The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	101734	179882	2936195	transposase,protease,tRNA	Pseudomonas_phage(22.22%)	56	NA	NA
WP_011639562.1|101734_103099_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1I2W1	Paramecium_bursaria_Chlorella_virus	28.1	3.0e-13
WP_011639563.1|103564_105364_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	47.6	1.2e-110
WP_011639564.1|105538_106063_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011639565.1|106251_107490_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.7	6.9e-25
WP_041427633.1|107494_107854_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011639567.1|107908_108403_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011639568.1|108525_109422_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_011639569.1|109518_110349_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_011639570.1|110510_111359_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011639571.1|111362_111719_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011639572.1|111758_112670_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_011639573.1|112790_114392_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_011639574.1|114915_115746_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_011639575.1|115821_116418_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_011639576.1|116518_117286_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_049750143.1|117362_118358_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_011639578.1|118747_119278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011639579.1|119530_120445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011639580.1|120437_121346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011639581.1|121570_122050_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011639582.1|122439_123921_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	39.0	8.6e-99
WP_011639583.1|124104_125559_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	50.5	1.6e-129
WP_011639584.1|125690_125984_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041427637.1|125976_126234_+	DNA helicase	NA	NA	NA	NA	NA
WP_011639586.1|126512_127499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011639587.1|127488_129531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011639588.1|129670_131161_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_011639589.1|131268_132339_-	polysaccharide pyruvyl transferase CsaB	NA	NA	NA	NA	NA
WP_041427238.1|132591_133671_+	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_011639591.1|133864_135007_+	LCP family protein	NA	NA	NA	NA	NA
WP_011639592.1|135119_137843_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	38.8	2.6e-24
WP_011639593.1|138175_140713_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011639594.1|140786_142694_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.9	2.4e-29
WP_041427643.1|142719_143157_-	small multi-drug export protein	NA	NA	NA	NA	NA
WP_011639596.1|143769_147465_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011639597.1|147518_148562_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_041427239.1|148551_149133_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041427240.1|149586_152025_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_162010591.1|152195_153335_+	TolC family protein	NA	NA	NA	NA	NA
WP_011639601.1|153786_154245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049750068.1|154228_154423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041427242.1|154519_155278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041427243.1|155402_155618_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011639604.1|156220_157441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011639605.1|157625_159902_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011639606.1|159999_161118_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011639607.1|161867_164144_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_011639608.1|164191_164581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011639609.1|164859_168912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010592.1|169440_170094_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_011639611.1|170636_171968_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	2.1e-32
WP_041427246.1|172666_173425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011639615.1|174686_174998_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_041427248.1|174987_175320_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155814252.1|175573_176590_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011639620.1|178655_179882_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.7	1.2e-53
>prophage 2
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	707471	717204	2936195		Acanthocystis_turfacea_Chlorella_virus(28.57%)	9	NA	NA
WP_011640049.1|707471_708203_+	SigB/SigF/SigG family RNA polymerase sigma factor	NA	A0A0A0RV91	Bacillus_phage	42.3	1.8e-41
WP_011640050.1|708423_709023_-	DUF4489 domain-containing protein	NA	NA	NA	NA	NA
WP_011640051.1|709468_710821_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011640052.1|710867_711854_+	NAD-dependent epimerase/dehydratase family protein	NA	M1I3H4	Acanthocystis_turfacea_Chlorella_virus	26.9	2.1e-24
WP_011640053.1|711869_712796_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	59.1	3.8e-105
WP_011640054.1|713061_713280_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5KMI2	ANMV-1_virus	55.8	9.2e-10
WP_011640055.1|713276_713507_+	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	51.8	1.9e-05
WP_011640056.1|713597_714560_+	transferase	NA	R4TPX3	Phaeocystis_globosa_virus	27.7	2.7e-16
WP_011640057.1|714591_717204_-	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	31.9	3.1e-91
>prophage 3
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	783601	842440	2936195	transposase,integrase,tRNA	Klosneuvirus(16.67%)	53	825163:825180	849714:849731
WP_041427351.1|783601_784918_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011640116.1|784886_785807_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011640117.1|786233_787751_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011640118.1|787773_788946_+	radical SAM protein	NA	NA	NA	NA	NA
WP_011640119.1|789371_790352_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011640120.1|790482_791484_+	putative heme d1 biosynthesis radical SAM protein NirJ2	NA	NA	NA	NA	NA
WP_011640121.1|791489_791960_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011640122.1|791949_792420_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011640123.1|792492_793788_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011640124.1|793872_794652_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_041427355.1|794909_795662_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011640126.1|795701_796655_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011640127.1|796757_798902_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_155814120.1|799310_799814_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.1	2.3e-27
