The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	10423	40834	2080931	transposase	Lysinibacillus_phage(33.33%)	21	NA	NA
WP_012211199.1|10423_11677_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.0e-08
WP_041810667.1|15593_15788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211200.1|16223_16832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211201.1|16939_18961_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_012211202.1|18972_19428_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_012211203.1|19458_20853_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	3.2e-119
WP_012211204.1|21089_22019_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211205.1|22135_23413_-|transposase	ISL3-like element ISLhe2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.4e-12
WP_003624871.1|23579_24509_+	DegV family protein	NA	NA	NA	NA	NA
WP_035514160.1|24638_25490_+	ROK family protein	NA	NA	NA	NA	NA
WP_003631748.1|25641_25812_+	CsbD family protein	NA	NA	NA	NA	NA
WP_023191122.1|25862_26123_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012211208.1|26183_27413_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_012211209.1|27496_28201_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.6	2.1e-18
WP_041810668.1|28683_30516_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.1	6.2e-99
WP_012211211.1|30518_33530_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.7	3.7e-157
WP_012211212.1|33822_35052_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	2.6e-64
WP_012211213.1|35289_36549_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.3	1.5e-11
WP_012211214.1|36787_38089_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_012212409.1|38667_39318_+|transposase	IS607-like element ISLhe9 family transposase	transposase	A0A7Q0	Microcystis_virus	45.7	3.6e-41
WP_023062123.1|39271_40834_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	150572	214556	2080931	transposase,tRNA	Lactobacillus_phage(12.5%)	52	NA	NA
WP_012211282.1|150572_151850_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211283.1|152023_155041_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_012211284.1|155538_156015_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	63.6	1.3e-51
WP_012211285.1|156130_156628_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003629999.1|156646_157450_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003625468.1|157600_158092_+	universal stress protein	NA	NA	NA	NA	NA
WP_012211286.1|158438_159374_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003625472.1|159403_160177_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	6.6e-26
WP_012211287.1|160176_160974_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_012211288.1|160973_161786_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_012211289.1|161829_162402_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_012211290.1|162556_163042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211291.1|163095_164493_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012211292.1|164608_166558_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	31.0	4.0e-27
WP_012211293.1|166580_167864_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003625480.1|168138_168300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211294.1|168514_170734_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.9e-251
WP_012211295.1|170726_171440_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	55.8	1.0e-49
WP_012211296.1|171491_172061_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_003625486.1|172053_173247_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_012211297.1|173346_174564_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	32.8	1.4e-51
WP_003625492.1|174653_176585_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.2	1.3e-67
WP_012211298.1|178231_180253_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.4	4.2e-64
WP_012211299.1|180517_180952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080668570.1|181231_181312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211300.1|181606_182848_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	1.3e-119
WP_012211301.1|184297_184738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211302.1|184974_185190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810676.1|186021_187353_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003627959.1|187588_188926_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003627958.1|188900_189131_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|189170_189521_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003633334.1|189514_189691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014918132.1|189769_189931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212415.1|190619_191009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211304.1|191623_192847_+	SLAP domain-containing protein	NA	S5M9Y4	Brevibacillus_phage	36.9	1.6e-13
WP_012211305.1|192865_193957_+	SLAP domain-containing protein	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	26.9	1.3e-19
WP_003630530.1|194060_195896_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_012211306.1|196013_196748_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	31.6	6.5e-31
WP_003630533.1|197093_198059_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_035513470.1|198068_198860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211308.1|201306_201999_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012211309.1|202221_202824_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003625545.1|202887_203448_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_012211310.1|203549_204659_+	LCP family protein	NA	NA	NA	NA	NA
WP_012211311.1|204658_205276_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_012211312.1|205311_208302_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_012211313.1|208387_209773_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_012211314.1|210026_211289_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.0e-84
WP_003630682.1|211710_212067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212409.1|212389_213040_+|transposase	IS607-like element ISLhe9 family transposase	transposase	A0A7Q0	Microcystis_virus	45.7	3.6e-41
WP_023062123.1|212993_214556_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	228682	285576	2080931	protease,transposase,tRNA,bacteriocin	Lactobacillus_virus(15.38%)	48	NA	NA
WP_012211324.1|228682_229345_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012211325.1|229505_230105_-	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_012211326.1|230229_231252_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003625568.1|231276_231756_+	hypothetical protein	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
WP_023061528.1|231745_232354_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_012211328.1|232651_235240_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	25.2	6.2e-36
WP_012211329.1|235332_237309_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.3e-99
WP_012211330.1|237308_238076_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012211331.1|238062_238629_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_012211332.1|238618_239503_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003625575.1|239565_239823_+	Veg family protein	NA	NA	NA	NA	NA
WP_012211334.1|239941_240772_+	pur operon repressor	NA	NA	NA	NA	NA
WP_012211335.1|240818_242204_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	1.0e-29
WP_012211336.1|242435_243041_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012211337.1|243126_244257_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_041810677.1|244392_245787_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012211338.1|246027_247002_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	8.6e-47
WP_012211339.1|248031_248307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211340.1|248334_249699_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.6	1.1e-31
WP_003625587.1|249812_250214_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_023190547.1|250260_250818_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003625589.1|250935_252555_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
WP_012211342.1|252684_253980_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_072749096.1|254334_254724_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012211344.1|254779_256204_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_012211345.1|256284_257109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211346.1|257208_258483_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.4e-28
WP_012211347.1|258486_259065_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_035504367.1|259338_259941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080516407.1|260223_261483_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.4	2.1e-122
WP_035514015.1|261981_262275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190992.1|262317_262470_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_193327842.1|262682_264260_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.3e-23
WP_012211351.1|264430_265639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211352.1|265652_269258_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	24.8	3.1e-09
