The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	129381	138122	2661057		Acinetobacter_phage(50.0%)	8	NA	NA
WP_041353396.1|129381_131145_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	2.4e-63
WP_011633265.1|131336_131933_-	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_011633266.1|132020_132941_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	44.1	3.1e-54
WP_011633267.1|132951_133977_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	49.6	5.4e-84
WP_011633268.1|133973_134576_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	4.8e-72
WP_011633269.1|134702_136202_+	HAMP domain-containing histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	29.6	3.8e-09
WP_011633270.1|136198_136738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011633271.1|136754_138122_+	sigma 54-interacting transcriptional regulator	NA	W8CYM9	Bacillus_phage	35.7	1.5e-09
>prophage 3
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	1069969	1103807	2661057	integrase,transposase	Enterobacteria_phage(33.33%)	32	1101659:1101718	1108694:1108858
WP_011634114.1|1069969_1071952_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_011634115.1|1072174_1074976_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_011634116.1|1075099_1076026_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_110332584.1|1076042_1076828_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011634118.1|1076842_1077871_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011634119.1|1077867_1079049_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_011634120.1|1079055_1080102_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_011634121.1|1080133_1081039_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011634122.1|1081098_1082319_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011634123.1|1082362_1083223_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011634124.1|1083226_1083838_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_011634125.1|1083910_1084666_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_011634126.1|1084682_1084877_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_011634127.1|1084944_1086279_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_011634128.1|1086302_1087064_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_011634129.1|1087161_1087719_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011634130.1|1087721_1088525_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_011634131.1|1088618_1090205_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_041353727.1|1090522_1092187_+	alginate export family protein	NA	NA	NA	NA	NA
WP_011634133.1|1092232_1092568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107818442.1|1095542_1096406_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011634137.1|1096409_1097369_-	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	40.8	4.6e-45
WP_011634138.1|1097365_1097980_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011634139.1|1098089_1098581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143055271.1|1098716_1099067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634140.1|1099144_1099585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110332632.1|1099590_1100079_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011634142.1|1100130_1100280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166484991.1|1100456_1101627_+|transposase	IS3-like element ISNieu3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.1e-60
1101659:1101718	attL	ATTCTGAATCAATGTGCCGTCCATATTTTATACTCCTCAGTCAAGATTGGCGCATTACCA	NA	NA	NA	NA
WP_011634143.1|1101824_1102190_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	54.7	5.0e-24
WP_049753094.1|1102255_1103218_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_082211247.1|1103174_1103807_-|transposase	transposase	transposase	NA	NA	NA	NA
1108694:1108858	attR	TGGTAATGCGCCAATCTTGACTGAGGAGTATAAAATATGGACGGCACATTGATTCAGAATGAAGTTATTCTTGGCGTTGATACCCATTTAGATACACATGTTGGTGTAGTCATTAACCACCAGGGTAAAGTGATAGGTAAACGCACCTACAGAGCGCTTCTTCAG	NA	NA	NA	NA
>prophage 4
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	1107624	1165593	2661057	protease,integrase,transposase	Acinetobacter_phage(11.11%)	53	1160113:1160137	1165637:1165661
WP_082211248.1|1107624_1108587_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.7	1.5e-35
WP_160803634.1|1108877_1109012_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011634151.1|1109326_1112512_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166484994.1|1112513_1113572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753095.1|1113501_1114614_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_011634154.1|1115032_1117417_-	sucrose synthase	NA	NA	NA	NA	NA
WP_011634155.1|1117427_1119566_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011634156.1|1119576_1120506_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011634157.1|1120701_1122801_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011634158.1|1122879_1124073_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011634159.1|1124458_1124731_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041353466.1|1125191_1126547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107818412.1|1126666_1127047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634162.1|1127185_1127878_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_107818415.1|1127926_1128403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041353467.1|1128426_1129809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634165.1|1129863_1130394_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_049753154.1|1130606_1131698_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.6	5.3e-53
WP_011634167.1|1131803_1133024_+	glycosyltransferase, exosortase A system-associated	NA	A0A1V0SL50	Klosneuvirus	23.9	4.5e-29
WP_011634168.1|1133124_1134447_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.8	2.2e-77
