The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	254544	302959	5082025	plate,transposase,capsid	Streptococcus_phage(28.57%)	49	NA	NA
WP_000224516.1|254544_255891_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|255893_256418_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|256414_257707_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|257711_258761_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|258724_260566_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|260571_260997_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|261001_262486_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|262508_263012_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263717_264236_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053636.1|264456_266439_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_000571852.1|266545_267592_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528853.1|267584_269024_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|268998_269289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|270539_271043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|271136_271625_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|271895_272666_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|272819_273293_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|273335_275780_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|276019_276598_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|276803_277571_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|277541_278282_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|278593_279343_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|279518_280016_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|280098_280257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447225.1|280335_282075_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|282019_282805_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|282875_283931_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|283982_284276_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|284278_284677_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|284686_285139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|285316_286468_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|286464_287079_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|287135_288593_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|288853_289312_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|289403_290648_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|290705_291107_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|291216_292272_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|292560_293664_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|293675_294929_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000788777.1|295724_295883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873455.1|298721_298910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005056.1|298932_299100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609984.1|299151_299841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000617151.1|299852_300131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129159.1|300263_300668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066656.1|300669_301005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000898164.1|301340_301553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000582630.1|301549_301912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000600409.1|301930_302959_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
>prophage 2
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	882732	992284	5082025	portal,tail,plate,integrase,terminase,holin,protease,tRNA,lysis,capsid,head	Escherichia_phage(37.1%)	92	896495:896512	963251:963268
WP_000188147.1|882732_884679_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|884751_884976_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|885298_885619_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|885649_887926_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|888638_889622_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|889618_892852_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|893181_894489_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|895419_896421_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|896431_896986_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
896495:896512	attL	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
WP_001040187.1|898027_898246_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|898530_899235_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|899276_900998_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043638.1|900998_902765_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|902887_903853_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|904396_904891_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|905025_909069_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|909227_909839_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|909849_911193_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|911283_912576_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|912814_915259_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|915269_915887_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534662.1|915888_916752_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|916787_917414_-	hydrolase	NA	NA	NA	NA	NA
WP_000109282.1|917727_918876_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067975.1|918972_919770_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023393.1|919801_920797_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	99.7	3.5e-189
WP_000072552.1|920890_921202_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022055.1|921306_921663_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	99.2	4.1e-63
WP_001005162.1|921673_921844_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217671.1|921840_922341_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|922404_922629_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|922628_922928_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|922930_923155_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|923151_923427_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268633.1|923416_925708_+	replication endonuclease	NA	M1SV59	Escherichia_phage	97.6	0.0e+00
WP_000423308.1|925931_928148_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038157.1|928651_929686_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	1.6e-200
WP_000156835.1|929685_931458_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_001085949.1|931631_932486_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.9	1.6e-134
WP_001248569.1|932544_933618_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.7	3.9e-202
WP_000203438.1|933621_934365_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_000988633.1|934464_934974_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846398.1|934973_935177_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123117.1|935180_935462_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	4.8e-43
WP_001144101.1|935461_935959_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736585.1|935973_936399_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.5e-59
WP_000040650.1|936386_936812_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.7	1.8e-65
WP_071819632.1|936798_936957_+|lysis	phage lysis protein	lysis	M1RZ27	Escherichia_phage	96.2	9.9e-22
WP_000917185.1|936919_937387_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	2.8e-80
WP_001001780.1|937379_937832_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093712.1|937898_938534_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_000127163.1|938530_938878_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121486.1|938882_939791_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.3e-161
WP_001285336.1|939783_940314_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	90.9	8.7e-94
WP_000023101.1|940324_942334_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	97.0	0.0e+00
WP_001164113.1|942337_942865_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	95.4	2.3e-91
WP_000612293.1|943265_944852_-	hypothetical protein	NA	P79669	Escherichia_phage	100.0	2.9e-310
WP_001016257.1|947356_948103_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001251408.1|949032_949551_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|949607_949883_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|949915_950035_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069956.1|950027_952475_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.0	0.0e+00
WP_000978897.1|952489_952969_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_000882954.1|952968_954132_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.8e-205
