The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008497	Lactobacillus brevis ATCC 367, complete sequence	2291220	808855	818111	2291220	tRNA	Staphylococcus_phage(42.86%)	9	NA	NA
WP_011667553.1|808855_809131_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	3.1e-26
WP_011667554.1|809236_810496_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_042254316.1|810613_811510_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	1.6e-52
WP_011667556.1|811685_812879_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	4.1e-35
WP_011667557.1|812907_814800_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.3	6.1e-49
WP_011667558.1|814811_815762_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.8	5.9e-117
WP_011667559.1|815778_816270_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	37.2	5.7e-23
WP_011667560.1|816449_817091_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_011667561.1|817259_818111_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	5.8e-15
>prophage 2
NC_008497	Lactobacillus brevis ATCC 367, complete sequence	2291220	1065562	1132477	2291220	tRNA,integrase,portal,tail,terminase,plate,capsid	Lactobacillus_phage(57.14%)	83	1085006:1085025	1137582:1137601
WP_011667812.1|1065562_1066201_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_011667813.1|1066224_1066557_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011667814.1|1066735_1067062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667815.1|1067167_1068526_-	amino acid permease	NA	NA	NA	NA	NA
WP_011667816.1|1068560_1069670_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_011667817.1|1069881_1070388_-	universal stress protein	NA	NA	NA	NA	NA
WP_011667818.1|1070425_1071826_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_011667819.1|1071967_1072801_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_011667820.1|1072847_1073537_-	16S rRNA uridine-516 pseudouridylate synthase related pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011667821.1|1073548_1075183_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011667822.1|1075404_1075725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011667823.1|1075830_1076595_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_011667824.1|1076660_1077335_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011667825.1|1077783_1080213_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_011667826.1|1080654_1081296_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011667827.1|1081292_1081859_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	46.0	8.0e-37
WP_011667829.1|1082188_1083511_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011667830.1|1083519_1084029_-	hypothetical protein	NA	NA	NA	NA	NA
1085006:1085025	attL	TAAAAAATGAAAGCGTGTCA	NA	NA	NA	NA
WP_011667831.1|1085688_1086048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148201724.1|1086293_1087445_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	25.8	3.5e-23
WP_011667833.1|1087441_1088122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667834.1|1088268_1089321_-	lysozyme M1 (1,4-beta-N-acetylmuramidase)	NA	D6PSS2	Lactobacillus_phage	91.0	1.3e-170
WP_011667835.1|1089320_1089839_-	hypothetical protein	NA	D6PSS1	Lactobacillus_phage	91.9	1.5e-79
WP_011667836.1|1089831_1090134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667837.1|1090130_1090517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667838.1|1090574_1090745_-	hypothetical protein	NA	D6PSR8	Lactobacillus_phage	83.9	2.5e-18
WP_011667840.1|1090903_1091356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667841.1|1091374_1091956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667843.1|1093755_1094364_-	hypothetical protein	NA	D6PT00	Lactobacillus_phage	45.7	1.5e-25
WP_011667844.1|1094353_1095517_-|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	35.2	5.6e-61
WP_011667845.1|1095513_1095888_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_011667846.1|1095884_1096259_-	hypothetical protein	NA	A8ATI0	Listeria_phage	36.0	3.1e-05
WP_011667847.1|1096255_1097215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667848.1|1097207_1097594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667849.1|1097607_1098909_-	LysM peptidoglycan-binding domain-containing protein	NA	A8ATH7	Listeria_phage	31.2	8.0e-08
WP_011667850.1|1098920_1104608_-|tail	phage tail tape measure protein	tail	D6PSZ2	Lactobacillus_phage	62.2	3.6e-60
WP_011667852.1|1104845_1105472_-	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	43.2	4.0e-13
WP_011667853.1|1105602_1106085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667854.1|1106102_1107254_-	DUF3383 family protein	NA	NA	NA	NA	NA
WP_011667855.1|1107271_1107760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667856.1|1107743_1108127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667857.1|1108145_1108445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667858.1|1108459_1108972_-	hypothetical protein	NA	L7TME2	Rhizobium_phage	35.2	1.8e-08
WP_011667859.1|1108968_1109319_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_011667860.1|1109491_1110613_-|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	33.5	7.6e-47
WP_011667861.1|1110630_1111032_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	31.9	8.5e-09
WP_011667862.1|1111043_1111697_-	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	53.1	3.5e-28
WP_011667863.1|1111890_1112826_-	hypothetical protein	NA	A0A2P1JTW9	Anoxybacillus_phage	23.1	1.0e-17
WP_011667864.1|1112746_1114270_-|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	37.4	1.8e-75
WP_148201725.1|1114281_1115598_-|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	62.4	6.4e-162
WP_011667866.1|1115743_1116331_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	34.6	1.5e-22
WP_011667867.1|1116337_1117096_-|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	50.6	3.1e-60
WP_011667868.1|1117127_1117310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667869.1|1117329_1117575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667870.1|1117586_1117913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108477668.1|1119339_1119792_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.9	3.7e-45
WP_011667873.1|1119888_1120212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667874.1|1120241_1120499_-	hypothetical protein	NA	A0A2H4PB64	Lactobacillus_phage	55.2	6.0e-16
WP_011667875.1|1120639_1120939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667876.1|1120972_1121317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667877.1|1121441_1121696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667878.1|1121696_1121954_-	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	68.4	6.8e-20
WP_011667879.1|1121968_1122166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667880.1|1122179_1122641_-	DUF1064 domain-containing protein	NA	A0A2P0ZKV6	Lactobacillus_phage	46.9	8.8e-26
WP_011667881.1|1122637_1122883_-	hypothetical protein	NA	D6PSU9	Lactobacillus_phage	56.8	1.8e-14
WP_011667882.1|1123051_1123249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667883.1|1123260_1123476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080504807.1|1123468_1123903_-	hypothetical protein	NA	D6PSU8	Lactobacillus_phage	53.7	9.1e-17
WP_011667885.1|1123899_1124601_-	hypothetical protein	NA	A0A0D4DC57	Staphylococcus_phage	34.9	4.9e-28
WP_011667886.1|1124601_1125015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667887.1|1125007_1126252_-	replicative DNA helicase	NA	A0A2D1GP91	Lactobacillus_phage	35.3	5.2e-57
WP_011667888.1|1126252_1127005_-	conserved phage C-terminal domain-containing protein	NA	U5U793	Lactobacillus_phage	39.1	2.4e-33
WP_011667889.1|1127005_1127203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667890.1|1127272_1127857_-	DUF669 domain-containing protein	NA	D2KRE3	Lactobacillus_phage	45.5	1.0e-31
WP_011667891.1|1127853_1128552_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	72.9	7.2e-88
WP_011667892.1|1128552_1129446_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	31.1	1.5e-26
WP_011667893.1|1129438_1129618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667895.1|1129944_1130223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667896.1|1130311_1130566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667897.1|1130578_1130776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667898.1|1130788_1131571_-	ORF6N domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	55.0	1.6e-75
WP_011667899.1|1131583_1131802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011667900.1|1132060_1132477_+	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	37.4	2.3e-09
1137582:1137601	attR	TAAAAAATGAAAGCGTGTCA	NA	NA	NA	NA