WP_011634169.1|1134582_1134765_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_166484995.1|1134934_1135078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041353468.1|1135274_1135529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634171.1|1135633_1136911_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011634172.1|1136922_1138278_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_011634173.1|1138279_1138900_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011634174.1|1139178_1139658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634175.1|1139747_1140905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634176.1|1140956_1141772_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_011634177.1|1141790_1142864_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011634178.1|1142863_1143922_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011634179.1|1143938_1145156_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_107818413.1|1145157_1146141_+	kinase	NA	NA	NA	NA	NA
WP_011634181.1|1146154_1147123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634182.1|1147183_1147831_+	DUF2959 domain-containing protein	NA	NA	NA	NA	NA
WP_110332597.1|1147841_1148297_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_011634184.1|1148789_1151519_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_011634185.1|1151698_1152304_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011634186.1|1152305_1153553_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011634187.1|1153549_1154254_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011634188.1|1154305_1154905_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011634189.1|1154901_1155330_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_082211250.1|1155524_1155680_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	72.0	1.2e-14
WP_011634191.1|1155765_1156224_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.3	6.5e-05
WP_011634192.1|1156365_1156791_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_107818414.1|1157152_1158868_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	29.9	6.0e-19
WP_041353469.1|1158830_1159682_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
1160113:1160137	attL	GTTTTCTACCCGTTTTTTGAAATGT	NA	NA	NA	NA
WP_041353470.1|1160634_1160850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634196.1|1161241_1162792_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_011634197.1|1162788_1163247_-	toprim domain-containing protein	NA	A0A2I7RAI5	Vibrio_phage	34.0	7.9e-11
WP_011634198.1|1163281_1163785_-	PriCT-2 domain-containing protein	NA	NA	NA	NA	NA
WP_011634199.1|1163866_1164103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634200.1|1164411_1165593_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.7	4.3e-85
1165637:1165661	attR	GTTTTCTACCCGTTTTTTGAAATGT	NA	NA	NA	NA
>prophage 5
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	1374504	1439458	2661057	integrase,transposase	Acinetobacter_phage(11.11%)	51	1375997:1376011	1438496:1438510
WP_001138073.1|1374504_1377477_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
1375997:1376011	attL	TGAAGCTGGCCAGCG	NA	NA	NA	NA
WP_011634374.1|1377612_1378872_-	putative Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_110332638.1|1378929_1380034_-	peptide chain release factor 2	NA	G0YKC3	Acinetobacter_phage	44.6	4.1e-05
WP_011634376.1|1380151_1381999_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011634377.1|1382016_1383264_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.2	3.1e-94
WP_011634378.1|1383416_1383893_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_011634379.1|1384411_1384867_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_166484997.1|1384993_1386165_-|transposase	IS3-like element ISNieu3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.1e-60
WP_011634382.1|1386597_1386744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011634385.1|1389485_1389824_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011634386.1|1390964_1392056_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	1.3e-32
WP_011634387.1|1392052_1392955_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011634388.1|1392974_1393760_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041353757.1|1393777_1394866_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011634390.1|1394870_1395179_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_011634391.1|1395498_1396302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634392.1|1396303_1397752_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SF91	Hokovirus	29.9	6.6e-35
WP_011634393.1|1397755_1400218_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011634394.1|1400279_1404041_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.0	1.2e-51
WP_011634395.1|1404047_1404527_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011634396.1|1404557_1405667_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	47.4	4.8e-78
WP_011634397.1|1405811_1407467_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	28.7	8.9e-12
WP_011634398.1|1407614_1408193_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_011634399.1|1408205_1409360_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011634400.1|1409356_1410028_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	5.9e-31
WP_011634401.1|1410024_1411227_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011634402.1|1411232_1412432_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041353488.1|1412441_1412966_-	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_041353489.1|1413564_1414407_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	35.8	1.7e-19
WP_011634405.1|1414409_1415123_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_041353490.1|1415308_1415557_+	metal-binding protein	NA	NA	NA	NA	NA
WP_011634406.1|1415532_1416159_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	37.7	2.3e-16
WP_041353491.1|1416288_1416879_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_011634408.1|1416896_1417277_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011634410.1|1418333_1418942_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_049753158.1|1419916_1423447_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_011634412.1|1423462_1427149_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.5	1.1e-09
WP_011634413.1|1427145_1429188_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.1	3.8e-20
