The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	14694	60727	3497479	plate,transposase	Leptospira_phage(33.33%)	44	NA	NA
WP_038802950.1|14694_15814_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011204166.1|15926_16058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196846.1|16041_16239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196848.1|16261_17668_+	amino acid permease	NA	NA	NA	NA	NA
WP_004551036.1|17981_18317_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004196853.1|18343_19144_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004196857.1|19162_19741_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011204167.1|19863_20346_-	YraN family protein	NA	NA	NA	NA	NA
WP_004196861.1|20344_21232_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_004191998.1|21326_22790_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198058.1|22999_24262_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|24859_25465_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|25426_26002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|25961_27245_-	MFS transporter	NA	NA	NA	NA	NA
WP_004198062.1|27403_28048_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080516879.1|28038_28389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198063.1|28385_29009_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004198065.1|29093_29990_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198067.1|30117_31254_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011204169.1|31250_31466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185303.1|31610_32729_-	acyltransferase	NA	NA	NA	NA	NA
WP_004199981.1|32727_33138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204170.1|33131_33674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009922408.1|34105_34201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204896.1|34239_36405_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_071893038.1|36986_37385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205259.1|37427_37697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|37799_38030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012729786.1|38263_38620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|38645_39914_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199993.1|39928_42190_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	4.2e-36
WP_004199995.1|42186_43635_+	TolC family protein	NA	NA	NA	NA	NA
WP_004199997.1|43845_44802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527832.1|44813_45779_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011204174.1|45796_46075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200001.1|46050_49944_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|49940_50930_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004185296.1|50934_51867_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004200005.1|52065_53187_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004200009.1|53276_55970_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.5	9.5e-88
WP_004204910.1|56003_57104_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_076839014.1|57067_58894_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011205263.1|58985_59498_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038802950.1|59606_60727_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 2
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	499640	508877	3497479		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|499640_501593_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004194374.1|501859_502990_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|503023_505030_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|505205_506021_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|506085_506769_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|506765_507293_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|507329_508877_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 3
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	554787	615674	3497479	protease,transposase	Leptospira_phage(13.33%)	52	NA	NA
WP_038802950.1|554787_555907_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|556074_556293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|556490_557000_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|557300_559415_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_009936593.1|559696_559903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038796688.1|560583_562062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|562606_563452_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|563620_564367_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|565082_566444_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|566983_568423_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004200476.1|569049_570324_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|570455_571061_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011204108.1|571360_571522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186428.1|571600_572623_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|572638_573166_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|573250_574006_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004185841.1|577493_578072_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|578268_579651_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|579645_579876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|580108_581137_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|581117_581324_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|581497_582289_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_009929233.1|582309_582507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185840.1|582497_583160_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|583275_584739_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|584842_585046_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|585578_585893_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|585889_588190_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_096325460.1|589008_590129_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004190070.1|590159_590666_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_076804428.1|590812_592537_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004189390.1|592858_593482_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_004189905.1|593474_594509_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004189144.1|594528_594975_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004197552.1|595106_596147_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_004197553.1|596274_596472_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_004188924.1|596537_597461_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_004189945.1|597682_598432_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004189842.1|598428_598752_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004189839.1|599018_600212_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_004190063.1|600292_600568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188973.1|600546_601983_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_004190157.1|602263_603328_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_004189256.1|603517_604408_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.8	3.3e-53
WP_004188932.1|604443_604962_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004190104.1|605041_606238_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004188980.1|606249_607275_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	40.2	1.9e-41
WP_004189788.1|607522_608662_-	acylhydrolase	NA	NA	NA	NA	NA
WP_004201777.1|610023_611475_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_004189255.1|611742_612405_+	response regulator	NA	NA	NA	NA	NA
WP_004190128.1|612408_613725_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.6	1.9e-20
WP_004526224.1|614186_615674_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.1	2.0e-26
>prophage 4
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	1344638	1368469	3497479	plate,transposase,coat	uncultured_Caudovirales_phage(50.0%)	26	NA	NA