WP_000468308.1|954213_954432_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|954750_957033_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|957087_957945_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194828.1|958350_960111_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642837.1|960240_960933_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057124.1|961131_962220_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
WP_000445244.1|962290_963574_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
963251:963268	attR	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
WP_001313710.1|963743_964508_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|964680_965364_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|965474_967148_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|967307_967592_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551259.1|970092_971841_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570549.1|971837_972824_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056555.1|972860_974093_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|974144_974327_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011606.1|974323_975070_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436900.1|975223_976117_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|976093_976873_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001331920.1|977008_977794_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|977790_979113_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|979093_979798_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572616.1|979797_984258_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000926021.1|984518_986366_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|986546_987095_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|987121_987769_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|987818_989009_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|989193_990282_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|990883_992284_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 3
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	1175034	1219870	5082025	portal,tail,integrase,terminase,protease,tRNA,lysis,capsid,head	Enterobacteria_phage(54.55%)	63	1165554:1165567	1195324:1195337
1165554:1165567	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1175034_1176141_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1176194_1176656_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1176665_1177319_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1177490_1178741_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1178854_1179997_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1179986_1180223_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1180362_1180602_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1180585_1180912_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1180911_1181133_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1181519_1181711_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1181683_1181866_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1181862_1182543_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1182539_1183325_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1183330_1183627_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1183702_1183846_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1183814_1183979_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1184051_1184420_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1184602_1184803_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1185016_1185598_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1185614_1185887_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1185864_1186047_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1186323_1187076_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1187072_1187630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1187669_1188365_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1188439_1188655_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1188796_1189093_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1189125_1190025_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1190021_1190723_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1190719_1191010_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1191083_1191524_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1191520_1192048_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1192044_1192221_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1192223_1192565_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1192771_1193134_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1193130_1193271_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1193356_1193740_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1193928_1195011_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1195599_1195815_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1195324:1195337	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1195814_1196312_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1196528_1196711_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1196801_1197095_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1197575_1197902_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1198108_1198291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867565.1|1198762_1199311_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_001304453.1|1199282_1201211_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1201194_1201401_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1201397_1202990_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1202979_1204485_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1204521_1204869_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522649.1|1204926_1205955_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000201530.1|1206006_1206381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1206373_1206727_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1206738_1207317_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|1207313_1207709_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001350574.1|1207716_1208457_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1208472_1208895_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459485.1|1208876_1209311_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	89.2	3.4e-56
WP_000840269.1|1209303_1211865_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1211861_1212191_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1212190_1212889_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1212894_1213638_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1213574_1214207_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000290543.1|1217809_1219870_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
>prophage 4
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	1299111	1389242	5082025	portal,tail,integrase,terminase,holin,protease,lysis,transposase,capsid,head	Enterobacteria_phage(32.14%)	100	1292506:1292522	1344927:1344943
1292506:1292522	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1299111_1300311_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1301103_1301946_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1301995_1302454_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1302566_1303472_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1303563_1304577_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1304778_1305687_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1305830_1306244_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1306847_1307465_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1308922_1311598_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1312074_1312722_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000051910.1|1312879_1313041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|1313459_1315091_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1315176_1316097_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1316111_1317020_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1317031_1318045_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1318041_1319046_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1319098_1319428_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1319462_1320923_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1321065_1321239_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|1321293_1322547_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1322846_1323143_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1323366_1324083_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1324122_1324521_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1324626_1325166_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1325195_1325939_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1326294_1326933_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1326978_1328109_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1328086_1328335_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1328399_1330871_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1330963_1331155_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1331151_1331340_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1331740_1331905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1331905_1332127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1332286_1332442_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1332734_1333073_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1333464_1333707_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1333690_1334116_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262377.1|1334187_1335246_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	7.1e-63