WP_011634414.1|1429206_1430511_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_011634415.1|1430533_1430962_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_041353760.1|1430961_1431207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634417.1|1431291_1432629_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	21.3	2.0e-09
WP_011634418.1|1432625_1433312_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011634419.1|1433380_1433671_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041353492.1|1433756_1434116_-	DUF3824 domain-containing protein	NA	NA	NA	NA	NA
WP_041353761.1|1434413_1434959_+	DUF924 domain-containing protein	NA	NA	NA	NA	NA
WP_011634422.1|1435094_1436084_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.8e-68
WP_011634423.1|1436209_1437010_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	40.6	2.9e-32
WP_011634424.1|1437086_1437584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634425.1|1437607_1438108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166484998.1|1438230_1439458_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	78.1	2.6e-125
1438496:1438510	attR	TGAAGCTGGCCAGCG	NA	NA	NA	NA
>prophage 6
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	1500514	1595675	2661057	tail,protease,terminase,tRNA,transposase,integrase,head,holin,capsid,portal	Pseudomonas_phage(16.67%)	105	1532788:1532832	1569828:1569872
WP_166485000.1|1500514_1501313_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_110332563.1|1501381_1501633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166485029.1|1501730_1502852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634477.1|1502851_1505806_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_160803492.1|1505876_1506047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634478.1|1506284_1506701_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011634479.1|1506701_1507775_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011634480.1|1507789_1508284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634481.1|1508303_1510910_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.8	2.2e-182
WP_011634482.1|1511064_1512105_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011634483.1|1512101_1513187_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	2.5e-87
WP_011634484.1|1513251_1513716_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.4	3.0e-10
WP_011634485.1|1513802_1515650_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011634486.1|1515674_1516607_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	2.6e-45
WP_011634487.1|1516646_1517024_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_110332562.1|1517073_1517808_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011634489.1|1517860_1518829_-	agmatinase	NA	NA	NA	NA	NA
WP_011634490.1|1518992_1519475_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011634491.1|1519516_1522324_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.0	3.3e-75
WP_011634492.1|1522325_1523303_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	32.6	9.6e-06
WP_011634493.1|1523414_1523846_-	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_082211280.1|1523977_1526257_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011634495.1|1526266_1527244_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011634496.1|1527375_1529031_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_011634497.1|1529079_1530024_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	29.1	8.4e-23
WP_041353774.1|1530035_1530332_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011634499.1|1530419_1531283_+	DUF2914 domain-containing protein	NA	NA	NA	NA	NA
WP_011634500.1|1531299_1531839_+	NUDIX hydrolase	NA	NA	NA	NA	NA
1532788:1532832	attL	TGGCTCCCCGACCTGGGCTCGAACCAGGGACCTGCGGATTAACAG	NA	NA	NA	NA
WP_011634501.1|1533356_1533842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634502.1|1533831_1534089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634503.1|1534091_1534583_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	51.6	2.6e-36
WP_011634504.1|1534582_1534903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110332561.1|1534899_1535226_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011634506.1|1535484_1536420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485001.1|1536429_1538910_-	hypothetical protein	NA	A0A0S0N6L2	Pseudomonas_phage	39.4	6.6e-168
WP_041353775.1|1539199_1539382_-	hypothetical protein	NA	L7P837	Pseudomonas_phage	58.8	5.9e-10
WP_011634509.1|1539399_1539627_-	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	69.7	7.6e-23
WP_041353501.1|1539634_1540405_-	phage BR0599 family protein	NA	A0A0K1LLK5	Rhodobacter_phage	50.8	5.3e-68
WP_011634511.1|1540401_1541571_-	hypothetical protein	NA	A0A0K1LM02	Rhodobacter_phage	33.7	4.5e-18
WP_166485002.1|1541563_1543936_-|tail	phage tail length tape measure family protein	tail	A0A172PZU6	Pseudomonas_phage	34.9	7.7e-17
WP_041353502.1|1543935_1544211_-	hypothetical protein	NA	A0A1J0GUY0	Halomonas_phage	50.0	2.7e-22
WP_011634514.1|1544222_1544573_-|tail	phage tail assembly chaperone family protein, TAC	tail	Q9MCA4	Pseudomonas_phage	62.9	2.3e-34
WP_011634515.1|1544581_1545298_-|tail	tail protein	tail	A0A286S1Q8	Klebsiella_phage	40.3	3.0e-41
WP_011634516.1|1545303_1545666_-	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	54.2	8.4e-32
WP_011634517.1|1545662_1546196_-	phage protein	NA	A0A1J0GUY2	Halomonas_phage	42.1	6.4e-28
WP_011634518.1|1546195_1546531_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	46.6	4.6e-16
WP_011634519.1|1546532_1547090_-	hypothetical protein	NA	H9YSG3	environmental_Halophage	27.4	5.8e-08
WP_011634520.1|1547146_1547446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634521.1|1547455_1548682_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	40.8	9.4e-75
WP_110332564.1|1548763_1549486_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	63.0	9.1e-62
WP_011634523.1|1549460_1550753_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	41.7	1.3e-90
WP_110332557.1|1550749_1552459_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	41.3	1.6e-117
WP_011634525.1|1552427_1552892_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	32.6	3.0e-10