WP_041810680.1|270600_271017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810681.1|271016_271259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211353.1|271379_272558_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_148201619.1|272698_272956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211354.1|272955_273768_+	cell division protein FtsK	NA	NA	NA	NA	NA
WP_172987699.1|273901_274654_+	replicative protein	NA	NA	NA	NA	NA
WP_012211356.1|276413_277691_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.3	3.8e-10
WP_148201628.1|279634_280489_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|280552_281731_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158298619.1|281947_282238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158298620.1|282176_282887_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003625723.1|282976_284053_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_080516408.1|284322_285576_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	8.0e-122
>prophage 4
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	304091	363045	2080931	protease,transposase,tRNA	Phaeocystis_globosa_virus(14.29%)	60	NA	NA
WP_003625761.1|304091_305117_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_023190458.1|305132_306683_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
WP_003625767.1|307875_308331_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_012211371.1|308435_310916_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.3	1.5e-119
WP_012211372.1|311138_314780_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.7	3.1e-49
WP_012211373.1|314795_318449_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	2.8e-66
WP_012211374.1|319989_320673_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_012211375.1|320856_321264_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003625773.1|321279_321750_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_012211376.1|321784_323878_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	5.5e-67
WP_003549023.1|324197_324506_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_003625776.1|324529_325168_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_012211377.1|325182_325800_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_003625782.1|325799_326105_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_012211378.1|326120_326957_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_003625786.1|326975_327257_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_003625788.1|327276_327630_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_012211379.1|327643_328318_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_003625792.1|328317_328758_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_003625794.1|328747_328945_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_003631302.1|328963_329230_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_012211380.1|329261_329630_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_012211381.1|329649_329883_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_012211382.1|329897_330440_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_003549037.1|330452_330638_+	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003625802.1|330662_331061_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_012211383.1|331085_331616_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_014563006.1|331641_332001_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_003625807.1|332018_332525_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_003625808.1|332541_332727_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_003625809.1|332750_333191_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_003625811.1|333190_334486_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_003625812.1|334496_335153_+	adenylate kinase	NA	NA	NA	NA	NA
WP_002878178.1|335224_335446_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005721621.1|335462_335579_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_012211385.1|335606_335957_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_003625817.1|335981_336371_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_012211387.1|336416_337355_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_012211388.1|337381_337765_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_012211389.1|337949_338801_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.2	2.3e-19
WP_012211390.1|338776_339634_+	energy-coupling factor transporter ATPase	NA	G3M9Y6	Bacillus_virus	30.2	3.9e-19
WP_025283272.1|339626_340424_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003625828.1|340426_341218_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003625830.1|341318_341762_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003625832.1|341777_342173_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_012211392.1|342499_343729_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
WP_012211393.1|343966_345226_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	6.4e-10
WP_012211394.1|345371_345782_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_012211395.1|345871_346456_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_012211396.1|347230_347989_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003631352.1|348027_348708_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211397.1|348770_349670_+	cation transporter	NA	A0A1V0SED0	Indivirus	34.8	6.3e-12
WP_012211398.1|349874_350555_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003631355.1|350658_351594_+	AAA family ATPase	NA	I7CCW4	Staphylococcus_virus	25.7	9.5e-11
WP_012211358.1|351802_352981_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190834.1|354816_357495_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	24.4	4.9e-44
WP_012211401.1|358146_358989_-	sugar transporter	NA	NA	NA	NA	NA
WP_012211402.1|359132_360482_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	35.5	4.8e-72
WP_012212171.1|360691_361549_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_193327843.1|361785_363045_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	5.9e-125
>prophage 5
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	376799	509308	2080931	transposase,holin,tRNA	Streptococcus_phage(13.16%)	108	NA	NA
WP_012211416.1|376799_378077_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	1.3e-10
WP_012211417.1|379158_380025_+	phosphate ABC transporter substrate-binding protein	NA	M1PR58	Cyanophage	22.6	4.2e-05
WP_003625892.1|380028_381024_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003625895.1|381025_381913_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003625897.1|381923_382718_+	phosphate ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	33.5	1.0e-13
WP_012211419.1|382719_383475_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.9e-15
WP_003625900.1|383491_384169_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003625908.1|385763_386276_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003625909.1|386326_386689_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012211420.1|387590_388220_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012211421.1|388209_388716_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.5	9.1e-08
WP_012211422.1|388910_390698_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	2.0e-49
WP_003625916.1|390730_391066_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003631534.1|391066_391666_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_012211423.1|391665_391911_+	YaaL family protein	NA	NA	NA	NA	NA
WP_003631536.1|392014_392653_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	3.6e-54
WP_003625920.1|392664_392985_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003625921.1|392985_393843_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	29.2	3.9e-19
WP_012211424.1|393853_394204_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003625923.1|394205_395060_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	2.3e-64
WP_012211425.1|395062_395797_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_012211426.1|395839_396358_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_012211427.1|396382_397117_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012211428.1|397100_397673_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_023061461.1|397723_398773_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
WP_012211430.1|398841_400119_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211431.1|400296_402210_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	6.0e-60
WP_003625963.1|402383_403031_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_012211433.1|403170_403629_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211434.1|403625_404372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812609.1|405786_406317_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012211436.1|406460_406754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061469.1|406897_406990_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_012211437.1|407287_407818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627770.1|408033_408318_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_012211438.1|408371_409994_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
WP_041810687.1|410153_412751_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	4.6e-39
WP_012211440.1|412750_414661_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	5.8e-55