WP_011640129.1|800082_800499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011640130.1|800927_801458_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_041427358.1|801525_801876_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_011640132.1|801949_803134_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	33.0	5.5e-40
WP_011640133.1|803413_803998_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011640134.1|804077_805394_+	nucleotide sugar dehydrogenase	NA	M1HKZ1	Paramecium_bursaria_Chlorella_virus	29.3	6.8e-39
WP_011640135.1|805411_806407_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011640136.1|806667_807639_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	32.6	3.6e-37
WP_011640137.1|807870_808959_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011640138.1|809115_810336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011640139.1|810556_811570_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	35.1	6.4e-37
WP_011640140.1|811562_812729_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.5	9.1e-19
WP_011640141.1|812731_814612_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	28.2	9.8e-31
WP_155814121.1|814625_814787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081424771.1|814837_815617_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041427360.1|815734_816778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011640144.1|816822_817788_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011640145.1|817769_818654_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_011640146.1|818644_819526_+|tRNA	methionyl-tRNA formyltransferase-like protein	tRNA	NA	NA	NA	NA
WP_011639746.1|819453_821100_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162010596.1|821209_821440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010597.1|821522_821669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011640148.1|821904_823125_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011640149.1|823324_824890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011640150.1|825112_826405_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
825163:825180	attL	AAGCTTAAGATATTTATT	NA	NA	NA	NA
WP_011640151.1|826414_827707_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_011640152.1|827791_829069_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011640153.1|829675_830824_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011640154.1|830871_831885_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.2	2.3e-34
WP_155814123.1|831922_832795_+	sugar nucleotide-binding protein	NA	A0A167RG57	Powai_lake_megavirus	34.4	7.4e-34
WP_011640156.1|832791_833919_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	52.4	2.6e-111
WP_011640157.1|833942_834848_+	nucleoside-diphosphate-sugar epimerases-like protein	NA	NA	NA	NA	NA
WP_011640158.1|834844_836038_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011640159.1|836117_837239_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011640160.1|837267_837903_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011640161.1|838619_839366_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011640162.1|839355_840225_-	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	33.7	1.2e-36
WP_011640163.1|840379_841393_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.4	1.1e-15
WP_011640164.1|841678_842440_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
849714:849731	attR	AAGCTTAAGATATTTATT	NA	NA	NA	NA
>prophage 4
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	1939596	2011182	2936195	transposase,holin	Pseudomonas_phage(12.5%)	53	NA	NA
WP_049750181.1|1939596_1940559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641102.1|1941016_1941835_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_011641103.1|1941893_1942118_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011641104.1|1942207_1942426_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_011639756.1|1942746_1944078_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	8.2e-32
WP_011641105.1|1944552_1945725_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	43.7	1.1e-59
WP_011641106.1|1946084_1946684_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.0	1.1e-36
WP_011641107.1|1946742_1948050_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011641108.1|1948201_1949380_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011641109.1|1949400_1951776_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_049750182.1|1951775_1952435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	4.6e-36
WP_011641111.1|1952758_1955614_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_162010611.1|1955603_1957427_-	BatA domain-containing protein	NA	NA	NA	NA	NA
WP_049750122.1|1957560_1958439_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_081424890.1|1958937_1959852_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_049750123.1|1960029_1960296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814187.1|1960295_1960601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641116.1|1960491_1961763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641117.1|1961783_1962713_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011641118.1|1962712_1963639_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.9	7.2e-27
WP_011641119.1|1963640_1966100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641120.1|1966096_1967287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641121.1|1968288_1968714_+	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_041427964.1|1968990_1970037_+	Zn-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011641123.1|1970541_1970835_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011641124.1|1970818_1971163_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_011641125.1|1971190_1974862_-	AAA family ATPase	NA	A0A1B1IUN1	uncultured_Mediterranean_phage	27.0	2.7e-08
WP_011641126.1|1974874_1976101_-	exonuclease SbcCD subunit D C-terminal domain-containing protein	NA	G9J1Y4	Bacillus_phage	33.3	9.9e-08
WP_011641127.1|1976131_1977625_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_041427497.1|1977680_1978544_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_041427498.1|1978826_1979543_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_011641130.1|1979715_1981011_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_011641131.1|1981352_1982204_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155814298.1|1982210_1983113_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	38.6	8.8e-30