WP_041353779.1|1553023_1553347_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	58.6	7.5e-32
WP_041353504.1|1553433_1553814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041353505.1|1553815_1554001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041353506.1|1553997_1554177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634529.1|1554169_1554409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753110.1|1554717_1557051_-	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	39.6	1.5e-76
WP_011634531.1|1557116_1557434_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011634532.1|1557440_1557719_+	XRE family transcriptional regulator	NA	A0A1I9L2L2	Xanthomonas_phage	42.9	7.2e-07
WP_011634533.1|1557840_1558146_-	hypothetical protein	NA	Q37905	Pseudomonas_phage	46.7	1.9e-13
WP_011634534.1|1558142_1558394_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082211281.1|1558750_1559485_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041353781.1|1559579_1560542_+	SppA protein	NA	NA	NA	NA	NA
WP_011634537.1|1560735_1561140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146208360.1|1561139_1561685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634539.1|1561689_1562100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166485003.1|1562507_1562936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041353508.1|1563168_1563501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634542.1|1563941_1564436_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.7	5.7e-07
WP_011634543.1|1565058_1565958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485004.1|1566175_1566349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166485005.1|1566345_1566501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634544.1|1566497_1566782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146208358.1|1566751_1567261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634546.1|1567275_1567638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634547.1|1567647_1568031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041353510.1|1568014_1568230_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_011634548.1|1568226_1568727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011634549.1|1568729_1569755_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.2	2.1e-96
WP_041353511.1|1570111_1570378_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
1569828:1569872	attR	TGGCTCCCCGACCTGGGCTCGAACCAGGGACCTGCGGATTAACAG	NA	NA	NA	NA
WP_011634551.1|1570367_1571261_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011634552.1|1571323_1573168_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011634553.1|1573283_1574087_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011634554.1|1574253_1574874_+	YqhA family protein	NA	K4K6D8	Caulobacter_phage	26.9	1.0e-13
WP_011634555.1|1574902_1575643_-	pteridine reductase	NA	M1NMS3	Moumouvirus	28.8	7.3e-06
WP_011634556.1|1575715_1576891_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011634557.1|1576887_1577631_-	purine phosphorylase	NA	NA	NA	NA	NA
WP_011634558.1|1577627_1579640_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_041353783.1|1579774_1580545_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011634560.1|1580779_1581388_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011634561.1|1581687_1583034_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	26.7	5.3e-31
WP_011634562.1|1583098_1583479_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011634563.1|1583539_1584724_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011634564.1|1584733_1585222_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_041353513.1|1585504_1585894_+	RidA family protein	NA	NA	NA	NA	NA
WP_011634566.1|1586060_1586408_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_011634567.1|1586462_1587137_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.2e-26
WP_011634568.1|1587133_1589683_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011634569.1|1589682_1590753_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011634570.1|1590832_1591075_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_011634571.1|1591566_1592391_+	methane monooxygenase/ammonia monooxygenase subunit C	NA	NA	NA	NA	NA
WP_011634572.1|1592715_1593645_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_049753111.1|1594685_1595675_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	1893166	1958743	2661057	transposase,tRNA	Burkholderia_virus(37.5%)	56	NA	NA
WP_011634829.1|1893166_1894498_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011634830.1|1894790_1895495_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_011634831.1|1895497_1896205_-	cytochrome c family protein	NA	NA	NA	NA	NA
WP_011634832.1|1896266_1897388_-	hydroxylamine oxidation protein HaoB	NA	NA	NA	NA	NA
WP_011634833.1|1897384_1899097_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_011634834.1|1899316_1903531_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.2e-70
WP_011634835.1|1903687_1907767_-	DNA-directed RNA polymerase subunit beta	NA	A0A146JCU1	Tokyovirus	31.7	4.4e-20
WP_011634836.1|1908132_1908498_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_011634837.1|1908583_1909099_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_011634838.1|1909465_1910161_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_011634839.1|1910162_1910594_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_011634840.1|1910710_1911244_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_011634841.1|1911262_1911607_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_011634842.1|1911850_1913041_-	elongation factor Tu	NA	A0A142CJQ8	Brazilian_marseillevirus	26.1	2.1e-18
WP_110332630.1|1913588_1915748_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011634844.1|1915747_1916275_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011634845.1|1916271_1916922_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011634846.1|1916918_1917530_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_041353813.1|1917526_1918633_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011634848.1|1918809_1921122_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011634849.1|1921409_1922330_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.3	1.7e-44