WP_012211441.1|414661_415252_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003627765.1|415300_416317_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_012211443.1|416375_416801_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_012211444.1|416936_418388_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	3.3e-63
WP_023190286.1|418380_419502_+	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	3.1e-16
WP_012211446.1|419561_420518_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_012211447.1|420510_421872_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
WP_101854061.1|422488_422935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211450.1|423204_425844_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
WP_003627753.1|425904_426162_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_012211451.1|426161_426590_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_012211452.1|426591_426903_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_012211453.1|426966_429324_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_012211454.1|429462_430869_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211455.1|431031_431343_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.7	3.8e-17
WP_012211456.1|431382_431760_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_012211457.1|431830_432688_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079227881.1|432756_434022_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_012211458.1|434303_434717_-	YslB family protein	NA	NA	NA	NA	NA
WP_003627745.1|434793_435597_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003631882.1|435596_436217_+	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	8.8e-13
WP_012211459.1|436495_437725_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.2e-64
WP_012211460.1|437962_439222_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.9e-10
WP_012211461.1|439389_440241_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012211462.1|440374_440800_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_012211463.1|440817_441189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211464.1|441254_442361_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012211465.1|442507_443509_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.3	1.1e-20
WP_012211466.1|443589_444960_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	1.6e-11
WP_003627737.1|445062_445383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211467.1|445397_446789_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4W5J5	Pandoravirus	22.4	4.7e-06
WP_012211468.1|446772_447396_+	YutD family protein	NA	NA	NA	NA	NA
WP_003632178.1|447395_448175_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_012211469.1|448171_448780_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_012211470.1|448793_449444_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_072749066.1|449452_450406_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.8	1.0e-15
WP_003627915.1|459044_460208_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012211472.1|460221_461265_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012211473.1|461264_462287_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_012211474.1|462362_464420_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.3e-142
WP_003632304.1|464486_464720_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012211475.1|464794_467134_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.8	9.5e-84
WP_003627921.1|467146_467605_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
WP_012211476.1|473241_474093_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211477.1|474290_474692_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012211478.1|476886_477897_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_012211479.1|477915_478728_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012211480.1|478756_479677_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012211481.1|479680_480049_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_012211482.1|481077_481593_+	acetyltransferase	NA	NA	NA	NA	NA
WP_012211483.1|481630_483004_-	amino acid permease	NA	NA	NA	NA	NA
WP_012211484.1|486996_488808_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	8.1e-91
WP_012211485.1|488881_489175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080516411.1|489358_489472_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_012211486.1|489685_490288_-	amino acid permease	NA	NA	NA	NA	NA
WP_012211487.1|490269_490737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211488.1|490690_491227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810783.1|491310_491793_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003632604.1|492124_493309_+	acetate kinase	NA	NA	NA	NA	NA
WP_003632732.1|494230_494458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626977.1|494618_495032_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_080516412.1|496796_498047_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.2	2.0e-117
WP_003626968.1|498315_498687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626966.1|498704_499454_-	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_012211491.1|500491_501349_-|transposase	IS982-like element ISLhe7 family transposase	transposase	NA	NA	NA	NA
WP_012211492.1|501530_502937_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003626963.1|503949_504663_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211493.1|504679_505834_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_012211494.1|506108_507350_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_012211495.1|507556_509308_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	2.0e-86
>prophage 6
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	595371	709334	2080931	protease,transposase,tRNA,bacteriocin	Streptococcus_phage(16.67%)	95	NA	NA
WP_012211549.1|595371_596778_-|transposase	ISLre2-like element ISLhe13 family transposase	transposase	NA	NA	NA	NA
WP_012211550.1|596998_597802_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_012211551.1|598775_599702_+	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_012211552.1|599701_600394_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012211553.1|600454_602470_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.4	1.3e-65
WP_012211554.1|602587_603514_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_023190338.1|604311_604506_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_080516415.1|604531_605791_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	54.1	5.8e-112
WP_012211556.1|605910_606204_+	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211557.1|606293_607112_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003626810.1|608164_608959_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_012211559.1|608970_610248_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_012211560.1|610222_611461_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_012211561.1|611447_611909_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211562.1|611901_613305_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012211563.1|613304_613628_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_012211564.1|613714_614080_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_012211565.1|614085_614850_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012211566.1|615146_617546_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012211430.1|617644_618922_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211567.1|619088_619937_+	patatin family protein	NA	NA	NA	NA	NA
WP_012211569.1|624629_625115_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012211570.1|625240_625513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211571.1|626327_627689_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023190478.1|627795_628365_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.9e-10
WP_012211573.1|629701_630406_+	lysozyme	NA	NA	NA	NA	NA
WP_003633288.1|630405_631638_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
WP_012211574.1|631634_632963_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014919182.1|633130_633319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211575.1|633426_634569_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.6	4.2e-29
WP_012211576.1|634592_635132_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003626773.1|635124_635571_-	flavodoxin	NA	NA	NA	NA	NA
WP_003633294.1|635713_636541_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_012211577.1|636549_637473_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003626768.1|637534_638434_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_003633307.1|640920_642081_+	thiolase family protein	NA	NA	NA	NA	NA
WP_012211578.1|642080_643292_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_012211579.1|643291_644455_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003626759.1|644493_644778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211580.1|646256_647435_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_003626750.1|647851_650716_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	27.0	1.9e-33