WP_155814188.1|1983119_1984193_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155814189.1|1984925_1985126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641134.1|1985107_1985695_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_041427501.1|1988360_1989926_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_011641138.1|1990103_1991327_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_011641139.1|1991347_1992682_-	acetyl-CoA hydrolase/transferase	NA	NA	NA	NA	NA
WP_011641140.1|1993023_1994736_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011641141.1|1994951_1996193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011639960.1|1996473_1997694_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641142.1|1997890_1998220_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011641143.1|1998216_1999227_-	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011641144.1|2000509_2001787_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011641145.1|2002711_2003461_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_011641146.1|2003611_2004754_-	type III-A CRISPR-associated RAMP protein Csm5	NA	NA	NA	NA	NA
WP_011641147.1|2004750_2005698_-	type III-A CRISPR-associated RAMP protein Csm4	NA	NA	NA	NA	NA
WP_041427503.1|2005672_2006368_-	type III-A CRISPR-associated RAMP protein Csm3	NA	NA	NA	NA	NA
WP_011641149.1|2006387_2006864_-	type III-A CRISPR-associated protein Csm2	NA	NA	NA	NA	NA
WP_011641150.1|2006856_2009283_-	type III-A CRISPR-associated protein Cas10/Csm1	NA	NA	NA	NA	NA
WP_011639746.1|2009535_2011182_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	2027459	2034154	2936195		Synechococcus_phage(33.33%)	6	NA	NA
WP_011641168.1|2027459_2028980_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	54.3	4.4e-82
WP_011641169.1|2028987_2029629_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.1	1.9e-23
WP_011641170.1|2029625_2030663_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	39.9	5.9e-62
WP_081424834.1|2030723_2032169_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.8	2.2e-59
WP_011641172.1|2032295_2033600_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	4.5e-19
WP_011641173.1|2033638_2034154_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.5	2.0e-23
>prophage 6
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	2531307	2549774	2936195	transposase	Leptospira_phage(80.0%)	18	NA	NA
WP_011641574.1|2531307_2532069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641575.1|2532174_2532495_-	TIGR04076 family protein	NA	NA	NA	NA	NA
WP_011641576.1|2532729_2533056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081424898.1|2533644_2534046_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011641580.1|2535090_2535852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081424853.1|2536128_2536284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041427560.1|2536723_2536930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641583.1|2539292_2539604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641584.1|2539600_2539954_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.2	1.5e-22
WP_011641585.1|2540031_2541624_+|transposase	IS66-like element ISSwo2 family transposase	transposase	S5VTD3	Leptospira_phage	34.6	1.2e-69
WP_011639493.1|2542162_2542885_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.2	1.1e-33
WP_011641587.1|2543090_2543528_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_041427562.1|2543517_2543697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041428061.1|2544044_2545823_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011641589.1|2545826_2547125_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011641583.1|2547442_2547754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641584.1|2547750_2548104_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.2	1.5e-22
WP_011641585.1|2548181_2549774_+|transposase	IS66-like element ISSwo2 family transposase	transposase	S5VTD3	Leptospira_phage	34.6	1.2e-69
>prophage 7
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	2553592	2615485	2936195	transposase,bacteriocin,integrase	Bacillus_phage(15.38%)	52	2592660:2592712	2618758:2618810
WP_011639494.1|2553592_2555098_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_011639493.1|2555094_2555817_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.2	1.1e-33
WP_011641597.1|2556708_2558250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814312.1|2559596_2561705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641601.1|2562287_2563547_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	32.1	1.5e-51
WP_011641602.1|2563836_2565306_+	metallophosphatase family protein	NA	NA	NA	NA	NA
WP_011641603.1|2565289_2565562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081424855.1|2565574_2566249_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011641605.1|2566692_2567202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641606.1|2567212_2569360_+|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.4	8.8e-28
WP_011641607.1|2569371_2571591_+|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.5	4.0e-23
WP_041427566.1|2571720_2571945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041427567.1|2572076_2572283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041427568.1|2572450_2572684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641608.1|2572909_2573353_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_011641609.1|2573334_2573499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641610.1|2573677_2574616_-	2-ketoacid ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_011641611.1|2574657_2575788_-	2-oxoisovalerate:ferredoxin oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_011641612.1|2575792_2576050_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011641613.1|2576183_2576741_-	2-oxoacid:acceptor oxidoreductase family protein	NA	NA	NA	NA	NA
WP_011641140.1|2577632_2579345_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_011641614.1|2579755_2580586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041427570.1|2580631_2581921_+	MFS transporter	NA	NA	NA	NA	NA
WP_011641616.1|2582136_2582454_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_011641617.1|2582479_2583271_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011641618.1|2583267_2584149_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-20
WP_011641619.1|2584150_2584543_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041427571.1|2584722_2585487_-	NRDE family protein	NA	A0A068EEH0	Pigeonpox_virus	37.4	2.0e-38