WP_011634850.1|1922466_1922688_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_041353537.1|1922876_1923167_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	50.0	1.0e-11
WP_082211262.1|1925140_1925401_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011634854.1|1925545_1925827_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011634855.1|1925810_1926056_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_177165378.1|1926326_1926464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041353539.1|1926471_1927374_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_166484999.1|1927408_1928637_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	78.4	3.1e-126
WP_146208375.1|1928739_1928928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110332640.1|1929187_1929541_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_110332639.1|1929572_1929791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634860.1|1930060_1930348_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011634861.1|1930531_1932007_-	flagellin	NA	NA	NA	NA	NA
WP_166485011.1|1932493_1933722_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	78.4	1.8e-126
WP_166484974.1|1933833_1933977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485012.1|1933966_1934629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011634865.1|1935508_1937335_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.6	3.9e-85
WP_041353815.1|1937504_1938164_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_041353816.1|1938369_1939077_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011634868.1|1939102_1940638_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_166485013.1|1940646_1941081_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_110332624.1|1941126_1944555_-	pilus assembly protein PilY	NA	NA	NA	NA	NA
WP_011634871.1|1944569_1945421_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_011634872.1|1945446_1946511_-	PilW family protein	NA	NA	NA	NA	NA
WP_110332623.1|1946528_1947011_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_011634874.1|1947000_1947558_-	Tfp pilus assembly protein FimT/FimU	NA	NA	NA	NA	NA
WP_011634876.1|1947986_1948619_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011634877.1|1948670_1950167_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011634878.1|1950832_1952380_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011634879.1|1952522_1952930_-	pilin	NA	NA	NA	NA	NA
WP_011634880.1|1953057_1954830_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_049753120.1|1955144_1956107_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_011634882.1|1956164_1956674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166484975.1|1956947_1957740_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082211263.1|1957780_1958743_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	2105965	2163317	2661057	tRNA,protease,transposase	uncultured_Mediterranean_phage(15.38%)	60	NA	NA
WP_049753120.1|2105965_2106928_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_166485000.1|2106969_2107767_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011635016.1|2107909_2110039_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_074685632.1|2110043_2110241_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_011635017.1|2110377_2111403_-	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	50.6	1.4e-79
WP_011635018.1|2111548_2111830_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_041353558.1|2111911_2112106_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	66.1	2.9e-15
WP_041353831.1|2112760_2113054_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_011635021.1|2113043_2113325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160803637.1|2113494_2113671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485016.1|2113667_2114896_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	77.7	7.6e-125
WP_011635023.1|2114879_2116862_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	34.0	2.4e-32
WP_011635024.1|2117484_2119068_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_011635025.1|2119317_2120238_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_011635026.1|2120262_2120472_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011635027.1|2120535_2121915_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.6	3.6e-51
WP_011635028.1|2121951_2123559_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	33.2	4.2e-75
WP_011635029.1|2123714_2125229_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011635030.1|2125308_2126454_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_110332570.1|2126467_2127232_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	1.4e-39
WP_011635032.1|2127228_2128452_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_166485017.1|2128492_2128663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041353560.1|2128740_2128926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011635033.1|2128967_2130425_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011635034.1|2130421_2130832_+	ATPase	NA	NA	NA	NA	NA
WP_011635035.1|2130828_2131110_+	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_166485018.1|2131155_2131449_+	ATP synthase subunit AtpR	NA	NA	NA	NA	NA
WP_011635037.1|2131470_2132163_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011635038.1|2132165_2132444_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011635039.1|2132450_2133221_+	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_011635040.1|2133233_2134784_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_041353561.1|2134788_2135658_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_049753164.1|2136448_2139037_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.2	9.3e-32
WP_011635043.1|2139071_2139551_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_049753165.1|2139706_2140321_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	43.0	4.9e-24