WP_003627959.1|651307_652645_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003627958.1|652619_652850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143441508.1|652889_653240_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003633334.1|653233_653410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810691.1|653474_654563_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.2	1.1e-50
WP_003627796.1|654916_655186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211582.1|655189_655645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627794.1|655693_656278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627793.1|656989_658372_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
WP_012211583.1|658493_659309_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003627790.1|659318_659801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190318.1|659802_660264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211584.1|660369_661242_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003627787.1|661241_662813_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
WP_012211585.1|662880_663162_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_012211586.1|663313_665503_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.5	8.8e-124
WP_012211587.1|666441_667848_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211588.1|668137_668320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211589.1|668432_668699_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_012211590.1|668698_670432_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_012211591.1|670663_671062_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_012211592.1|671153_671894_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_012211593.1|671972_672821_+	competence protein	NA	NA	NA	NA	NA
WP_012211594.1|672829_673447_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003633400.1|673525_674140_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003627775.1|674263_674896_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_012211595.1|674892_675705_+	NAD kinase	NA	NA	NA	NA	NA
WP_012211596.1|675688_676585_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.5	2.3e-06
WP_012211597.1|678504_679197_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_012211598.1|679303_680332_-	lactonase family protein	NA	NA	NA	NA	NA
WP_012211599.1|680484_683241_+	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	1.1e-75
WP_012211600.1|683709_684909_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003625990.1|684959_685520_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003625992.1|685519_685909_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_012211601.1|685929_688347_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	48.0	1.7e-83
WP_035514383.1|688333_689548_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003625998.1|689544_690801_+	insulinase family protein	NA	A0A2P1EIE5	Megavirus	28.1	1.0e-12
WP_003633413.1|690801_691530_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012211603.1|691597_692716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211604.1|692738_693299_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012211605.1|693482_694580_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.8	7.2e-119
WP_012211606.1|694698_696330_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_012211607.1|696437_697595_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_012211608.1|697621_698284_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	3.4e-39
WP_012211609.1|698328_699615_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	43.8	2.9e-82
WP_012211610.1|699611_700307_+	ComF family protein	NA	NA	NA	NA	NA
WP_012211611.1|700387_700933_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_012211612.1|701072_703472_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_101511653.1|703539_704655_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_012211613.1|704663_704942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211614.1|704958_705927_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_012211615.1|705919_706759_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003626023.1|706800_707820_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_080516416.1|708110_709334_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.4e-115
>prophage 7
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	713931	724480	2080931	transposase	Streptococcus_phage(33.33%)	8	NA	NA
WP_012211620.1|713931_716772_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	3.8e-305
WP_012211621.1|716836_717379_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_012211622.1|717467_718343_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	4.1e-08
WP_012211623.1|718353_719397_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.2	2.4e-87
WP_012211624.1|719389_720325_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
WP_012211625.1|720376_720961_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	3.7e-53
WP_012211626.1|721147_722773_+	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_041810693.1|722761_724480_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	2.6e-86
>prophage 8
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	823176	948911	2080931	protease,transposase,tRNA	Bacillus_virus(19.23%)	100	NA	NA
WP_012211690.1|823176_824367_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	2.4e-123
WP_012211691.1|825084_827724_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.4	4.8e-161
WP_012211692.1|827724_828999_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012211693.1|828988_829666_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003627679.1|829704_830328_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_012211694.1|830423_831428_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012211695.1|831473_832325_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012211696.1|832324_832864_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003627675.1|832904_833039_-	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_003628051.1|833133_833466_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_012211358.1|833666_834845_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003627673.1|835040_835472_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_012211697.1|835476_836424_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003628054.1|836437_836800_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_003627667.1|838954_839923_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_003627666.1|839932_841312_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_012211698.1|841313_842420_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_012211699.1|842436_843294_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_012211700.1|843356_844715_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_012211701.1|844729_846049_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_012211702.1|846066_846504_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_003627655.1|846503_846806_+	YggT family protein	NA	NA	NA	NA	NA
WP_003627654.1|846805_847606_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_012211703.1|847581_848379_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_012211704.1|848599_851383_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	1.2e-88
WP_003627651.1|851382_851586_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_012211705.1|851605_852175_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627649.1|852177_852486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211706.1|852503_853199_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023190853.1|853200_854358_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.6	1.8e-27
WP_012211708.1|854753_855881_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_012211709.1|855956_857234_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.8e-12
WP_012211710.1|857442_858102_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211711.1|858101_858746_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211712.1|858745_861097_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	2.1e-59
WP_041810698.1|862139_863819_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003627933.1|863825_864047_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_012211714.1|864214_865621_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003628072.1|866004_866559_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
WP_023190858.1|868752_869934_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_012211716.1|869930_870275_+	YlbG family protein	NA	NA	NA	NA	NA
WP_012211717.1|870271_870820_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003627939.1|870822_871317_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
WP_012211718.1|871300_872335_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_012211719.1|872412_873108_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211720.1|873076_875365_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	8.2e-24
WP_003627943.1|875361_876348_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003628079.1|876880_877150_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_012211721.1|877306_879079_+	ribonuclease J	NA	NA	NA	NA	NA
WP_012211722.1|879081_879915_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211723.1|880104_881295_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	2.3e-30
WP_012211724.1|881445_882804_+	trigger factor	NA	NA	NA	NA	NA
