The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	480872	488491	1832387		Bacillus_phage(33.33%)	8	NA	NA
WP_099046112.1|480872_481988_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	47.1	1.9e-05
WP_002834460.1|481999_482704_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	6.9e-38
WP_002834459.1|482675_484061_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.3	6.3e-27
WP_002834458.1|484223_485105_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	25.9	9.3e-08
WP_011673073.1|485104_486013_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002834456.1|486013_486901_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_171030525.1|486921_487719_+	phosphate ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.0	3.4e-09
WP_002834094.1|487732_488491_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.0e-18
>prophage 2
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	522952	600040	1832387	integrase,tRNA,transposase	Enterococcus_phage(11.11%)	59	584116:584144	600120:600148
WP_002834053.1|522952_523426_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002834051.1|523415_523913_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011673082.1|523905_524442_-	exonuclease	NA	M1PFD8	Streptococcus_phage	39.1	5.6e-24
WP_011673083.1|524516_525434_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002834046.1|525478_526381_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002834044.1|526511_527363_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002834043.1|527363_528293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002834042.1|528311_529670_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	28.2	1.5e-20
WP_011673084.1|529905_531723_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	35.3	7.6e-89
WP_002834040.1|531991_532303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002834038.1|534222_534759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673085.1|534904_535588_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_147628904.1|536030_537203_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_011673087.1|537222_539394_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.5	3.4e-245
WP_002834033.1|539386_539974_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	55.5	9.1e-52
WP_002834032.1|539990_540752_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.3	2.9e-10
WP_002834031.1|540789_541818_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_011673088.1|541830_543006_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.9	6.2e-84
WP_011673089.1|543002_543443_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_049752779.1|543489_544842_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002834025.1|544997_545534_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_011673090.1|545560_546091_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029257762.1|546300_546636_+	LapA family protein	NA	NA	NA	NA	NA
WP_148194163.1|546681_546930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673093.1|549705_550824_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	42.1	1.7e-75
WP_011673094.1|551557_552118_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.7	3.4e-32
WP_011673095.1|552309_553239_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.4	1.6e-26
WP_011673096.1|553346_553748_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_167522503.1|554324_554537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673098.1|554785_554977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673099.1|555104_556634_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011673100.1|556672_558046_+	MFS transporter	NA	NA	NA	NA	NA
WP_003606447.1|559536_559785_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041526953.1|560376_560709_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011673106.1|561045_561876_-	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_011673107.1|562110_564039_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_011673108.1|564096_566298_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_049752771.1|567589_568468_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.9e-25
WP_011673109.1|568565_568772_+	membrane protein	NA	NA	NA	NA	NA
WP_011673110.1|568849_569716_-	ROK family protein	NA	NA	NA	NA	NA
WP_011673111.1|569795_571955_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_011673112.1|571974_573930_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_011673113.1|574185_575691_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_011673114.1|575671_576652_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	9.3e-17
WP_011673115.1|576672_578349_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002816285.1|578914_579166_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_041526954.1|579219_580029_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.1	7.6e-150
WP_011673118.1|581182_581467_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011673119.1|581987_583346_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	41.4	1.0e-98
584116:584144	attL	AAAAATTGGCTAAGCTTTTGGCTAAGTTT	NA	NA	NA	NA
WP_167522504.1|584238_584382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673121.1|585610_587089_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_041526987.1|587214_588489_+	DNA (cytosine-5-)-methyltransferase	NA	Q8LTM9	Lactococcus_phage	38.0	6.0e-24
WP_011673123.1|588653_591155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673124.1|591151_592354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673125.1|592346_594929_+	DEAD/DEAH box helicase family protein	NA	I3VYY6	Thermoanaerobacterium_phage	22.4	7.4e-13