WP_176752573.1|2140344_2140779_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011635046.1|2140820_2141384_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_011635047.1|2141409_2143686_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011635048.1|2143688_2145056_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011635049.1|2145074_2146316_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011635050.1|2146312_2147140_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011635051.1|2147174_2147966_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.8	2.6e-17
WP_011635052.1|2147969_2148527_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011635053.1|2148627_2149341_-	UMP kinase	NA	NA	NA	NA	NA
WP_160803517.1|2149397_2149541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011635054.1|2149891_2150776_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011635055.1|2150848_2151604_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011635056.1|2151818_2152547_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_107818360.1|2152608_2152899_-	cytochrome c	NA	NA	NA	NA	NA
WP_166485019.1|2153157_2155236_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041353562.1|2155343_2155559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164502684.1|2156012_2156867_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011635060.1|2156989_2157622_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011635061.1|2157614_2158280_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011635062.1|2158355_2159558_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011635063.1|2159557_2160403_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_011635064.1|2160368_2161019_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.4	4.0e-24
WP_011635065.1|2161042_2162290_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011635066.1|2162428_2162632_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.3	8.9e-23
WP_011635067.1|2163005_2163317_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.2	2.0e-10
>prophage 9
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	2268953	2328602	2661057	transposase,tRNA	Acinetobacter_phage(25.0%)	54	NA	NA
WP_011635159.1|2268953_2269418_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_011635160.1|2269504_2270035_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_011635161.1|2270220_2271057_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_110332545.1|2271367_2272858_-	glucose-6-phosphate dehydrogenase	NA	M1UG55	Synechococcus_phage	38.4	3.9e-83
WP_011635163.1|2272861_2273770_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	41.5	6.1e-63
WP_041353571.1|2273839_2274922_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_011635165.1|2275039_2275339_-	YggU family protein	NA	NA	NA	NA	NA
WP_011635166.1|2275338_2275899_-	YggT family protein	NA	NA	NA	NA	NA
WP_011635167.1|2275971_2276784_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_041353849.1|2276863_2277070_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_011635169.1|2277088_2277553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011635170.1|2277889_2278024_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_011635171.1|2278060_2278426_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_011635172.1|2278422_2278632_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	2.1e-19
WP_011635173.1|2278722_2280591_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_041353850.1|2280661_2282017_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_011635175.1|2282243_2282513_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_011635176.1|2282691_2284809_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_082211270.1|2285224_2286772_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011635178.1|2286860_2288066_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011635179.1|2288083_2291278_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011635180.1|2291546_2291888_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011635181.1|2291916_2292657_-	ATPase	NA	NA	NA	NA	NA
WP_011635183.1|2293322_2294729_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011635184.1|2294780_2296010_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011635185.1|2296012_2296651_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011635186.1|2296673_2297939_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011635187.1|2297931_2299176_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_110332548.1|2299209_2300247_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011635189.1|2300275_2301067_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011635190.1|2301112_2302252_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011635191.1|2302289_2302715_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.6	3.0e-20
WP_011635192.1|2303012_2303429_-	nitrosocyanin	NA	NA	NA	NA	NA
WP_011635193.1|2303879_2305268_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	31.2	2.6e-25
WP_011635194.1|2305279_2305984_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	48.6	1.7e-41
WP_011635195.1|2305995_2306484_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	47.3	2.9e-35
WP_074456220.1|2306543_2307278_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011635197.1|2307337_2308105_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011635198.1|2308408_2308981_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011635199.1|2309087_2310005_-	zinc finger, SWIM-type	NA	NA	NA	NA	NA
WP_011635200.1|2310008_2312702_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.7	1.2e-45
WP_011635201.1|2313528_2314650_+	alkene reductase	NA	NA	NA	NA	NA
WP_041353855.1|2315274_2316843_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_011635204.1|2316878_2317718_+	cation transporter	NA	NA	NA	NA	NA
WP_011635206.1|2319469_2320414_+	agmatinase	NA	NA	NA	NA	NA
WP_011635207.1|2320425_2322384_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_049753125.1|2322375_2322879_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.8	3.6e-17
WP_011635209.1|2322898_2323192_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	35.1	2.5e-10
WP_011635210.1|2323253_2323715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082211272.1|2323832_2324084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041353574.1|2324031_2324895_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	5.6e-58
