The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	845881	854628	3225748		Gordonia_phage(16.67%)	7	NA	NA
WP_011563799.1|845881_847528_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0K0NKS2	Gordonia_phage	29.9	3.3e-06
WP_041328085.1|847460_847742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011563800.1|847855_849478_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	52.2	3.0e-153
WP_011563801.1|849865_851026_+	GuaB3 family IMP dehydrogenase-related protein	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	33.8	8.7e-14
WP_011563802.1|851031_852552_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.9	1.4e-19
WP_011563803.1|852587_853385_+	endonuclease/exonuclease/phosphatase family protein	NA	A0A2I2L4E4	Orpheovirus	23.9	6.0e-06
WP_083759918.1|853434_854628_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	41.2	3.4e-53
>prophage 2
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	1028478	1036615	3225748		Synechococcus_phage(50.0%)	8	NA	NA
WP_011563976.1|1028478_1029786_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.2	5.7e-22
WP_011563977.1|1029788_1030502_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	40.5	1.4e-38
WP_011563978.1|1030498_1030723_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011563979.1|1030719_1031382_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_156787624.1|1031258_1033562_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.7	2.9e-162
WP_011563981.1|1033563_1035012_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.7	3.1e-53
WP_011563982.1|1035015_1036041_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	44.7	1.7e-66
WP_041328113.1|1036045_1036615_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-28
>prophage 3
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	1361506	1369421	3225748	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_049761262.1|1361506_1362397_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.0	1.4e-35
WP_011564317.1|1362450_1362879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011564318.1|1362905_1364555_+	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	35.5	1.6e-45
WP_011564319.1|1364589_1366818_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	39.1	5.8e-14
WP_011564320.1|1366829_1367408_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.5	1.1e-12
WP_083759956.1|1367266_1368679_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.9	1.9e-18
WP_049761263.1|1368680_1369421_+	NAD-dependent deacylase	NA	A0A220NU33	Escherichia_phage	29.7	8.9e-12
>prophage 4
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	1832372	1947849	3225748	transposase,protease,integrase	Streptomyces_phage(13.33%)	105	1943861:1943880	1950081:1950100
WP_011564781.1|1832372_1834328_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.1	4.3e-114
WP_156787673.1|1834376_1835120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564784.1|1835444_1835840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328217.1|1835863_1836124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564786.1|1836327_1836957_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011564787.1|1837185_1837827_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_156787863.1|1838352_1839165_-	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	35.1	1.1e-34
WP_011564789.1|1839626_1840106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328218.1|1840173_1840410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564791.1|1840422_1840854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787864.1|1841026_1842214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787865.1|1842434_1843640_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011564794.1|1843887_1844436_+	universal stress protein	NA	NA	NA	NA	NA
WP_049761493.1|1845084_1845957_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_156787866.1|1845988_1846588_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011564797.1|1846734_1848444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328220.1|1848574_1848913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564799.1|1849065_1849902_+	cytochrome c biogenesis protein, region	NA	NA	NA	NA	NA
WP_011564800.1|1850003_1851377_-	MBL fold hydrolase	NA	NA	NA	NA	NA
WP_011564801.1|1851381_1851789_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_011564803.1|1852412_1853189_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_156787674.1|1853741_1855223_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011564805.1|1855314_1855665_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	50.0	6.0e-19
WP_156787675.1|1855415_1856273_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_156787676.1|1857307_1857475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564807.1|1857605_1858514_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	35.5	2.7e-34
WP_011564808.1|1858548_1859874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564809.1|1859887_1861981_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_156787677.1|1862118_1862433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564811.1|1862532_1862802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787678.1|1862801_1863200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564814.1|1865240_1866323_-	thiolase family protein	NA	NA	NA	NA	NA
WP_011564815.1|1867221_1867398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564816.1|1867572_1868895_-	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_156787679.1|1868908_1869775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564818.1|1869818_1871879_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_156787867.1|1871895_1873980_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_011564820.1|1874059_1874431_-	subunit of acetophenone carboxylase	NA	NA	NA	NA	NA
WP_011564821.1|1874432_1876376_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_049761305.1|1876470_1877778_-	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_156787680.1|1877840_1878425_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_041329031.1|1878746_1879289_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	2.7e-26
WP_156787681.1|1879717_1879990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787868.1|1880155_1881382_-	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_011564825.1|1881435_1881861_-	enamine deaminase RidA	NA	NA	NA	NA	NA
WP_041328224.1|1881883_1882570_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_011564827.1|1882605_1884057_-	4-hydroxyphenylacetate 3-hydroxylase	NA	NA	NA	NA	NA
WP_011564828.1|1884097_1885279_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_156787682.1|1886738_1886987_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.0	1.4e-06
WP_156787683.1|1886940_1887804_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	42.5	1.2e-20