WP_004192127.1|1344638_1346489_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1346516_1347932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1347955_1348222_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1348481_1348709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1348742_1351550_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1351552_1352386_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1352619_1353740_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193365.1|1353834_1354227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193170.1|1354486_1355800_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_011203888.1|1355848_1356025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203889.1|1356316_1356571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552605.1|1356655_1356964_+	lipoprotein	NA	NA	NA	NA	NA
WP_004193855.1|1357216_1357498_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009937836.1|1357497_1357758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192394.1|1357965_1358958_-	hydrolase	NA	NA	NA	NA	NA
WP_004196700.1|1359002_1360199_-	MFS transporter	NA	NA	NA	NA	NA
WP_009920897.1|1360354_1360492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|1360705_1361599_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|1361936_1362158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|1362243_1362429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|1362415_1362961_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|1363013_1363574_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1363650_1364175_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191504.1|1364192_1365032_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011807694.1|1365139_1367488_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004196717.1|1367503_1368469_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	1453658	1504475	3497479	transposase,tRNA	Leptospira_phage(42.86%)	44	NA	NA
WP_004266640.1|1453658_1454168_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011203911.1|1455196_1455535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192661.1|1455613_1457986_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_038802950.1|1459352_1460473_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004191362.1|1460999_1462553_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|1462602_1463868_+	lipoprotein	NA	NA	NA	NA	NA
WP_011203914.1|1464018_1465698_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_009920703.1|1465822_1465954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193599.1|1465941_1466403_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|1466639_1467050_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004526858.1|1467021_1467240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550551.1|1467244_1468342_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|1468448_1469879_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|1469978_1471253_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|1471380_1474245_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|1474583_1476410_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_009930591.1|1476406_1476562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|1476702_1477200_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|1477299_1478796_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|1478863_1480099_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|1480121_1481681_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|1481951_1482887_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|1482913_1483282_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|1483387_1486315_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|1486406_1487882_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|1487878_1488340_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|1488644_1490309_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|1490372_1491701_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|1492119_1493022_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004550556.1|1493215_1493413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199443.1|1493440_1493842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009920735.1|1493861_1493963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521676.1|1494047_1494305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|1494463_1494781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|1494981_1495704_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|1495942_1496221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|1496369_1496627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|1496676_1496967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1497388_1498508_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197405.1|1499307_1500534_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004205966.1|1500862_1501354_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004192528.1|1501364_1502567_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_011203917.1|1503013_1503220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1503354_1504475_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 6
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	2203125	2287423	3497479	transposase	Streptococcus_phage(33.33%)	58	NA	NA
WP_004191998.1|2203125_2204589_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2204697_2205267_-	phasin family protein	NA	NA	NA	NA	NA
WP_004557110.1|2205936_2207058_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_004191998.1|2207177_2208641_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2208897_2210667_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2210974_2212564_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2212696_2215393_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011204038.1|2215536_2218176_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2218172_2218811_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2219127_2219985_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_011204039.1|2220238_2220562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2220678_2222778_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_009931175.1|2223007_2224222_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2224162_2224447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2224939_2226220_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2226263_2227649_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2227899_2231625_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2231621_2233175_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2233171_2233876_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2233912_2234599_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2234740_2236663_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2236698_2237400_+	response regulator	NA	NA	NA	NA	NA
WP_011204042.1|2237371_2237548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193531.1|2237546_2238323_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2238605_2240069_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2240201_2241737_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004532137.1|2241774_2242869_-	nitrogen regulation protein NR(II)	NA	NA	NA	NA	NA
WP_004191998.1|2243041_2244505_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192601.1|2244676_2246092_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2246496_2246961_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2247213_2248032_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2248028_2248862_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_009966722.1|2248917_2249190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192998.1|2249405_2250395_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2250411_2251404_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2251505_2255633_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2255656_2257033_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2257085_2257361_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_076882745.1|2257533_2258877_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_038796647.1|2259073_2260609_-	CoA transferase	NA	NA	NA	NA	NA
WP_004206369.1|2260605_2262399_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2262507_2263410_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|2265247_2266368_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004534273.1|2266909_2268010_+	porin	NA	NA	NA	NA	NA
WP_004193987.1|2268478_2268817_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004198600.1|2268877_2270578_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004192390.1|2270698_2271877_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011807750.1|2272865_2273780_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.1e-07
WP_004192356.1|2273838_2274366_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_004193515.1|2274526_2275966_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192728.1|2276054_2276813_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004192161.1|2276851_2278159_+	MFS transporter	NA	NA	NA	NA	NA