WP_001151217.1|1335286_1335709_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_014639476.1|1335900_1336863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1336878_1337880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1338288_1338396_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|1338497_1338653_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|1338820_1339099_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1339100_1340147_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1340159_1340534_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1340530_1341352_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1341576_1341774_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1341924_1342974_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1343764_1343992_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1344260_1344476_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1344480_1344825_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1344790_1345063_-	hypothetical protein	NA	NA	NA	NA	NA
1344927:1344943	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000459345.1|1345862_1346000_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082537.1|1346001_1346466_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1346773_1347184_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1347241_1347475_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1347862_1348411_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622379.1|1348382_1350311_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	9.7e-260
WP_000259002.1|1350294_1350501_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1350497_1352090_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253963.1|1352079_1353585_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000256813.1|1353621_1353969_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522602.1|1354026_1355055_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	2.1e-112
WP_000201495.1|1355106_1355490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1355482_1355836_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1355851_1356385_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1356381_1356777_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1356784_1357537_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|1357550_1357982_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|1358008_1358422_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1358402_1360976_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|1360972_1361302_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152520.1|1361301_1362000_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	9.9e-130
WP_000140762.1|1362004_1362748_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1362684_1363287_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1363360_1363699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515772.1|1363765_1367245_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233195.1|1367312_1367912_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1368063_1371171_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1371170_1371755_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1371809_1372478_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1372534_1372804_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1372918_1373089_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|1373576_1374083_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1374128_1374629_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1374714_1374894_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1375274_1376081_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1376080_1377274_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1377285_1378644_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1378647_1380243_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1380242_1381805_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1381896_1381941_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1382078_1382960_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1382956_1383577_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1383604_1385500_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291203.1|1385712_1386588_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1386627_1387218_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1387214_1387973_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1388192_1389242_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	1461633	1515819	5082025	tail,terminase,tRNA,lysis	Escherichia_phage(48.0%)	62	NA	NA
WP_001350888.1|1461633_1462866_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|1463120_1464104_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1464378_1464552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|1464581_1465955_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157379.1|1466083_1467019_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	1.1e-147
WP_000040829.1|1467070_1468306_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.0	4.2e-240
WP_000079604.1|1468307_1468523_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1468622_1468811_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001317028.1|1468803_1468998_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1469054_1469864_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105155.1|1469856_1472457_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.7	1.6e-249
WP_021542963.1|1472558_1472834_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	93.4	9.8e-41
WP_000245512.1|1472908_1473085_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
WP_000560230.1|1473078_1473300_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001312793.1|1473730_1474219_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000410102.1|1474819_1475239_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1475335_1475578_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702029.1|1475574_1475997_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.3e-68
WP_021568026.1|1476075_1476870_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.5	1.7e-40
WP_000789010.1|1476876_1477623_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450696.1|1477645_1478407_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
WP_001151240.1|1478422_1478839_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.4	3.1e-62
WP_021554705.1|1479023_1479689_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000119355.1|1480291_1480471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818163.1|1480489_1480975_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940343.1|1481482_1482082_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_000228029.1|1482081_1482372_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	1.5e-47
WP_000640127.1|1482368_1482905_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.0	3.0e-70
WP_000839596.1|1484197_1484413_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|1484412_1484910_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228693.1|1485126_1485312_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	69.0	2.0e-13
WP_001097899.1|1485508_1486966_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291096.1|1487103_1487895_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	1.7e-48
WP_001204031.1|1487887_1488820_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_000613571.1|1488755_1489007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000625349.1|1490085_1491387_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
WP_000763705.1|1491389_1492796_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_024165603.1|1492779_1493892_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.0	8.7e-112
WP_000770040.1|1493996_1494761_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
WP_000918489.1|1494859_1495999_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.7	7.4e-159
WP_000908083.1|1496041_1496266_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.7	5.6e-10
WP_000634207.1|1496269_1496665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524258.1|1496664_1497048_+	hypothetical protein	NA	A0A0H5ARS2	Pseudomonas_phage	38.1	5.4e-13
WP_001029814.1|1497048_1497429_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	2.5e-18
WP_000144682.1|1497425_1497818_+	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	31.5	2.3e-11
WP_000094291.1|1497844_1498807_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	3.4e-56