WP_011673127.1|595590_597213_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011673128.1|597525_597951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673129.1|598106_598337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011673130.1|598885_600040_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	37.2	3.6e-60
600120:600148	attR	AAAAATTGGCTAAGCTTTTGGCTAAGTTT	NA	NA	NA	NA
>prophage 3
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	769694	856974	1832387	tail,head,integrase,plate,portal,terminase,protease,tRNA,capsid,holin	Lactobacillus_phage(34.78%)	114	780673:780697	818728:818752
WP_002833521.1|769694_770384_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002833522.1|770416_770629_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002833523.1|770646_771609_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002833524.1|771640_772060_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002833525.1|772113_772290_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002833526.1|772372_773107_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	35.2	1.2e-13
WP_002833528.1|773108_774041_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_011673217.1|774024_775281_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_002833530.1|775361_775727_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002833531.1|775761_777102_+	type I glutamate--ammonia ligase	NA	M1NM71	Moumouvirus	22.8	2.5e-12
WP_002833532.1|777250_778126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833533.1|778118_779036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833534.1|779045_779585_+	dUTP diphosphatase	NA	A0A290GJJ6	Caldibacillus_phage	26.2	9.7e-08
WP_002833535.1|779889_780117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833536.1|780256_780460_-	hypothetical protein	NA	NA	NA	NA	NA
780673:780697	attL	CTATATTAATATGATTCGGGAGAGA	NA	NA	NA	NA
WP_011673218.1|780797_781937_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	49.3	7.3e-90
WP_011673219.1|782083_782488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673220.1|782545_782983_-	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	39.2	2.1e-16
WP_011673221.1|782986_783337_-	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	38.1	8.4e-13
WP_011673222.1|783593_783803_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011673223.1|783816_783996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673224.1|783985_784126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673225.1|784186_784912_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	50.4	3.5e-53
WP_011673226.1|784914_785259_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_011673229.1|785534_785996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673230.1|785992_786649_+	ERF family protein	NA	A0A2H4JA34	uncultured_Caudovirales_phage	33.7	6.4e-22
WP_011673231.1|786651_787050_+	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	58.3	1.5e-37
WP_011673233.1|787955_789203_+	DnaB-like helicase C-terminal domain-containing protein	NA	A0A0P0IXJ2	Lactobacillus_phage	37.4	1.1e-62
WP_011673234.1|789205_789622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673235.1|789618_790038_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	55.6	6.3e-39
WP_011673237.1|790246_790477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673238.1|790490_790631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673239.1|790645_791017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673240.1|791060_791525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673241.1|791536_791830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673243.1|791996_792563_+	DUF1642 domain-containing protein	NA	A0A126GGJ0	Streptococcus_phage	38.7	7.0e-09
WP_011673244.1|792562_792751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673245.1|792743_792911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673246.1|793069_793366_+	hypothetical protein	NA	A0A2K9V535	Lactobacillus_phage	44.3	2.9e-14
WP_011673247.1|793365_793707_+	hypothetical protein	NA	A0A1S5SCI4	Streptococcus_phage	36.4	3.5e-11
WP_011673248.1|793709_794129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673249.1|794200_794374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673250.1|794440_794899_+	DNA-directed RNA polymerase sigma-70 factor	NA	O03925	Lactobacillus_phage	34.8	2.2e-13
WP_011673251.1|795079_795322_+	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	44.3	1.3e-09
WP_011673252.1|795367_795508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673253.1|795646_796228_+	YfbU family protein	NA	NA	NA	NA	NA
WP_011673254.1|796308_796806_+	helix-turn-helix domain-containing protein	NA	L0P6X1	Lactobacillus_phage	33.1	2.8e-09
WP_049752772.1|796789_798067_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	68.4	5.9e-173
WP_011673256.1|798074_799478_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	60.7	2.8e-155
WP_148194174.1|799584_800424_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	48.4	9.9e-68
WP_011673258.1|800426_800642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673259.1|800751_801363_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_011673260.1|801377_802292_+	hypothetical protein	NA	Q5YA70	Bacillus_phage	62.2	4.8e-100
WP_099046114.1|802309_802576_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_011673262.1|802587_802959_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	54.4	1.1e-26
WP_011673263.1|802963_803272_+	hypothetical protein	NA	A0A097BYD2	Leuconostoc_phage	44.6	1.8e-11