WP_004193604.1|2278339_2279530_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004193146.1|2279534_2281514_-	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193185.1|2281513_2282503_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004199404.1|2282537_2282717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191560.1|2282829_2285814_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_011203959.1|2285959_2287423_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.6e-79
>prophage 7
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	2505806	2570042	3497479	protease,transposase,tRNA	Streptococcus_phage(27.78%)	59	NA	NA
WP_004191998.1|2505806_2507270_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189921.1|2507380_2508352_-	thymidylate synthase	NA	A0A1V0DY05	Yersinia_phage	36.1	2.9e-47
WP_004189039.1|2508408_2509794_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195958.1|2509755_2510052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201791.1|2510316_2510685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011832229.1|2510681_2511959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516914.1|2512220_2514059_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189313.1|2514266_2514770_+	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.4	9.6e-26
WP_004191998.1|2514898_2516362_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004188997.1|2516498_2517869_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004195962.1|2518014_2518623_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004189637.1|2518603_2519224_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004189767.1|2519471_2520077_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.2e-28
WP_004189931.1|2520195_2521461_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004189924.1|2521457_2522402_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_004189573.1|2522470_2522788_+	lipoprotein	NA	NA	NA	NA	NA
WP_004195964.1|2522954_2523893_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_004550123.1|2523993_2524677_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_009931411.1|2525313_2525604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190182.1|2525600_2526191_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004189360.1|2526511_2526901_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004189914.1|2527038_2527833_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004195969.1|2527834_2528524_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004189402.1|2528568_2528823_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004189308.1|2530263_2530731_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_004189906.1|2530765_2531923_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_004188962.1|2532031_2532520_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004189387.1|2532667_2533954_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004189890.1|2535969_2536905_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_004189750.1|2536920_2537670_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011807766.1|2537896_2538691_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189862.1|2538764_2539418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190044.1|2539407_2540442_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-34
WP_004190087.1|2540750_2541593_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
WP_004188957.1|2541935_2542859_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_085962730.1|2542986_2544333_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004532363.1|2544558_2545461_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004204273.1|2545472_2545772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189725.1|2545784_2546102_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|2546173_2547166_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004200795.1|2547224_2548211_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004189214.1|2548179_2549580_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004188993.1|2549700_2550870_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_011203815.1|2550922_2551417_-	LapA family protein	NA	NA	NA	NA	NA
WP_004191998.1|2551451_2552915_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189865.1|2553033_2553357_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_004189285.1|2553379_2555092_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004189396.1|2555236_2555923_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_096325444.1|2555943_2558166_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011203817.1|2558113_2558290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190098.1|2558369_2559452_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_004189993.1|2559486_2560569_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.2	8.5e-88
WP_004189806.1|2560742_2561339_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004189243.1|2561437_2564038_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.8	9.5e-101
WP_004189892.1|2564548_2565223_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004532296.1|2565391_2566090_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004190123.1|2566115_2566841_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_038802950.1|2567438_2568559_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004186184.1|2568821_2570042_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
>prophage 8
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	2603784	2641955	3497479	tRNA,transposase,integrase	Leptospira_phage(30.0%)	38	2614152:2614211	2616688:2617884
WP_004186184.1|2603784_2605005_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
WP_004190100.1|2605346_2605607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|2605629_2606106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550102.1|2606274_2606523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205188.1|2607180_2607528_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004203540.1|2607814_2608303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004554214.1|2608299_2609571_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004188913.1|2609558_2611895_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011203824.1|2612041_2612518_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_011203825.1|2613043_2613637_+	chorismate mutase	NA	NA	NA	NA	NA
WP_004557196.1|2613633_2613846_-	hypothetical protein	NA	NA	NA	NA	NA
2614152:2614211	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_038802950.1|2614198_2615319_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189968.1|2615349_2616021_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.1	1.3e-46
WP_011203829.1|2616247_2616340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2616734_2617855_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004550771.1|2618137_2618659_-	hypothetical protein	NA	NA	NA	NA	NA
2616688:2617884	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCATTGCTTCGGCCAGCAGTTTCTTCAGTCGGGCATTCTCCACCTCGAGGCCCTTGAGCCGGCGGGCTTCCGAAACTTCCATGCCGCCGAACTTCGCGCGCCAGGTGTAGAACGACGCGTCACTGAACCCATGCTTCCTGCACAGTTCCTTGACCGGCATACCGGCCTCGGCTTCCTTCAGAAACCCGATGATTTGCTGTTCCGTAAAGCGCTTCTTCATGTTCGTCTTCTTCTCCGAAAACGAACTTT	NA	NA	NA	NA
WP_004191998.1|2618927_2620391_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004186453.1|2620513_2621494_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004186190.1|2621496_2621952_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004185928.1|2622090_2622927_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|2623220_2623454_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004185395.1|2623471_2623639_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004554550.1|2623761_2625408_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004197485.1|2625379_2625598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185611.1|2625599_2626484_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_004185886.1|2626480_2627617_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_004186237.1|2627785_2628982_-	aminotransferase	NA	NA	NA	NA	NA
WP_004186398.1|2629178_2630531_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004186079.1|2630542_2631805_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004185746.1|2631801_2632464_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	1.6e-25