WP_011641621.1|2585727_2586069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162010618.1|2586387_2586525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641622.1|2587921_2588431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041427575.1|2588435_2589584_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_041427577.1|2589995_2590280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641624.1|2590292_2590634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641625.1|2590630_2591131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641627.1|2591596_2592514_+|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	34.0	6.0e-26
2592660:2592712	attL	TGGAGCCGATGGCCGGATTTGAACCGGCGACCTGCTGATTACGAATCAGCTGC	NA	NA	NA	NA
WP_011641628.1|2592893_2595365_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_011641629.1|2595371_2596337_-	AAA family ATPase	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	30.8	1.0e-15
WP_011641630.1|2596473_2597157_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011641631.1|2597162_2600348_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.5	8.1e-62
WP_011641632.1|2600347_2601589_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011641633.1|2601585_2604261_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	34.2	1.6e-74
WP_049750192.1|2604484_2604883_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_155814234.1|2605517_2605769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011641635.1|2605962_2608731_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_011641636.1|2609017_2610265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814235.1|2610390_2611032_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_011641638.1|2611300_2612233_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	45.2	2.5e-72
WP_011641639.1|2612250_2613057_+	hypothetical protein	NA	A6M982	Geobacillus_virus	44.4	9.6e-28
WP_011641640.1|2613133_2613925_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041427578.1|2614058_2614307_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011641642.1|2614306_2615485_+|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	30.1	9.1e-43
2618758:2618810	attR	TGGAGCCGATGGCCGGATTTGAACCGGCGACCTGCTGATTACGAATCAGCTGC	NA	NA	NA	NA
>prophage 8
NC_008346	Syntrophomonas wolfei subsp. wolfei str. Goettingen G311, complete sequence	2936195	2789955	2855393	2936195	transposase,protease,integrase,tRNA	Escherichia_phage(14.29%)	55	2838937:2838956	2865267:2865286
WP_011641832.1|2789955_2791725_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	58.1	6.5e-186
WP_011641833.1|2791876_2792173_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_041427604.1|2792182_2792440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641835.1|2792608_2793454_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011639611.1|2793871_2795203_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	2.1e-32
WP_153014644.1|2795729_2795870_-	thioredoxin	NA	NA	NA	NA	NA
WP_011641836.1|2795999_2796314_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_011639960.1|2796538_2797759_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641837.1|2798073_2798811_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011641838.1|2798879_2799359_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_011641839.1|2799640_2799979_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_011641840.1|2800078_2801338_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011641841.1|2801355_2802195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641842.1|2802265_2803174_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	44.3	4.4e-61
WP_011641843.1|2803235_2804576_-	peptidoglycan DD-metalloendopeptidase family protein	NA	V5R8R0	Arthrobacter_phage	52.7	1.0e-18
WP_155814240.1|2804787_2806203_-	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
WP_081424864.1|2806235_2806379_-	six-cysteine ranthipeptide SCIFF	NA	NA	NA	NA	NA
WP_081424865.1|2806530_2806797_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_162010620.1|2806806_2807241_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_041427605.1|2807224_2807473_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011641847.1|2808533_2809628_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011641848.1|2809737_2811432_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011641849.1|2811407_2812463_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	6.5e-24
WP_155814320.1|2812765_2813764_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_081424866.1|2813750_2815574_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011641852.1|2815563_2816541_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	5.4e-25
WP_011641853.1|2816654_2817293_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011641854.1|2817594_2819454_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_011641855.1|2819643_2820384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641856.1|2820640_2821369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814242.1|2821347_2821506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641857.1|2821538_2822651_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041427607.1|2822678_2823539_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_011641859.1|2823943_2825980_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_011641860.1|2826043_2828665_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_041427609.1|2828781_2828985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641862.1|2829086_2829407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641864.1|2830119_2833671_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	19.6	1.2e-05
WP_011641865.1|2833708_2837266_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_011641866.1|2837395_2837962_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_011641867.1|2837978_2838578_-	DUF1819 family protein	NA	NA	NA	NA	NA
2838937:2838956	attL	AGGGTTTCGAACCCACGACT	NA	NA	NA	NA
WP_011641868.1|2839252_2839498_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_011641869.1|2839499_2842103_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011641871.1|2842853_2846909_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011641872.1|2847151_2849683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011639960.1|2850682_2851903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641873.1|2852028_2852391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155814243.1|2852440_2852614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041428125.1|2852721_2853084_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_011641875.1|2853088_2853307_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_011641876.1|2853486_2853705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641877.1|2853915_2854158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041427611.1|2854489_2854708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011641878.1|2854787_2855042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011641879.1|2855054_2855393_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2865267:2865286	attR	AGGGTTTCGAACCCACGACT	NA	NA	NA	NA