WP_122984268.1|1498957_1499317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|1499424_1499625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840612.1|1499788_1503022_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	8.2e-102
WP_000024053.1|1503014_1503353_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.9	1.1e-28
WP_001152480.1|1503352_1504051_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000194742.1|1504055_1504799_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	5.4e-150
WP_011703559.1|1504696_1505344_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.1e-110
WP_000515283.1|1505404_1508803_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.0	0.0e+00
WP_001228229.1|1508870_1509470_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	89.9	4.1e-100
WP_024179262.1|1509534_1511910_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	70.2	1.8e-170
WP_000654144.1|1511909_1512191_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	7.0e-18
WP_000235972.1|1512200_1512905_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	62.3	4.1e-59
WP_000355611.1|1512915_1513206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358617.1|1513718_1514432_+	cytolethal distending toxin type IV subunit CdtA	NA	A5LH52	Enterobacteria_phage	94.5	8.3e-132
WP_000734594.1|1514428_1515250_+	cytolethal distending toxin type IV nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	95.6	4.3e-148
WP_001220161.1|1515246_1515819_+	cytolethal distending toxin type IV subunit CdtC	NA	A5LH54	Enterobacteria_phage	85.2	1.1e-89
>prophage 6
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2052149	2089423	5082025	portal,tail,integrase,terminase,holin,protease,capsid,head	Escherichia_phage(51.22%)	50	2056317:2056331	2100390:2100404
WP_000654167.1|2052149_2052428_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|2052424_2054485_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000515324.1|2054543_2058026_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
2056317:2056331	attL	CAGGCGCTGGCGCAG	NA	NA	NA	NA
WP_000090917.1|2058086_2058719_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_011703583.1|2058655_2059399_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.3e-143
WP_001152452.1|2059403_2060102_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.6e-132
WP_001115183.1|2060101_2060443_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_024179264.1|2060435_2063675_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.2	0.0e+00
WP_000978930.1|2063721_2064000_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164661.1|2064023_2064395_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097528.1|2064409_2065114_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	2.8e-116
WP_001206698.1|2065173_2065518_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	6.1e-56
WP_000968644.1|2065514_2065964_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2065960_2066299_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2066307_2066625_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|2066701_2067919_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2067933_2068533_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|2068525_2069752_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_000811487.1|2069741_2069903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140907.1|2069899_2071657_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001523362.1|2071656_2072139_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	9.6e-84
WP_001140099.1|2072286_2072637_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001228684.1|2072741_2072927_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.0	2.7e-18
WP_000992094.1|2073143_2073677_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.4e-99
WP_000193274.1|2073740_2074091_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|2074095_2074311_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000342819.1|2075038_2075752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064898.1|2075981_2076671_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	51.1	1.8e-59
WP_000139994.1|2076667_2077033_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_001265122.1|2077033_2078089_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	2.0e-89
WP_001429486.1|2078090_2078369_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_000813254.1|2078827_2078983_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001289997.1|2079274_2079790_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	2.8e-36
WP_000753054.1|2079786_2079963_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	91.4	2.8e-25
WP_001224685.1|2079955_2080138_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	2.6e-26
WP_000403785.1|2080231_2080588_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001090969.1|2080589_2080892_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	86.9	2.7e-23
WP_001151177.1|2080916_2081324_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	8.8e-62
WP_001262369.1|2081364_2082435_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.1e-63
WP_000693846.1|2082506_2082932_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2082928_2083183_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2083262_2083682_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_042046576.1|2084039_2084339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2084410_2084629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021522780.1|2084632_2084797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449185.1|2085196_2085385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090551.1|2085381_2085585_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048594.1|2085664_2088136_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096344.1|2088194_2088398_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533618.1|2088397_2089423_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
2100390:2100404	attR	CTGCGCCAGCGCCTG	NA	NA	NA	NA
>prophage 7
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2196748	2203057	5082025		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100791.1|2196748_2197297_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|2197301_2198180_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|2198237_2199137_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|2199136_2200222_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|2200594_2201488_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115981.1|2201662_2203057_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
>prophage 8
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2257722	2269623	5082025	tail,tRNA	Escherichia_phage(70.0%)	10	NA	NA
WP_000476019.1|2257722_2259084_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_000468309.1|2259356_2259575_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	6.8e-37
WP_000882921.1|2259656_2260820_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_000978873.1|2260819_2261299_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.1	2.1e-83
WP_000069958.1|2261313_2263761_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	97.8	0.0e+00
WP_000785970.1|2263753_2263873_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2263905_2264181_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2264237_2264756_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001016257.1|2265685_2266432_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001285340.1|2269011_2269623_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
>prophage 9
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2272730	2284487	5082025	portal,integrase	Salmonella_phage(33.33%)	15	2259304:2259318	2282559:2282573
2259304:2259318	attL	CATTGACCACATCGA	NA	NA	NA	NA
WP_000038201.1|2272730_2273765_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.7	8.4e-202
WP_001389235.1|2274157_2275141_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001062015.1|2275133_2276417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000382626.1|2276592_2278848_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.1	0.0e+00
WP_000027667.1|2278837_2279113_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113261.1|2279109_2279334_-	TraR/DksA family transcriptional regulator	NA	Q858T6	Yersinia_virus	98.6	1.7e-35
WP_001277947.1|2279336_2279636_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	7.1e-45
WP_000557700.1|2279635_2279860_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_000217684.1|2279923_2280424_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_001005162.1|2280420_2280591_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|2280601_2280877_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001350698.1|2280991_2281291_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_000985260.1|2281406_2282420_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001350699.1|2282854_2283172_-	hypothetical protein	NA	NA	NA	NA	NA
2282559:2282573	attR	CATTGACCACATCGA	NA	NA	NA	NA
WP_000807360.1|2283587_2284487_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 10