WP_004535897.1|2632588_2633581_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004185348.1|2633692_2636530_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.6e-80
WP_004186086.1|2636529_2637030_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004186216.1|2637091_2638303_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-41
WP_004186718.1|2638366_2638813_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	7.9e-48
WP_004185819.1|2638901_2639684_-	membrane protein	NA	NA	NA	NA	NA
WP_004185697.1|2639848_2640595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2640834_2641955_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 9
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	2763141	2820732	3497479	protease,transposase,tRNA,portal	Vibrio_phage(17.65%)	54	NA	NA
WP_004191998.1|2763141_2764605_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|2764771_2765542_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|2765573_2766413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|2766539_2768012_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|2768014_2769505_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|2769617_2769917_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011807773.1|2770282_2771326_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|2771445_2772519_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|2772515_2773028_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|2773211_2775620_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|2775631_2776780_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|2777158_2777935_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|2777931_2778717_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_009962395.1|2778709_2779042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189793.1|2779138_2779591_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|2779610_2780243_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|2780336_2781071_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_009918037.1|2781067_2781358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189647.1|2781538_2782222_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|2782222_2784631_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|2784632_2785223_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|2785219_2786629_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|2787006_2787864_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|2787973_2788609_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|2788729_2789713_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|2789744_2790248_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|2790476_2791667_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|2791726_2792098_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|2792308_2794918_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|2795139_2796195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|2796644_2797661_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|2797781_2798651_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|2798688_2799093_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004203542.1|2799483_2800704_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	3.9e-238
WP_009918009.1|2801166_2801421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2802020_2803140_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|2803192_2803675_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|2803671_2803956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188948.1|2804028_2805042_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.4	1.3e-194
WP_011203781.1|2805694_2805859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|2806065_2806941_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|2806951_2808064_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|2808092_2809187_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|2809329_2810298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|2810400_2810970_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|2811562_2812111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011203779.1|2812126_2812378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|2812374_2813823_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004204797.1|2813841_2815443_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|2815614_2816556_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|2816552_2817647_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|2818048_2818465_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|2818680_2819235_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|2819612_2820732_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 10
NC_008785	Burkholderia mallei SAVP1 chromosome I, complete sequence	3497479	3220190	3284976	3497479	terminase,protease,transposase,integrase	Burkholderia_phage(13.33%)	59	3226444:3226462	3285801:3285819
WP_004539219.1|3220190_3220718_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
WP_004199888.1|3220939_3221437_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_038802950.1|3221798_3222918_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|3223543_3223816_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|3223934_3224717_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|3225036_3225465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|3225546_3226422_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|3226414_3226936_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
3226444:3226462	attL	CGCGCTCGCGATCGGCGTG	NA	NA	NA	NA
WP_004199878.1|3227093_3228107_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004199877.1|3228190_3228988_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004199876.1|3229006_3229864_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|3229941_3231321_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|3231331_3232009_+	response regulator	NA	NA	NA	NA	NA
WP_004549852.1|3232331_3233459_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|3233494_3233677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004266287.1|3233913_3235947_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.5	3.3e-85
WP_004197137.1|3235987_3239017_+	type III restriction endonuclease subunit R	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_011204147.1|3239100_3239403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197133.1|3239554_3240655_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|3241054_3242014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|3242136_3242868_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|3243240_3243963_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004205008.1|3243959_3245009_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|3245005_3245884_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|3245888_3247148_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011204146.1|3247275_3247368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198383.1|3247364_3248870_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|3248925_3249318_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|3249328_3250138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|3250183_3250981_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|3251065_3252715_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|3253442_3253784_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198375.1|3253780_3254917_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_004199869.1|3254996_3255116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|3255196_3256317_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200089.1|3256407_3257517_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	79.9	6.5e-168
WP_004202928.1|3257934_3258834_+	cytochrome c	NA	NA	NA	NA	NA
WP_004195888.1|3259154_3261257_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	34.8	1.1e-94
WP_073699136.1|3261506_3262349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516922.1|3262345_3263149_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_004545329.1|3263231_3263519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185221.1|3263662_3264715_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004195883.1|3264886_3265246_+	lipoprotein	NA	NA	NA	NA	NA
WP_004202927.1|3266017_3267136_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_004195879.1|3267229_3267610_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004195877.1|3267914_3270842_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	2.8e-258
WP_004185207.1|3270832_3270958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195875.1|3270993_3272112_+	alginate lyase family protein	NA	NA	NA	NA	NA
