283_-	CbbQ/NirQ/NorQ/GpvN family protein	NA	A0A2H4N7N3	Lake_Baikal_phage	30.0	4.6e-14
WP_011806538.1|3628302_3629676_-	cbb3-type cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011806539.1|3629706_3630579_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_085947543.1|3630869_3631538_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011806541.1|3631562_3632867_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 1
NC_008765	Acidovorax sp. JS42 plasmid pAOVO01, complete sequence	72689	50358	59712	72689	transposase	Rhodobacter_phage(16.67%)	9	NA	NA
WP_083766799.1|50358_51387_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.6	6.7e-42
WP_011798662.1|51493_51808_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_011798663.1|51804_52128_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	51.9	2.0e-16
WP_041836463.1|52201_52582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011798665.1|52661_53954_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.9	2.5e-09
WP_011798666.1|53966_54749_-	AAA family ATPase	NA	A0A142F1W4	Mycobacterium_phage	38.2	6.3e-08
WP_011798667.1|54777_55197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041836456.1|55352_56339_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.7	4.6e-40
WP_003158660.1|56796_59712_+|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