WP_011673264.1|803264_803606_+	HK97 gp10 family phage protein	NA	A0ZVS5	Lactococcus_phage	48.1	5.3e-20
WP_148194164.1|803606_804014_+	hypothetical protein	NA	A0A097BYB7	Leuconostoc_phage	42.2	8.6e-25
WP_011673266.1|804025_804610_+|tail	phage major tail protein, TP901-1 family	tail	A0A097BY79	Leuconostoc_phage	48.9	4.2e-41
WP_011673267.1|804686_804965_+	hypothetical protein	NA	A0A220BYE2	Staphylococcus_phage	51.9	4.6e-06
WP_011673268.1|805104_805446_+|tail	tail assembly chaperone	tail	A0A0A1ER95	Lactobacillus_phage	59.3	1.1e-30
WP_041526960.1|805496_805871_+	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	40.0	9.6e-15
WP_011673270.1|805854_808875_+|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	35.4	2.8e-03
WP_148194165.1|808862_809639_+|tail	phage tail protein	tail	A0A286QN36	Streptococcus_phage	38.9	2.4e-39
WP_011673272.1|809638_812599_+|tail	phage tail protein	tail	Q6SEC2	Lactobacillus_prophage	36.0	1.9e-142
WP_011673273.1|812582_812996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673274.1|812999_814829_+|plate	phage baseplate upper protein	plate	O03968	Lactobacillus_phage	37.4	6.0e-102
WP_011673275.1|814840_815581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673276.1|815580_815922_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_148194175.1|815921_816074_+	XkdX family protein	NA	E2ELK1	Clostridium_phage	51.2	2.1e-05
WP_011673278.1|816136_816739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673279.1|816781_817183_+|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	41.0	9.6e-21
WP_148194176.1|817208_818483_+	1,4-beta-N-acetylmuramidase	NA	A0A1X9IGI4	Lactococcus_phage	66.4	1.4e-81
WP_002833537.1|819016_819529_+	hypothetical protein	NA	NA	NA	NA	NA
818728:818752	attR	CTATATTAATATGATTCGGGAGAGA	NA	NA	NA	NA
WP_011673281.1|819862_820492_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002833539.1|820621_820930_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011673282.1|820951_821278_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002833541.1|821301_821589_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002833542.1|821713_822277_+	elongation factor P	NA	NA	NA	NA	NA
WP_002833543.1|822294_822723_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002833544.1|822722_823124_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002833545.1|823249_824101_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	4.9e-38
WP_002833546.1|824101_825445_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	30.9	2.1e-43
WP_002833547.1|825444_825681_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002833548.1|825673_826564_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002833549.1|826577_827396_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002833550.1|827404_827863_+	arginine repressor, DNA-binding domain protein	NA	NA	NA	NA	NA
WP_011673283.1|827874_829551_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011673284.1|829622_829958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002833553.1|830253_830868_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	32.9	1.8e-18
WP_002833554.1|830869_831079_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011673285.1|831190_832384_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.9	5.6e-40
WP_011673286.1|832398_834819_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011673287.1|834841_835804_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.3	5.7e-11
WP_011673288.1|835787_837122_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002833560.1|837130_837877_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	G9BWD9	Planktothrix_phage	24.2	2.8e-05
WP_002833561.1|837873_839397_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	28.5	9.1e-19
WP_011673289.1|839407_840337_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002833563.1|840333_840981_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011673290.1|840980_841622_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_011673291.1|841665_841851_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002833566.1|842150_842513_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_041526961.1|842534_844229_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_011673293.1|844279_846307_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011673294.1|846323_847367_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002833570.1|847405_847648_+	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	49.3	9.0e-06
WP_002833571.1|847744_848443_+	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	31.9	2.6e-21
WP_011673295.1|848452_851983_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_011673296.1|852000_853221_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	35.9	2.7e-13
WP_002833574.1|853226_853568_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002833575.1|853585_855016_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011673297.1|855374_855647_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011673298.1|855721_856237_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011673299.1|856236_856974_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	897994	904350	1832387		Megavirus(16.67%)	8	NA	NA
WP_011673326.1|897994_899854_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	5.3e-138
WP_002833625.1|899950_901075_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.2	1.3e-22
WP_002833626.1|901180_901408_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011673327.1|901536_902007_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_011673329.1|902243_902726_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.0	4.9e-11