WP_004195873.1|3272145_3273534_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011205306.1|3273568_3274750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195870.1|3274977_3276681_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_004185233.1|3276709_3277777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195868.1|3277895_3278924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004195866.1|3278967_3279147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004556617.1|3279219_3280740_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004195862.1|3281006_3281252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195860.1|3281317_3282121_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_004195859.1|3282117_3283458_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_004191998.1|3283512_3284976_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
3285801:3285819	attR	CACGCCGATCGCGAGCGCG	NA	NA	NA	NA
>prophage 1
NC_008784	Burkholderia mallei SAVP1 chromosome II, complete sequence	1734922	692935	772605	1734922	transposase,holin,plate	uncultured_Caudovirales_phage(40.0%)	60	NA	NA
WP_011204354.1|692935_693886_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004186852.1|694153_695098_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198575.1|695569_697273_+	peptidase	NA	NA	NA	NA	NA
WP_004200641.1|697390_698617_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|698671_699814_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|699922_700045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073699106.1|700041_700896_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186939.1|700931_702485_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004186868.1|702620_703520_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|703663_704539_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004186811.1|704625_706281_-	APC family permease	NA	NA	NA	NA	NA
WP_004186918.1|706461_707325_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186910.1|707434_708580_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186879.1|708600_709869_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004186884.1|709893_710679_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004202150.1|710675_711848_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186901.1|711852_713778_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004186960.1|713780_715844_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|715904_716438_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186989.1|716588_717560_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_011807509.1|717632_718907_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	1.2e-104
WP_009923708.1|718918_719182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|719340_720366_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186783.1|720543_721743_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.9e-11
WP_004186794.1|722182_723199_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004546670.1|723387_724953_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004198244.1|725085_726750_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_004186853.1|727319_728573_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004196352.1|729053_730649_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004184586.1|730645_730828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186828.1|730953_731949_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004184379.1|732213_733800_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004186962.1|733796_735116_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004199051.1|735123_735252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186983.1|735337_736237_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009923697.1|736516_736690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516849.1|736787_737159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|737383_737809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|737831_738191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204346.1|741745_743461_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004202226.1|744844_745438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190606.1|745443_745833_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004190800.1|745875_746592_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004202229.1|746594_747665_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004200633.1|747664_749881_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|749884_752173_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.6	1.0e-26
WP_004196185.1|752338_754585_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	2.1e-24
WP_004190851.1|757448_758438_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|758434_760297_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190879.1|760310_760742_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196178.1|760821_761349_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004530038.1|761492_763004_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004202234.1|763000_763549_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188491.1|763582_764521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325460.1|764643_765764_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011204645.1|767167_767500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188420.1|767469_768984_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004188272.1|769348_770038_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004206084.1|770797_771799_+	HpnL family protein	NA	NA	NA	NA	NA
WP_004188389.1|771837_772605_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
>prophage 2
NC_008784	Burkholderia mallei SAVP1 chromosome II, complete sequence	1734922	1550868	1597520	1734922	transposase,plate	Leptospira_phage(33.33%)	35	NA	NA
WP_004190585.1|1550868_1552272_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|1552287_1553604_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|1553606_1557236_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190273.1|1558132_1558360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011807597.1|1558358_1560947_+	protein kinase	NA	A7IVH4	Paramecium_bursaria_Chlorella_virus	24.3	2.2e-12
WP_004190988.1|1560999_1562079_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|1562141_1562720_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|1562712_1564221_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|1564280_1564772_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|1564790_1565351_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|1565355_1567227_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|1567223_1568702_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190714.1|1568680_1571335_+	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004203275.1|1571331_1573536_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|1573610_1574264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204338.1|1574223_1575252_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038802950.1|1575279_1576400_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204352.1|1576695_1576968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011205668.1|1576964_1578656_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004187717.1|1578756_1581474_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.2	2.0e-13
WP_004187807.1|1581720_1584438_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004188028.1|1584485_1585937_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004188791.1|1586013_1586523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188261.1|1586679_1587699_-	lyase	NA	NA	NA	NA	NA
WP_004187735.1|1587896_1588880_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188685.1|1589178_1589979_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004536542.1|1590178_1590595_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004187439.1|1590599_1590968_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004188402.1|1590972_1592748_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187935.1|1592769_1593471_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188825.1|1593472_1593745_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004188362.1|1593797_1595099_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004187842.1|1595195_1596170_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004200651.1|1596245_1596389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1596399_1597520_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