WP_166485020.1|2325085_2326256_+|transposase	IS3-like element ISNieu3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.1e-60
WP_049753126.1|2326505_2327354_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_049753120.1|2327639_2328602_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	2481557	2528071	2661057	tRNA,transposase	Enterobacteria_phage(20.0%)	48	NA	NA
WP_166485000.1|2481557_2482356_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011635347.1|2482879_2483221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011635348.1|2483525_2484089_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_041353880.1|2484225_2484765_+	CNP1-like family protein	NA	NA	NA	NA	NA
WP_110332611.1|2484792_2485560_-	slipin family protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	29.7	1.5e-22
WP_041353882.1|2485573_2486836_-	nodulation protein NfeD	NA	NA	NA	NA	NA
WP_049753132.1|2487011_2487614_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	32.0	1.7e-16
WP_011635353.1|2487797_2488712_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_041353587.1|2488805_2489672_+	YicC family protein	NA	NA	NA	NA	NA
WP_041353588.1|2489765_2490848_-	tellurite resistance/C4-dicarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_110332610.1|2491111_2491825_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_011635357.1|2491851_2492850_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011635358.1|2493014_2493323_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011635359.1|2493388_2494888_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011635360.1|2494906_2496304_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	51.7	7.3e-116
WP_011635361.1|2496409_2496865_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_011635362.1|2496883_2497162_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011635363.1|2497203_2497512_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_011635364.1|2497513_2497948_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_160803593.1|2498543_2498702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011635366.1|2499221_2500109_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011635367.1|2500171_2500651_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011635368.1|2500679_2501045_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	3.7e-11
WP_041353589.1|2501303_2501891_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_110332609.1|2501930_2503298_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011635371.1|2503391_2504288_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011635372.1|2504378_2504960_-	membrane protein	NA	NA	NA	NA	NA
WP_011635373.1|2504934_2505654_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_011635374.1|2505746_2506592_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_074456128.1|2506783_2507314_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011635376.1|2507436_2509014_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011635377.1|2509073_2509916_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011635378.1|2511339_2511558_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011635379.1|2511681_2512650_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_041353590.1|2512618_2513998_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	22.0	8.0e-06
WP_011635381.1|2514001_2515063_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.5	9.2e-87
WP_041353591.1|2515059_2515956_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	31.1	8.2e-28
WP_011635383.1|2515965_2516919_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_011635384.1|2516946_2517609_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	32.6	8.5e-06
WP_041353592.1|2517820_2518657_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_011635386.1|2518945_2520133_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.9	2.8e-92
WP_166485000.1|2520143_2520941_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011635387.1|2521098_2521974_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011634897.1|2522127_2523090_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_041353593.1|2523830_2524055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011635390.1|2524051_2524375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041353595.1|2526665_2527715_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	24.1	6.1e-06
WP_166485033.1|2527825_2528071_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_008344	Nitrosomonas eutropha C91, complete sequence	2661057	2550773	2630824	2661057	transposase,tRNA	Planktothrix_phage(10.53%)	57	NA	NA
WP_011635411.1|2550773_2552699_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_011635412.1|2553080_2553545_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_011635413.1|2553546_2553849_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_011635414.1|2554128_2555622_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011635415.1|2555618_2557676_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.5e-21
WP_011635416.1|2557672_2559280_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.9	9.3e-14
WP_011635417.1|2559531_2560662_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_011635418.1|2560709_2562794_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_011635419.1|2562790_2564062_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_011635420.1|2564054_2564948_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011635421.1|2564956_2565667_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_193330458.1|2566368_2567319_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	22.7	1.3e-07
WP_041353597.1|2567502_2567868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485011.1|2567986_2569215_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	78.4	1.8e-126
WP_011635424.1|2569612_2570176_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011635425.1|2570219_2571125_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_011635426.1|2571267_2574111_+	aconitate hydratase	NA	NA	NA	NA	NA
WP_011635427.1|2574231_2575503_-	glycerate kinase	NA	NA	NA	NA	NA
WP_011635428.1|2575499_2578337_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.5	5.5e-296
WP_041353888.1|2578459_2579818_+	MFS transporter	NA	NA	NA	NA	NA