WP_011673330.1|902742_902964_+	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	33.3	2.0e-07
WP_011673331.1|902964_903705_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.8e-17
WP_002833631.1|903828_904350_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	57.1	4.0e-43
>prophage 5
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	964897	1031048	1832387	tail,head,integrase,portal,terminase,protease,holin,capsid	Lactobacillus_phage(71.79%)	71	965450:965467	1032003:1032020
WP_011673374.1|964897_966310_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	25.3	6.6e-32
965450:965467	attL	TTTATCAATTTCATCGAT	NA	NA	NA	NA
WP_002833088.1|966313_966868_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002833090.1|966886_967792_-	tyrosine recombinase XerC	NA	A0A1I9SC88	Mycobacterium_phage	29.7	6.6e-17
WP_002833092.1|967863_969936_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	1.3e-92
WP_011673375.1|970245_970905_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011673376.1|970920_973173_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_011673377.1|973198_974542_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_011673378.1|974685_975639_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011673379.1|975738_976599_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	32.8	1.5e-26
WP_011673380.1|976639_977407_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.6	2.3e-26
WP_011673381.1|977393_978257_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_011673382.1|979052_980387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673383.1|980588_982619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673384.1|983037_983364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002833100.1|983631_985746_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.3	1.5e-117
WP_011673385.1|986029_988075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673386.1|988061_988400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148194166.1|988401_989391_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_011673388.1|989446_990100_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_011673389.1|990255_991047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673390.1|992276_992519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673391.1|992636_993014_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	82.5	7.4e-23
WP_011673392.1|993023_993287_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	85.1	6.1e-32
WP_049752780.1|993286_994399_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	61.3	6.2e-33
WP_011673394.1|994461_994821_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	79.0	6.6e-45
WP_011673395.1|994854_995103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673396.1|995115_995319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673397.1|995311_995539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673398.1|995531_998720_-	hypothetical protein	NA	A0A1S5RCP2	Lactobacillus_phage	48.6	2.2e-27
WP_011673399.1|998736_1001127_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	69.5	0.0e+00
WP_011673400.1|1001147_1002914_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	64.9	3.6e-229
WP_011673401.1|1002991_1007752_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P0ZLG0	Lactobacillus_phage	63.7	0.0e+00
WP_011673402.1|1007783_1007969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673403.1|1008013_1008388_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	95.2	1.4e-58
WP_011673404.1|1008461_1009115_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	90.3	5.5e-106
WP_011673405.1|1009130_1009511_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	84.1	4.6e-57
WP_011673406.1|1009510_1009918_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	89.4	7.9e-63
WP_011673407.1|1009920_1010268_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.9	5.4e-44
WP_011673408.1|1010257_1010590_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	83.3	4.3e-43
WP_011673409.1|1010663_1011896_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.7	1.7e-209
WP_011673410.1|1011895_1012651_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	3.9e-124
WP_011673411.1|1012628_1013792_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	93.5	2.7e-209
WP_011673412.1|1013794_1013989_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	96.9	4.8e-26
WP_011673413.1|1013978_1015877_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	95.1	0.0e+00
WP_011673414.1|1015879_1016338_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	95.4	3.0e-79
WP_080504382.1|1016534_1017002_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	1.5e-81
WP_011673416.1|1017581_1018013_-	DNA-directed RNA polymerase sigma-70 factor	NA	A0A0M7RDP0	Lactobacillus_phage	34.6	3.0e-12
WP_011673417.1|1018003_1018396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673418.1|1018475_1018940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673420.1|1018991_1019324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673421.1|1019324_1019696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673422.1|1019710_1019851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673423.1|1019860_1020079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673424.1|1020075_1020486_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	58.1	1.3e-41
WP_011673426.1|1020602_1021421_-	ATP-binding protein	NA	O03914	Lactobacillus_phage	48.9	1.8e-61
WP_011673427.1|1021401_1022145_-	conserved phage C-terminal domain-containing protein	NA	A7DYC7	Streptococcus_phage	54.1	6.1e-69