WP_012211725.1|882934_884209_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	1.7e-132
WP_012211726.1|884198_884789_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012211727.1|884753_886490_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.2e-87
WP_012211728.1|888271_889276_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_012211454.1|889365_890772_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211729.1|890896_892249_-	aspartate kinase	NA	NA	NA	NA	NA
WP_012211730.1|892721_894038_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003626729.1|894057_894768_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211731.1|894770_895925_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_012211732.1|895926_896862_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_023190283.1|896854_897634_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003626723.1|897654_898821_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211734.1|898832_899891_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003628084.1|899994_901095_+	serine hydrolase	NA	NA	NA	NA	NA
WP_079227764.1|901151_901727_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012211736.1|901771_903382_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_012211737.1|903990_904506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211738.1|904568_905498_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_012211739.1|908182_908818_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211740.1|909388_910666_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.3e-12
WP_012211741.1|912463_913018_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	2.1e-34
WP_012211742.1|913014_914454_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.4	1.5e-95
WP_012211743.1|914639_916046_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211744.1|916183_917887_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	6.0e-88
WP_012211358.1|918160_919339_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211745.1|919591_920296_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.5	2.2e-07
WP_012211746.1|921291_922014_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211747.1|922764_924006_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_023191145.1|924164_925106_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012211748.1|925105_926488_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_012211749.1|927649_928138_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012211750.1|928969_930256_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_012211751.1|931296_933033_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	2.6e-86
WP_012211752.1|933177_933753_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012211358.1|935028_936207_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211753.1|936450_936819_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A7S1E5	Clostridium_phage	38.9	9.2e-10
WP_079227905.1|936840_936912_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012211754.1|937316_938705_+	amino acid permease	NA	NA	NA	NA	NA
WP_003626673.1|938846_939803_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
WP_012211755.1|939817_940336_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
WP_023190625.1|940455_940659_+	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	5.6e-09
WP_023190626.1|940671_940854_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012211756.1|940953_943371_+	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	1.2e-17
WP_012211757.1|943721_944582_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211758.1|944594_945656_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
WP_012211759.1|945648_946350_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012211760.1|946676_947855_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_049751267.1|948113_948911_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	992274	1063164	2080931	integrase,protease,transposase,tRNA	Staphylococcus_phage(15.0%)	59	1000759:1000818	1080943:1081004
WP_012211788.1|992274_992712_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012211789.1|993019_994306_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	1.8e-20
WP_012211790.1|994311_996165_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	2.2e-11
WP_012211791.1|996253_997438_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211792.1|997566_998973_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211793.1|999477_1000671_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.7e-41
1000759:1000818	attL	GAAACTGTCAAATTTTTTGTGTAAATAGATTTTTCTCGTAGATTGATTTTTTAATCTTTT	NA	NA	NA	NA
WP_023191208.1|1002222_1003059_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.3	1.5e-36
WP_012211795.1|1005007_1006393_-	amino acid permease	NA	NA	NA	NA	NA
WP_023191213.1|1006499_1007096_-	DedA family protein	NA	NA	NA	NA	NA
WP_012211798.1|1008291_1009227_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_012211799.1|1009937_1010453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211800.1|1010749_1012504_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	3.1e-87
WP_041810701.1|1012481_1012682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810702.1|1013572_1013932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211801.1|1013945_1014308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211803.1|1015335_1017138_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003626551.1|1017216_1018521_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_172619747.1|1018535_1020455_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.4	2.5e-26
WP_012211805.1|1020473_1021412_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_012211806.1|1021408_1022203_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	2.1e-06
WP_012211807.1|1022209_1022461_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003547064.1|1022562_1022751_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_012211808.1|1022809_1024372_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003626540.1|1024430_1024649_-	YjzD family protein	NA	NA	NA	NA	NA
WP_012211809.1|1024765_1027873_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	32.5	1.2e-134
WP_012211810.1|1028040_1029003_+	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	28.6	2.1e-05
WP_012211811.1|1029036_1030806_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_012211812.1|1030933_1031827_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_003626532.1|1031813_1032719_+	site-specific tyrosine recombinase XerD	NA	S5W9T9	Leptospira_phage	26.9	9.8e-21
WP_003626531.1|1032729_1033086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211813.1|1033078_1033819_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_012211814.1|1033808_1034402_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_003626528.1|1034402_1035119_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_012211815.1|1035341_1036031_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_041810705.1|1037943_1038411_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003626524.1|1038463_1039138_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_012211818.1|1039209_1040421_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003626522.1|1040490_1041798_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003626521.1|1041972_1042248_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.2	1.7e-24
WP_012211819.1|1042331_1043579_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211820.1|1043619_1044507_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.2	4.4e-50
WP_012211821.1|1044591_1045791_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
WP_003628329.1|1045829_1046522_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003626512.1|1046638_1047469_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
WP_003626511.1|1047471_1047702_+	YozE family protein	NA	NA	NA	NA	NA
WP_012211823.1|1047749_1049342_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_012211824.1|1049365_1050217_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012211825.1|1050206_1050959_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_003628334.1|1051019_1051868_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
WP_012211826.1|1051939_1054054_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	1.5e-96
WP_012211827.1|1054087_1055311_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_041810706.1|1055468_1056302_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.9	4.8e-14
WP_003628338.1|1056310_1056835_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_012211830.1|1056845_1058249_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	24.9	5.8e-28
WP_012211831.1|1058401_1059301_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_012211833.1|1060367_1061183_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003628344.1|1061463_1061847_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
WP_003628346.1|1061848_1062226_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_012211835.1|1062306_1063164_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1080943:1081004	attR	GAAACTGTCAAATTTTTTGTGTAAATAGATTTTTCTCGTAGATTGATTTTTTAATCTTTTAT	NA	NA	NA	NA
>prophage 10
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1132436	1194290	2080931	integrase,transposase	Staphylococcus_phage(21.43%)	49	1138216:1138241	1140448:1140473