WP_011635430.1|2579818_2580286_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	57.0	1.2e-43
WP_011635431.1|2580488_2582279_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.1	3.8e-32
WP_011635432.1|2582279_2583212_+	cytochrome c	NA	NA	NA	NA	NA
WP_011635433.1|2583257_2584217_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_011635434.1|2584216_2584624_-	adenosylmethionine decarboxylase	NA	A0A1D7SGA8	Cyanophage	36.3	8.3e-12
WP_011635435.1|2585017_2588458_-	acyl-[ACP]--phospholipid O-acyltransferase	NA	A0A2H4PQM9	Staphylococcus_phage	22.4	1.0e-17
WP_011635436.1|2588704_2591578_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.0	2.0e-176
WP_011635437.1|2591629_2592763_+	ribonucleotide-diphosphate reductase subunit beta	NA	E5ER80	Bathycoccus_sp._RCC1105_virus	27.7	9.1e-32
WP_011635438.1|2592910_2594275_+	transglycosylase SLT domain-containing protein	NA	A0A172JIA8	Bacillus_phage	31.7	4.5e-09
WP_011635439.1|2594262_2597883_-	urea carboxylase	NA	NA	NA	NA	NA
WP_011635441.1|2598828_2600367_+	amino acid permease	NA	NA	NA	NA	NA
WP_011635442.1|2600381_2601110_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_011635443.1|2601106_2601772_+	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_110332592.1|2601813_2604159_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_011635445.1|2604290_2604734_+	universal stress protein	NA	NA	NA	NA	NA
WP_011635446.1|2604804_2605878_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011635447.1|2606449_2606776_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.7	2.1e-18
WP_011635448.1|2606989_2608249_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_041353600.1|2608422_2608635_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011635449.1|2609128_2609410_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_011635450.1|2609406_2610693_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	1.2e-144
WP_011635451.1|2610981_2612676_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.6	8.2e-154
WP_011635452.1|2612857_2613250_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011635453.1|2613243_2613597_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011635454.1|2613598_2615362_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011635455.1|2615439_2616414_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011635456.1|2616630_2618937_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	49.3	1.2e-83
WP_011635457.1|2618996_2619617_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011635458.1|2619609_2620926_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_011635459.1|2620953_2621628_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.2	3.3e-37
WP_011635460.1|2621620_2622868_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_166485024.1|2623006_2624029_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_166484975.1|2624980_2625772_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049753139.1|2625841_2626804_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_166484975.1|2626844_2627636_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041353602.1|2627840_2629598_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166485011.1|2629596_2630824_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	78.4	1.8e-126
>prophage 1
NC_008341	Nitrosomonas eutropha C91 plasmid p1, complete sequence	65132	0	17703	65132	integrase,transposase	Leptospira_phage(20.0%)	13	NA	NA
WP_011630618.1|221_3155_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_110332622.1|3242_3728_-	endonuclease	NA	NA	NA	NA	NA
WP_041353898.1|3788_4688_-	hypothetical protein	NA	S5W9D9	Leptospira_phage	30.4	5.3e-27
WP_110332621.1|4731_5538_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_011630622.1|5944_6559_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	44.8	1.9e-36
WP_011630623.1|6944_8207_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_011630624.1|8302_8761_-	conjugal transfer TrbH family protein	NA	NA	NA	NA	NA
WP_011630625.1|8757_9339_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_011630626.1|9522_10083_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	43.1	2.3e-28
WP_011630627.1|10066_11722_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011630628.1|11711_12680_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011630629.1|12799_15715_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	33.8	4.1e-36
WP_011630630.1|15714_17703_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	31.1	1.4e-40
>prophage 2
NC_008341	Nitrosomonas eutropha C91 plasmid p1, complete sequence	65132	31685	47874	65132	transposase	Salmonella_phage(25.0%)	16	NA	NA
WP_011630644.1|31685_32075_+	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	33.9	9.4e-13
WP_082211282.1|32149_36892_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	29.5	2.5e-35
WP_001138073.1|36867_39840_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|39842_40400_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|40529_40742_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|40807_41044_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|41040_41406_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003055149.1|41423_43106_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.5e-38
WP_000522993.1|43144_43552_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|43579_43855_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|43870_44221_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|44292_44748_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011630646.1|44754_45192_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011630647.1|45439_46072_-	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	40.0	6.2e-38
WP_041353902.1|46140_46572_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	47.2	6.3e-26
WP_011630649.1|46578_47874_+	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	41.8	3.0e-87
>prophage 3
NC_008341	Nitrosomonas eutropha C91 plasmid p1, complete sequence	65132	56414	59557	65132		Vibrio_phage(50.0%)	2	NA	NA
WP_107818387.1|56414_58736_+	toprim domain-containing protein	NA	A0A2I7R3N6	Vibrio_phage	29.2	4.6e-14
WP_011630658.1|58939_59557_+	AAA family ATPase	NA	A2I303	Vibrio_virus	31.2	1.3e-13