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2323092	2331404	5082025		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001332210.1|2323092_2325096_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2325220_2325682_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2325722_2326193_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2326239_2326959_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2326955_2328641_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2328862_2329594_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2329653_2329761_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2329741_2330473_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2330477_2331404_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 11
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2539926	2610311	5082025	portal,tail,integrase,coat,terminase,holin,protease,tRNA,lysis,head	Enterobacteria_phage(73.21%)	85	2556884:2556900	2602428:2602444
WP_001283598.1|2539926_2540739_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2540738_2541752_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2541817_2542954_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2543052_2544048_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2544044_2545223_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2545487_2546708_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2546866_2548873_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2548993_2549272_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|2549305_2549854_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2549853_2550663_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2550662_2551487_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2551490_2552576_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2552610_2553543_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2553708_2554260_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2554579_2555422_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2555423_2555951_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2555947_2556427_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2556423_2556927_-	fimbrial protein	NA	NA	NA	NA	NA
2556884:2556900	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2556943_2557696_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2557715_2560364_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|2561552_2562038_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|2562240_2564385_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2564384_2565695_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2565875_2566160_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2566531_2567872_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2567929_2568685_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2568978_2569911_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2570222_2571380_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000129907.1|2572696_2575642_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_001350929.1|2575742_2576645_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000620145.1|2576707_2576881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|2576877_2577030_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|2577144_2577393_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|2577392_2577929_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_001198454.1|2577977_2578427_-	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|2578435_2579002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|2579198_2579528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868966.1|2579545_2581558_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
WP_000257015.1|2581557_2583009_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|2583019_2583712_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|2583714_2584170_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2584169_2584871_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2584870_2586289_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2586298_2586760_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2586740_2586929_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|2586970_2588224_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_000372589.1|2588242_2589136_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|2589226_2591425_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2591426_2592842_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2592838_2593279_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2593281_2593524_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2593751_2594294_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2594499_2594652_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2594639_2595077_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2595073_2595550_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2595533_2595857_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|2596453_2596972_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|2596968_2597157_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2597153_2597516_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2597512_2597803_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2597802_2598525_-	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|2598517_2598694_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000386646.1|2598686_2599106_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|2599108_2599285_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|2599281_2599692_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001622252.1|2599891_2600206_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	66.7	5.0e-25
WP_000229808.1|2600321_2600528_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|2600600_2601977_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000431320.1|2601973_2602861_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
2602428:2602444	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2602923_2603196_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2603218_2603512_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2603620_2603806_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2603886_2604537_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|2605059_2605359_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|2605367_2605838_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_001183771.1|2606032_2606203_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000031365.1|2606459_2607065_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2607064_2607448_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2607471_2607768_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2607862_2608381_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2608377_2608677_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2608678_2609251_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000002106.1|2609528_2609813_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2609885_2610053_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2610110_2610311_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 12
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2724454	2782198	5082025	tail,integrase,terminase,holin,protease	Escherichia_phage(50.94%)	62	2758241:2758258	2789129:2789146
WP_000489682.1|2724454_2725918_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166454.1|2725938_2726298_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|2726435_2727182_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198327.1|2727231_2728521_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|2728606_2729233_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|2729556_2730594_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|2730593_2731232_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001296288.1|2731403_2733470_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121363.1|2733474_2735016_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000017553.1|2737480_2737633_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|2737650_2737842_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|2738152_2738671_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2738686_2739226_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000604067.1|2739421_2739919_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	67.7	8.8e-48
WP_000403802.1|2739915_2740545_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.6e-113
WP_000256103.1|2740534_2740843_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|2740829_2741234_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_000218907.1|2741540_2744660_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	95.7	0.0e+00
WP_001188254.1|2744855_2745113_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
WP_000127506.1|2745428_2746124_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	99.6	1.6e-127
WP_001260052.1|2746270_2746903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2747001_2747163_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001337645.1|2747194_2747611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248446.1|2747794_2750269_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