WP_193327838.1|1132436_1133666_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	6.9e-126
WP_012211876.1|1133784_1134156_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_012211877.1|1134209_1135118_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_012211878.1|1135118_1135961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211879.1|1136096_1137752_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	46.0	2.0e-112
WP_012211880.1|1137744_1138815_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	29.0	5.4e-26
1138216:1138241	attL	ACTATCGCTCTTCATCAACGAAAATT	NA	NA	NA	NA
WP_012211881.1|1138880_1139810_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	51.0	1.8e-86
WP_080516425.1|1139840_1140962_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.6	3.5e-12
1140448:1140473	attR	AATTTTCGTTGATGAAGAGCGATAGT	NA	NA	NA	NA
WP_012211883.1|1141001_1144025_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	2.4e-15
WP_012211884.1|1145297_1146563_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_012211885.1|1146565_1147384_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_012211886.1|1147376_1147868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211889.1|1152697_1154644_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.8e-59
WP_003628612.1|1154839_1155205_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_035509473.1|1155479_1156826_+	amino acid permease	NA	NA	NA	NA	NA
WP_012211891.1|1156857_1158045_+	amidohydrolase	NA	NA	NA	NA	NA
WP_041810796.1|1158385_1159288_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_012211893.1|1160752_1162000_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_012211895.1|1163858_1164392_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041810719.1|1164555_1164786_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_012211896.1|1164920_1165472_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_148201621.1|1165585_1166815_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.0	6.9e-126
WP_012211898.1|1167003_1167243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190890.1|1168270_1168606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628653.1|1168988_1170368_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_012211900.1|1170437_1171673_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.1	1.6e-53
WP_012211901.1|1171726_1173130_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_012211902.1|1173331_1174345_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012211903.1|1174457_1177196_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_035513343.1|1177231_1177444_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_181414337.1|1177707_1178994_+	ATPase	NA	NA	NA	NA	NA
WP_012211905.1|1178997_1179495_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035513345.1|1179530_1179944_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_012211907.1|1179945_1180383_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003628700.1|1180560_1180836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211908.1|1180821_1182534_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	3.0e-87
WP_012211909.1|1182705_1183359_-	endonuclease III	NA	NA	NA	NA	NA
WP_003614991.1|1183800_1184151_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_012211910.1|1184147_1185221_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	4.7e-38
WP_023190383.1|1185204_1186542_+	tetrahydrofolate synthase	NA	NA	NA	NA	NA
WP_012211912.1|1186531_1187623_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	23.1	1.4e-05
WP_012211913.1|1187634_1188171_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158298621.1|1188427_1188562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211914.1|1188759_1189128_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211915.1|1189502_1190162_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003626333.1|1190142_1190817_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003628728.1|1190826_1191567_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
WP_003613446.1|1191578_1192439_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023190387.1|1193258_1194290_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
>prophage 11
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1282622	1354354	2080931	protease,transposase,tRNA	Streptococcus_phage(10.53%)	59	NA	NA
WP_003628907.1|1282622_1284686_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003627460.1|1284678_1285596_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_012211975.1|1285848_1286601_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_012211976.1|1286601_1287507_-	GTPase Era	NA	NA	NA	NA	NA
WP_012211977.1|1287506_1288031_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012211978.1|1288033_1288993_-	PhoH family protein	NA	W8D063	Erwinia_phage	46.5	1.3e-47
WP_012211979.1|1289018_1289462_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	2.0e-11
WP_002880182.1|1289572_1289749_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_012211980.1|1290005_1290845_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_035513591.1|1291215_1291671_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012211982.1|1291878_1292757_+	YitT family protein	NA	NA	NA	NA	NA
WP_003628928.1|1293342_1294371_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	4.1e-47
WP_003627474.1|1294537_1295143_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003627475.1|1295145_1295307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211984.1|1295322_1296489_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211985.1|1297420_1298005_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_080516430.1|1300458_1301718_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.2	2.3e-124
WP_012211987.1|1302724_1303579_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211988.1|1303707_1305981_+	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	25.3	1.6e-43
WP_012211989.1|1306048_1306549_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012211991.1|1308307_1309102_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_012211992.1|1309117_1310047_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
WP_003628968.1|1310190_1310718_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211993.1|1310822_1313096_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_012211454.1|1313276_1314683_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003627502.1|1314823_1315513_-	class A sortase	NA	NA	NA	NA	NA
WP_012211994.1|1315515_1317354_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
WP_158298622.1|1317747_1317924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211995.1|1318797_1319952_-	molecular chaperone DnaJ	NA	A0A167RAM8	Powai_lake_megavirus	29.0	1.4e-19
WP_012211996.1|1320033_1321860_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	1.8e-143
WP_014563432.1|1321877_1322459_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023190313.1|1322474_1323524_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_012211997.1|1323693_1324656_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.1e-05
WP_012211998.1|1324661_1325555_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012211999.1|1325606_1325972_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_012212000.1|1325991_1328604_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_003627514.1|1328608_1328920_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_012212001.1|1328922_1329219_-	YlxR family protein	NA	NA	NA	NA	NA
WP_012212002.1|1329227_1330409_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_012212003.1|1330428_1330905_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_012212004.1|1331014_1335331_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
WP_012212005.1|1335336_1337034_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012212006.1|1337076_1338333_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003627524.1|1339159_1339894_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
WP_012212007.1|1339896_1340454_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003629020.1|1340453_1341179_-	UMP kinase	NA	NA	NA	NA	NA
WP_003627529.1|1341317_1342343_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003627530.1|1342376_1343150_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003629021.1|1343311_1344343_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003629022.1|1344408_1345023_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_012212008.1|1345082_1346264_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_012212009.1|1346321_1348265_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	2.7e-60
WP_012212010.1|1348539_1349817_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	4.5e-11
WP_012212011.1|1349977_1350196_-	YneF family protein	NA	NA	NA	NA	NA
WP_012212012.1|1350258_1350522_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_012212013.1|1350672_1351299_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_012212014.1|1351327_1352113_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012212015.1|1352105_1352765_-	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.8e-09
WP_012211454.1|1352947_1354354_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1504663	1514970	2080931		Prochlorococcus_phage(16.67%)	9	NA	NA
WP_012212085.1|1504663_1506799_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	5.6e-75
WP_003627023.1|1506795_1507845_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