WP_011673428.1|1022145_1022823_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	64.3	2.6e-82
WP_011673429.1|1022833_1023232_-	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	55.3	1.4e-35
WP_011673430.1|1023234_1023891_-	ERF family protein	NA	A0A2H4JA34	uncultured_Caudovirales_phage	33.7	8.4e-22
WP_011673431.1|1023887_1024349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673433.1|1024574_1024841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673434.1|1024797_1025055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673436.1|1025152_1025362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029258001.1|1025688_1025910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673439.1|1025934_1026135_-	DUF2829 domain-containing protein	NA	A0A2H4J5N9	uncultured_Caudovirales_phage	39.4	3.7e-05
WP_011673440.1|1026180_1026984_-	phage antirepressor	NA	Q38330	Lactococcus_phage	56.2	1.1e-76
WP_011673441.1|1026999_1027188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673442.1|1027453_1027801_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	41.4	1.6e-16
WP_041526966.1|1027804_1028215_+	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	39.2	2.5e-16
WP_011673444.1|1028278_1029406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011673446.1|1029974_1031048_+|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	36.0	6.8e-45
1032003:1032020	attR	TTTATCAATTTCATCGAT	NA	NA	NA	NA
>prophage 6
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	1062369	1071987	1832387	tRNA	Staphylococcus_phage(37.5%)	9	NA	NA
WP_011673470.1|1062369_1063215_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.2	1.0e-16
WP_011673471.1|1063451_1064189_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.4e-33
WP_011673472.1|1064185_1065637_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099046115.1|1065758_1066235_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.8	3.8e-24
WP_011673474.1|1066272_1067223_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.7	3.4e-117
WP_011673475.1|1067235_1069113_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	2.9e-51
WP_041526969.1|1069115_1070324_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.0	3.5e-34
WP_002833200.1|1070577_1071462_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.1	2.1e-52
WP_002833201.1|1071516_1071987_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	40.1	3.8e-16
>prophage 7
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	1433157	1441721	1832387		Synechococcus_phage(33.33%)	9	NA	NA
WP_011673676.1|1433157_1433739_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.7	1.1e-22
WP_011673677.1|1433735_1434785_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	40.2	5.2e-58
WP_011673678.1|1434784_1436254_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	1.4e-56
WP_041526973.1|1436238_1438446_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	5.7e-147
WP_011673680.1|1438463_1439138_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_011673681.1|1439140_1439395_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011673682.1|1439387_1440116_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.4	9.6e-43
WP_011673683.1|1440115_1441255_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011673684.1|1441238_1441721_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	2.6e-20
>prophage 8
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	1451081	1459949	1832387		Streptococcus_phage(33.33%)	10	NA	NA
WP_011673692.1|1451081_1452098_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.6	2.5e-33
WP_002833272.1|1452097_1452433_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002833271.1|1452448_1453078_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	2.0e-52
WP_002833270.1|1453242_1453842_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002833269.1|1453868_1454183_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011673693.1|1454198_1455944_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	48.4	2.8e-56
WP_011673694.1|1456156_1456642_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	31.6	1.8e-05
WP_011673695.1|1456634_1457240_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011673696.1|1457451_1457682_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	48.1	8.0e-12
WP_011673697.1|1457783_1459949_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.9	3.9e-249
>prophage 9
NC_008525	Pediococcus pentosaceus ATCC 25745, complete sequence	1832387	1688943	1699789	1832387		Bacillus_phage(28.57%)	12	NA	NA
WP_011673827.1|1688943_1690119_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	33.3	4.8e-44
WP_002834110.1|1690260_1690593_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_002834111.1|1690613_1691402_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_011673828.1|1691533_1692790_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	23.3	3.8e-07
WP_011673829.1|1692970_1694107_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	2.8e-25
WP_002834114.1|1694118_1694808_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	5.7e-37
WP_011673830.1|1694890_1695388_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	37.3	3.7e-14
WP_011673831.1|1695518_1696661_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.0	2.4e-64
WP_011673832.1|1696682_1697387_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002834120.1|1697415_1698522_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002834122.1|1698738_1698924_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_011673833.1|1698937_1699789_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	35.6	1.6e-12