WP_000119850.1|2750274_2752077_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	96.8	0.0e+00
WP_001145634.1|2752073_2754587_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	89.5	0.0e+00
WP_000336180.1|2754599_2755139_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
WP_000568027.1|2755138_2755603_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_001018536.1|2755602_2758074_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.0	0.0e+00
WP_000179260.1|2758073_2758679_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
2758241:2758258	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424495.1|2758678_2759002_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_000012377.1|2759052_2759388_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627072.1|2759398_2759836_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	1.8e-73
WP_000268707.1|2759887_2760874_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	98.5	1.2e-184
WP_001048083.1|2760888_2761584_-	hypothetical protein	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
WP_000133160.1|2761586_2761883_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852417.1|2761879_2763559_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	95.9	5.2e-294
WP_000335899.1|2763573_2763780_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000999674.1|2764482_2764863_+	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_000132538.1|2764953_2766429_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	9.9e-297
WP_001090117.1|2766425_2767100_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	2.2e-118
WP_001124396.1|2767096_2767309_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001130062.1|2767326_2767665_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	1.4e-49
WP_000034258.1|2767779_2768310_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	78.8	1.8e-75
WP_000156551.1|2768885_2769203_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	93.0	4.7e-47
WP_000445445.1|2769199_2769679_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	95.4	5.7e-52
WP_001231256.1|2769740_2770085_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	3.7e-61
WP_000843279.1|2770202_2770979_-	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_000168731.1|2770950_2771781_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.7	2.6e-153
WP_001282459.1|2772122_2772353_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836293.1|2772507_2773092_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001198620.1|2773245_2773398_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102255.1|2773400_2773700_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	94.9	2.5e-45
WP_000983425.1|2773696_2774596_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
WP_000026204.1|2774605_2775628_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.6	9.3e-177
WP_000675390.1|2775677_2775926_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|2776083_2776335_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163472.1|2776327_2776978_+	adenine methylase	NA	G9L699	Escherichia_phage	96.8	1.2e-124
WP_001055435.1|2776974_2777634_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_000954556.1|2777636_2778893_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	1.3e-236
WP_000138282.1|2779085_2780663_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_024179268.1|2780731_2782198_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	6.8e-88
2789129:2789146	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 13
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	2866101	2956148	5082025	plate,tail,portal,terminase,holin,protease,tRNA,lysis,transposase,capsid,head	Shigella_phage(42.11%)	92	NA	NA
WP_000083664.1|2866101_2866839_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2866970_2868305_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2868337_2869219_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2869321_2869909_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2869964_2870348_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2870652_2871342_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_001098726.1|2872637_2873057_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2873125_2873824_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|2873855_2876516_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2876629_2877985_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2878030_2878354_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2878350_2879649_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001298859.1|2880734_2882276_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001350770.1|2890824_2893398_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2893527_2894259_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|2894255_2895236_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2895370_2896108_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2896377_2896719_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2896822_2896870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2896968_2898129_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2898171_2899293_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2899303_2900374_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2900583_2900949_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2901097_2901616_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2901605_2902832_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2902847_2903330_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2903406_2903754_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000043335.1|2904595_2905144_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2905162_2905411_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2905547_2906909_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2907075_2907867_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2907887_2909174_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2909228_2909822_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2909944_2910823_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2910908_2912570_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2912718_2913060_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2913121_2913412_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2913401_2913878_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2914009_2914492_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|2915648_2916437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2916524_2916818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2917028_2917802_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_001115587.1|2920997_2921489_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.2	1.1e-45
WP_000356380.1|2921488_2922091_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|2922062_2922506_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000554664.1|2922508_2923252_-	hypothetical protein	NA	U5P0I1	Shigella_phage	85.0	6.7e-60
WP_000539246.1|2923255_2923840_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785327.1|2923830_2924889_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.4	5.8e-198
WP_000424731.1|2924875_2925301_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2925300_2925849_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2925848_2926928_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2926924_2928253_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2928313_2930149_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2930290_2930560_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2930559_2930916_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2930915_2932412_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2932395_2932566_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2932574_2933135_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2933131_2933638_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2933612_2934023_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2934019_2934343_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2934345_2934546_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2934595_2935801_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2935815_2936466_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2936443_2937685_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2937684_2937867_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2937878_2939375_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2939608_2940103_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2940228_2940579_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000092331.1|2941549_2941987_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2941983_2942460_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2942446_2942752_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606309.1|2942903_2943239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2943424_2944177_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2944190_2945180_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2945187_2945985_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2946004_2946394_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2946390_2946717_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001350763.1|2946713_2947367_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	98.6	4.7e-126