WP_003627024.1|1507876_1509310_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
WP_012212086.1|1509285_1511517_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
WP_003627026.1|1511513_1512185_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003627027.1|1512184_1512436_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012212087.1|1512435_1513152_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	39.1	9.7e-40
WP_012212088.1|1513394_1514489_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003627031.1|1514481_1514970_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
>prophage 14
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1542731	1614288	2080931	protease,transposase,tRNA,bacteriocin	Bacillus_phage(28.57%)	60	NA	NA
WP_012212104.1|1542731_1543412_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627079.1|1543432_1543993_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003548272.1|1544041_1544191_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_023190296.1|1544267_1546376_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012212106.1|1546466_1549058_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003627088.1|1551626_1551923_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035513757.1|1551891_1552233_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012212108.1|1552420_1553335_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012212109.1|1553397_1553874_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012212110.1|1553950_1556365_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012212111.1|1556368_1557418_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_012212112.1|1557702_1558053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212113.1|1558164_1558932_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012212114.1|1559029_1559302_+	acylphosphatase	NA	NA	NA	NA	NA
WP_012212115.1|1559348_1560311_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_012212116.1|1560358_1560847_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_012212117.1|1560883_1562452_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003627105.1|1562429_1563146_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
WP_003627108.1|1563308_1563863_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_012212118.1|1563864_1565016_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003627111.1|1565021_1565369_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003627112.1|1565390_1565984_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_012212119.1|1565964_1566648_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_012212120.1|1566658_1567768_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_012212121.1|1567760_1568285_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003627118.1|1568430_1568787_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003627120.1|1568830_1569031_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080516435.1|1569052_1569586_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.5	1.2e-13
WP_012212123.1|1571572_1572823_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_012212124.1|1572829_1573123_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012212125.1|1574327_1575653_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	36.3	7.3e-57
WP_012212126.1|1575682_1576291_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_041810730.1|1576481_1577012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212129.1|1577843_1579778_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
WP_012212130.1|1580068_1580977_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_003627136.1|1581008_1582340_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_003627138.1|1582342_1582810_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003627139.1|1582812_1583415_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627142.1|1583411_1584242_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_012212131.1|1584250_1586914_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	31.0	2.2e-60
WP_014563208.1|1589181_1589472_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_012212132.1|1589481_1590513_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_012212133.1|1590509_1591166_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_012212134.1|1591168_1592020_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_012212135.1|1592022_1593996_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_012212136.1|1593995_1594739_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012212137.1|1594753_1597288_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	20.8	2.6e-10
WP_012212139.1|1600762_1601644_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_012212140.1|1601661_1601976_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012212141.1|1602382_1603360_-|bacteriocin	class III bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003627172.1|1603497_1605012_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_012211430.1|1605089_1606367_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_003627174.1|1606569_1607547_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012212142.1|1607601_1608915_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_101812619.1|1609069_1609504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191291.1|1609475_1609643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810731.1|1610094_1610727_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
WP_003629734.1|1610761_1611406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212092.1|1611461_1612697_+|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.9	2.2e-55
WP_012212145.1|1613010_1614288_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
>prophage 15
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1723142	1843473	2080931	protease,transposase,bacteriocin	Bacillus_phage(16.13%)	110	NA	NA
WP_012212210.1|1723142_1724384_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.8e-119
WP_012212211.1|1724564_1724972_-	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_012212212.1|1725059_1725800_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	6.8e-121
WP_012212213.1|1726649_1728254_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	1.3e-15
WP_012212214.1|1728374_1729289_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_012212215.1|1729378_1730380_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_012212216.1|1730427_1730931_+	nucleoside 2-deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	1.2e-12
WP_162465573.1|1731081_1731249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810806.1|1731345_1731750_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012212217.1|1731933_1733235_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012212218.1|1733287_1733860_-	elongation factor P	NA	NA	NA	NA	NA
WP_012212219.1|1733894_1734809_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	3.6e-31
WP_012212220.1|1734867_1735428_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012212221.1|1736970_1739277_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012212222.1|1739426_1740113_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1740173_1740824_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012212223.1|1741040_1742840_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012212224.1|1742852_1743602_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
WP_012212225.1|1743748_1745020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212226.1|1745108_1745780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627805.1|1745975_1746113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212227.1|1746203_1747208_-	asparaginase	NA	NA	NA	NA	NA
WP_148201625.1|1747979_1748459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148201630.1|1748524_1748800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212228.1|1749272_1749779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812858.1|1749795_1750191_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212231.1|1750971_1751847_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	7.1e-77
WP_012212232.1|1752011_1754117_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012212233.1|1754341_1755793_+	APC family permease	NA	NA	NA	NA	NA
WP_012211358.1|1756381_1757560_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212234.1|1757644_1758664_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.9	4.2e-44
WP_012212235.1|1761256_1762537_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	1.0e-10
WP_080516439.1|1762887_1763724_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012212237.1|1764655_1765768_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	74.0	2.8e-163
WP_148201631.1|1765777_1766668_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_012212239.1|1766727_1768185_-	flippase	NA	NA	NA	NA	NA
WP_012212240.1|1768202_1769162_-	glycosyltransferase family 2 protein	NA	L7Y3U4	Megavirus	24.8	7.2e-06
WP_012212241.1|1769154_1770351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212242.1|1770347_1771148_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_012212243.1|1771147_1772299_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012212244.1|1772327_1773401_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012212245.1|1773415_1774189_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_041809725.1|1774204_1774855_-	sugar transferase	NA	NA	NA	NA	NA
