The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011566	Shewanella piezotolerans WP3, complete sequence	5396476	1381221	1391827	5396476	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_020911526.1|1381221_1381971_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.8	1.2e-69
WP_020911527.1|1382047_1382683_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.0	6.8e-37
WP_044555716.1|1382749_1383646_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_020911529.1|1383722_1384691_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	32.4	1.4e-33
WP_020911530.1|1384910_1387493_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.4	5.6e-37
WP_020911531.1|1387813_1388881_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	58.9	1.9e-111
WP_020911532.1|1389202_1391827_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	2.2e-81
>prophage 2
NC_011566	Shewanella piezotolerans WP3, complete sequence	5396476	1918155	1984993	5396476	transposase,protease,tRNA,integrase	uncultured_Mediterranean_phage(25.0%)	56	1931519:1931540	1983833:1983854
WP_020912003.1|1918155_1919271_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_020912004.1|1919463_1919916_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020912006.1|1919908_1920589_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_020912008.1|1920888_1923114_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_012155761.1|1923211_1923418_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.3	9.6e-17
WP_020912009.1|1923657_1923966_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.9	3.9e-14
WP_020912010.1|1924002_1926261_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.8e-164
WP_005500725.1|1926753_1926972_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044555787.1|1927085_1927811_-	arginyltransferase	NA	NA	NA	NA	NA
WP_020912012.1|1927800_1928511_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020912013.1|1928564_1929041_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_044555788.1|1929139_1930507_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_143711182.1|1930608_1931214_+	LysE family transporter	NA	NA	NA	NA	NA
1931519:1931540	attL	CTTAAAAGGGAATAACCATTTC	NA	NA	NA	NA
WP_020912017.1|1931732_1933817_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_079891925.1|1934024_1935344_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020912019.1|1935399_1936056_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_020912021.1|1936639_1937623_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_020912022.1|1937679_1938498_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	29.2	1.4e-21
WP_020912023.1|1938478_1939873_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_020912024.1|1940169_1941537_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044555790.1|1941892_1942381_+	CreA family protein	NA	A0A2I7SAK3	Vibrio_phage	37.7	1.1e-18
WP_020912027.1|1942456_1943032_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_020912028.1|1943153_1943606_-	azurin	NA	NA	NA	NA	NA
WP_044555791.1|1943897_1944950_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_020912030.1|1945584_1946076_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_020912031.1|1946179_1947661_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_052634166.1|1948168_1948906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044556348.1|1948926_1951257_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020912035.1|1951266_1952508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020912036.1|1952577_1953384_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	28.2	1.4e-15
WP_020912037.1|1953400_1953700_-	YciI family protein	NA	NA	NA	NA	NA
WP_020912038.1|1953699_1954245_-	septation protein A	NA	NA	NA	NA	NA
WP_020912039.1|1954399_1955251_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020912040.1|1955622_1956630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044555792.1|1957137_1958106_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044555793.1|1958811_1959240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020911050.1|1961153_1962104_+|transposase	IS110-like element ISSpi5 family transposase	transposase	NA	NA	NA	NA
WP_020912046.1|1962132_1962570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020912047.1|1963207_1964236_+|transposase	IS110-like element ISSpi2 family transposase	transposase	NA	NA	NA	NA
WP_044555795.1|1964607_1965861_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_020912049.1|1965987_1967037_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044555796.1|1967417_1968374_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.9	1.0e-44
WP_020912051.1|1968459_1969269_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_020912052.1|1969261_1970479_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_020912053.1|1970584_1972003_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	NA	NA	NA	NA
WP_020912054.1|1972055_1973108_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	1.5e-57
WP_020912055.1|1973104_1973743_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.6	2.9e-35
WP_020912056.1|1973739_1975311_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_044555797.1|1975949_1976822_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_020912059.1|1976818_1977439_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_020912060.1|1977522_1978311_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.9	6.8e-10
WP_020912061.1|1978323_1978920_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.7	7.1e-28
WP_020912062.1|1978912_1979785_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_020912063.1|1980065_1980803_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_020912064.1|1981065_1983552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020912066.1|1983961_1984993_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.6	7.7e-22
1983833:1983854	attR	CTTAAAAGGGAATAACCATTTC	NA	NA	NA	NA
>prophage 3
NC_011566	Shewanella piezotolerans WP3, complete sequence	5396476	2709440	2719050	5396476	tRNA	Pelagibacter_phage(16.67%)	8	NA	NA
WP_020912679.1|2709440_2710268_-	glucosaminidase domain-containing protein	NA	M1IDP9	Pelagibacter_phage	40.4	9.3e-10
WP_020912680.1|2710424_2711339_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.8	3.2e-27
WP_020912681.1|2711382_2712576_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_020912682.1|2712832_2714119_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	2.2e-95
WP_020912683.1|2714137_2714512_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.8	3.2e-10
WP_020912684.1|2714504_2715836_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.9	4.3e-81
WP_020912685.1|2715845_2716472_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_020912686.1|2716560_2719050_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	7.7e-84