WP_001332382.1|2947366_2947861_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2947857_2948799_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2948788_2948968_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2949143_2949695_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2949738_2949939_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2950029_2950704_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2950906_2951419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2951887_2952250_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2952315_2953140_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2953267_2953792_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2953900_2954767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2954808_2955015_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2954975_2956148_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 14
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	3031807	3038947	5082025		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|3031807_3034369_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|3034474_3035131_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|3035181_3035949_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847958.1|3036144_3037053_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_000590420.1|3037049_3038312_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|3038308_3038947_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 15
NC_008563	Escherichia coli APEC O1, complete sequence	5082025	5003640	5052500	5082025	portal,tail,integrase,terminase,holin,protease	Enterobacteria_phage(47.06%)	61	5001263:5001279	5040403:5040419
5001263:5001279	attL	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001218287.1|5003640_5004855_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653747.1|5005230_5006226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206727.1|5006793_5007414_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.1	2.6e-118
WP_001242728.1|5007413_5007776_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|5007766_5008303_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081290.1|5008430_5009255_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|5009320_5009683_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|5010405_5011098_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|5011195_5011456_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|5011448_5012000_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087313.1|5011996_5013148_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000620695.1|5013144_5013369_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	4.8e-38
WP_000061487.1|5013365_5014184_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_000055034.1|5014186_5014675_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
WP_000210132.1|5014674_5015001_+	LexA repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
WP_000767093.1|5014997_5015387_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
WP_016230662.1|5016212_5017202_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|5017215_5017968_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230663.1|5018239_5018329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|5018383_5018596_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|5018896_5019112_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|5019864_5020080_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|5020084_5020636_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|5020583_5020844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|5020957_5021491_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071776.1|5021487_5021985_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5022348_5022561_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|5022571_5022760_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5022907_5023063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5023235_5023409_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|5023704_5023911_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349509.1|5024463_5024955_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934112.1|5024954_5027057_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5027053_5027266_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5027265_5028774_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|5028718_5030746_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|5030832_5031156_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283153.1|5031148_5031424_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677127.1|5031435_5032014_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001079398.1|5032010_5032412_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|5032422_5033166_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|5033226_5033613_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|5033621_5033951_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|5033922_5036988_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|5036987_5037317_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|5037326_5038025_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|5038029_5038773_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|5038670_5039318_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000515501.1|5039378_5042774_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
5040403:5040419	attR	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001233090.1|5042841_5043441_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000741761.1|5043505_5045884_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	75.9	7.4e-185
WP_000654139.1|5045883_5046165_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	3.1e-18
WP_000235978.1|5046174_5046879_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000355601.1|5046889_5047183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086522.1|5047410_5048001_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|5048317_5048551_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001372053.1|5048619_5048733_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5049159_5049408_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5049627_5051214_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5051606_5052212_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5052338_5052500_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NC_009837	Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence	174241	43850	100318	174241	tRNA,integrase,protease,transposase	Enterobacteria_phage(17.65%)	50	91209:91229	103459:103479
WP_000911333.1|43850_44249_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450520.1|44248_44476_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000986968.1|44557_49828_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205749.1|49847_50594_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000704513.1|50652_51513_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139315.1|51615_52176_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|52311_52524_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351576.1|53147_53354_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|53637_53895_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|54126_54201_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001273588.1|54193_54676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774297.1|54668_55526_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001132900.1|56488_56740_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222767.1|56736_57024_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	3.8e-19
WP_171804886.1|57292_58506_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_001080138.1|58774_62908_+|protease	temperature-sensitive protease autotransporter hemagglutinin Tsh	protease	Q9LA54	Enterobacteria_phage	41.6	5.6e-297
WP_001016257.1|63772_64519_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_001298859.1|64533_66075_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000361403.1|66312_67350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128474.1|67334_68900_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|68974_69391_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|69387_69618_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000670960.1|69979_70432_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001017349.1|70463_71996_-	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	5.2e-06
WP_000379710.1|71992_72262_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_000583428.1|72263_73280_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000154003.1|73282_74110_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012006540.1|74093_75332_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	2.8e-26