WP_012212247.1|1774974_1775745_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012212248.1|1775744_1776545_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_012212249.1|1776555_1777443_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012212250.1|1777454_1778516_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	2.5e-15
WP_012212251.1|1778994_1780260_+	GTPase HflX	NA	NA	NA	NA	NA
WP_041810744.1|1780554_1781511_-	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	36.9	2.1e-13
WP_041810745.1|1781648_1782425_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	48.0	2.7e-19
WP_023062123.1|1783325_1784888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012212409.1|1784841_1785492_-|transposase	IS607-like element ISLhe9 family transposase	transposase	A0A7Q0	Microcystis_virus	45.7	3.6e-41
WP_041810747.1|1785527_1785740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810748.1|1785758_1786040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080516440.1|1786050_1786488_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012212252.1|1786608_1787160_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	44.4	2.5e-19
WP_012212253.1|1787349_1787895_-	AAA family ATPase	NA	A0A0K2FM14	Brevibacillus_phage	29.4	1.6e-10
WP_041810749.1|1787988_1788288_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_012212255.1|1788380_1789886_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_012212257.1|1792292_1792640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212258.1|1792752_1793289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212259.1|1793528_1794770_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	56.6	2.8e-119
WP_041810750.1|1794916_1795633_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_012212260.1|1795837_1796323_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012212261.1|1796325_1797096_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012212262.1|1797106_1798648_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
WP_023190894.1|1798656_1799034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810751.1|1799198_1799723_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212263.1|1801887_1803129_-	LCP family protein	NA	NA	NA	NA	NA
WP_012212264.1|1803300_1805097_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_080516441.1|1805384_1805678_+	Fic family protein	NA	NA	NA	NA	NA
WP_023190802.1|1806583_1807960_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_003627328.1|1808397_1809192_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012212267.1|1809191_1809839_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.1	2.1e-17
WP_193327840.1|1809870_1810833_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003630183.1|1811110_1811383_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212269.1|1811586_1813584_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012212270.1|1813604_1814519_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_041810005.1|1814518_1815274_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
WP_003630190.1|1815633_1815801_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_012212272.1|1815781_1816090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919460.1|1816360_1816552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630196.1|1816851_1817073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810755.1|1817062_1817290_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041810756.1|1817437_1817761_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_012212275.1|1819492_1820242_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_003627351.1|1820250_1821822_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_012212276.1|1821872_1823021_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
WP_012212277.1|1823024_1823711_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
WP_012212278.1|1823899_1825759_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	4.8e-46
WP_012212279.1|1825768_1827346_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	1.3e-36
WP_012211358.1|1827482_1828661_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212280.1|1828786_1829221_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041810757.1|1829261_1829810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1830007_1831186_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212281.1|1831356_1832139_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003627361.1|1832147_1833248_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003627362.1|1833306_1833570_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_012212282.1|1833562_1834447_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.9e-16
WP_003627364.1|1834424_1835204_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
WP_012212283.1|1835219_1836059_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	44.0	2.7e-17
WP_012212284.1|1836073_1836796_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012212285.1|1836957_1837494_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003627368.1|1837535_1838465_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_012212286.1|1838473_1839265_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003627370.1|1839357_1839906_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
WP_041810758.1|1839919_1840459_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023190785.1|1840601_1841225_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012212288.1|1841509_1842835_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_012212126.1|1842864_1843473_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
>prophage 16
NC_010080	Lactobacillus helveticus DPC 4571, complete sequence	2080931	1866226	1919961	2080931	transposase	Lactococcus_phage(18.18%)	43	NA	NA
WP_012212302.1|1866226_1867936_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	3.9e-87
WP_023190551.1|1867932_1870101_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.6	1.1e-171
WP_005720082.1|1870093_1870519_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_023190550.1|1870499_1871507_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_012212305.1|1871770_1872949_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_080516447.1|1873150_1873504_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003630326.1|1873811_1874369_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003627923.1|1874334_1875519_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012212307.1|1875540_1876452_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
WP_035514011.1|1877727_1877946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211580.1|1879226_1880405_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_012212310.1|1880425_1881157_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212311.1|1881268_1882543_-	MFS transporter	NA	NA	NA	NA	NA
WP_023190988.1|1882638_1883487_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080516448.1|1884262_1884565_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_012212313.1|1885049_1885523_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003625266.1|1885676_1887962_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_080516443.1|1887939_1888845_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_003625262.1|1890084_1891161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212314.1|1891163_1891721_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003625260.1|1893283_1893826_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_012212316.1|1893899_1894889_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_012212317.1|1894936_1895695_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_012212318.1|1895754_1896525_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_003630373.1|1896517_1897360_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012212319.1|1897340_1898720_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003625250.1|1898733_1899150_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012212320.1|1899154_1899625_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_012212321.1|1899628_1900858_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012212322.1|1900879_1901611_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	2.1e-13
WP_012212323.1|1901610_1902528_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003625239.1|1902537_1902780_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003625237.1|1902838_1903822_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003625235.1|1903818_1904286_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|1904315_1904762_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002831196.1|1906485_1906734_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012212324.1|1907406_1908732_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_012212126.1|1908761_1909370_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_012212325.1|1911931_1912819_+	EamA family transporter	NA	NA	NA	NA	NA
WP_012212326.1|1912871_1914149_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.6e-11
WP_041810760.1|1915161_1917408_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.2e-59
WP_012212328.1|1917872_1918391_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212329.1|1918734_1919961_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.3	1.8e-38