WP_000545983.1|75871_77005_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|77024_77309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215657.1|77305_77503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282151.1|78086_78476_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_000612591.1|78472_78820_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997962.1|78869_80408_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	1.6e-297
WP_094284489.1|80433_81664_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001038844.1|81929_85427_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.3	2.8e-100
WP_160348040.1|86859_88047_-	MFS transporter	NA	NA	NA	NA	NA
WP_000020503.1|88103_88865_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_000110580.1|88864_89902_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000756335.1|89901_90900_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
91209:91229	attL	GGGGTCCGCTTGGAAAACGGA	NA	NA	NA	NA
WP_000086535.1|91254_91845_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	4.3e-25
WP_012006537.1|92345_92630_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421266.1|92629_92905_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105068.1|93010_93250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|94941_97080_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|97241_97658_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|97654_97885_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000493379.1|98446_98797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796229.1|98840_99530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|99526_100318_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
103459:103479	attR	TCCGTTTTCCAAGCGGACCCC	NA	NA	NA	NA
>prophage 1
NC_009838	Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence	241387	60033	96474	241387	protease,integrase,transposase	Acinetobacter_phage(20.0%)	38	82342:82357	100972:100987
WP_000795947.1|60033_61209_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|61379_61592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|61952_63035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|63201_64701_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|64726_66364_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|66363_67404_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|67489_68128_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|68127_68769_-	TerD family protein	NA	NA	NA	NA	NA
WP_024179285.1|68791_69430_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|69892_70360_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|70377_71586_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|71596_72553_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|72552_73632_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|73633_74407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|74399_75542_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|75551_76610_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254136.1|76934_77516_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|77515_78673_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007448.1|78695_79151_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|79173_80214_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|80262_80841_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|80908_81484_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81912_83154_+	VWA domain-containing protein	NA	NA	NA	NA	NA
82342:82357	attL	CGTGCGCTCGGGCAGG	NA	NA	NA	NA
WP_000077926.1|83716_83998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|84047_84239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|84330_84672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|85044_85437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|86040_86334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|86338_87664_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_001067855.1|87812_88517_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000015696.1|88874_89153_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071533317.1|89178_89364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002310911.1|89360_89699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000841446.1|89602_90793_-	tetracycline efflux MFS transporter Tet(C)	NA	NA	NA	NA	NA
WP_001038045.1|90885_91545_+	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001138073.1|91622_94595_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|94597_95155_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|95460_96474_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
100972:100987	attR	CCTGCCCGAGCGCACG	NA	NA	NA	NA
>prophage 2
NC_009838	Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence	241387	100885	154031	241387	transposase	Escherichia_phage(21.05%)	47	NA	NA
WP_001137772.1|100885_102415_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001137513.1|102682_103918_+|transposase	IS256-like element ISEc58 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
WP_000679427.1|104135_104483_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|104476_105316_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|105443_105944_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|106450_107215_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|107329_108034_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000090707.1|109163_110006_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000351437.1|109992_112116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|112115_113564_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|113604_115161_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000654806.1|115877_116846_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.1	4.4e-176
WP_012006590.1|116825_117164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|117516_117816_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|118380_120207_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
WP_000647571.1|120375_120726_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
WP_000790485.1|120873_121305_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|121549_123031_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|123023_123704_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|123893_125279_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|125306_125660_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|125773_127066_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574029.1|127076_130223_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	8.0e-62
WP_000758228.1|130309_130750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353604.1|130876_133324_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|133364_133562_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|133595_134333_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|134621_135071_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925240.1|135305_137123_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|137128_138019_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|138058_138439_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|138443_139373_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|139427_140108_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|140104_141505_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|141722_142157_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_000193209.1|142534_143353_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426318.1|143349_144555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|144834_146154_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|146176_146344_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|146404_147832_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000465133.1|148046_148562_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|148564_149461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637192.1|149895_150153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024152227.1|151156_151378_+	membrane protein	NA	NA	NA	NA	NA
WP_071782195.1|151576_151954_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001426321.1|152015_152378_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	41.6	4.6e-14
WP_001067855.1|153326_154031_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NC_009838	Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence	241387	229548	237827	241387	transposase	Salmonella_phage(57.14%)	8	NA	NA
WP_077626043.1|229548_230517_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	93.8	1.3e-175
WP_001000406.1|230834_232370_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000609174.1|232419_232767_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|232763_233147_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000070863.1|233369_233546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096327.1|233542_235234_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	2.6e-67
WP_000114859.1|235481_236645_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_001121575.1|237014_237827_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