WP_011564829.1|1887626_1887923_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156787684.1|1887910_1888315_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011564830.1|1888535_1889903_-	MFS transporter	NA	NA	NA	NA	NA
WP_156787685.1|1890129_1890243_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011564831.1|1890361_1891126_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_011564832.1|1891142_1891940_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_083759998.1|1891996_1893637_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.0	1.8e-33
WP_083759999.1|1893633_1894356_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_083760174.1|1894360_1895047_-	VOC family protein	NA	NA	NA	NA	NA
WP_011564836.1|1894761_1895415_-	cyclase family protein	NA	NA	NA	NA	NA
WP_011564837.1|1895542_1896406_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_011564838.1|1896395_1898783_+	xanthine dehydrogenase family protein	NA	A0A0P0I429	Acinetobacter_phage	24.4	1.5e-44
WP_011564839.1|1898779_1899355_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011564840.1|1899351_1901679_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_011564841.1|1901725_1903105_-	MFS transporter	NA	NA	NA	NA	NA
WP_011564842.1|1903164_1903911_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011564843.1|1903914_1905075_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_083760000.1|1905517_1906885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787686.1|1907799_1907991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011564847.1|1908056_1908707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011564851.1|1909884_1910115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787687.1|1910104_1910506_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041329036.1|1911430_1912381_+	ribokinase	NA	NA	NA	NA	NA
WP_041328228.1|1912487_1913507_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011564858.1|1916063_1916528_+	D-ribose pyranase 2	NA	NA	NA	NA	NA
WP_011564859.1|1916599_1917226_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_049761495.1|1917267_1918029_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_011564861.1|1918025_1919750_+	energy-coupling factor ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	4.9e-13
WP_011564862.1|1919794_1920730_-	inosine/uridine-preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011564863.1|1920762_1922100_-	DUF455 family protein	NA	NA	NA	NA	NA
WP_083760002.1|1922279_1923233_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156787688.1|1923287_1923605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787689.1|1925167_1925407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564866.1|1926204_1926456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760007.1|1926389_1926659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011564868.1|1928500_1929265_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011564869.1|1929329_1930484_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_156787690.1|1930753_1932097_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.6	2.3e-58
WP_011564871.1|1932228_1932903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328230.1|1933444_1934032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011564875.1|1934635_1935607_-	nuclease	NA	V5UN65	Mycobacterium_phage	39.7	2.4e-17
WP_011564876.1|1935616_1936246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564877.1|1936316_1936565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564878.1|1936573_1936849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787869.1|1936845_1937151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564880.1|1937245_1939525_-	hypothetical protein	NA	A0A2K9V2Z1	Faecalibacterium_phage	34.2	1.4e-20
WP_011564881.1|1939537_1940167_-	repressor LexA	NA	NA	NA	NA	NA
WP_041328159.1|1940392_1940914_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011563511.1|1940913_1941510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760009.1|1941846_1945314_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	29.7	6.9e-107
1943861:1943880	attL	TCGAGTCGCCGGGGCAGATG	NA	NA	NA	NA
WP_011564885.1|1945347_1945545_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041328235.1|1945541_1945988_-	nuclease	NA	NA	NA	NA	NA
WP_011564887.1|1945989_1946268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564888.1|1946252_1946477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011564889.1|1946709_1947849_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	38.1	1.8e-56
1950081:1950100	attR	CATCTGCCCCGGCGACTCGA	NA	NA	NA	NA
>prophage 5
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	2187236	2299394	3225748	transposase,protease,tRNA,integrase	Bacillus_phage(18.75%)	110	2205699:2205714	2235619:2235634
WP_011565131.1|2187236_2188649_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.6	4.9e-43
WP_011565132.1|2188645_2189941_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011565133.1|2189930_2190428_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_083760183.1|2190435_2191083_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011565135.1|2191131_2192217_-	DNA integrity scanning protein DisA	NA	NA	NA	NA	NA
WP_011565136.1|2192213_2193605_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011565137.1|2193725_2196230_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.8	5.1e-128
WP_011565138.1|2196613_2198092_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041328265.1|2198132_2198624_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_156787707.1|2198694_2199483_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_011565141.1|2199482_2199980_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_049761500.1|2199990_2200785_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	36.5	9.8e-33
WP_156787874.1|2200848_2202693_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	50.6	1.2e-113
WP_041329101.1|2202808_2203369_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011565145.1|2203374_2204709_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011565146.1|2204817_2206065_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	39.3	8.4e-55
2205699:2205714	attL	CAGCAGGCGGACCTAC	NA	NA	NA	NA
WP_011565147.1|2206439_2206823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041328267.1|2206824_2207010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787708.1|2207029_2207206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787709.1|2207439_2208132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787710.1|2208307_2208547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787711.1|2208722_2209355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787875.1|2209354_2210446_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_011565152.1|2210531_2211017_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_011565153.1|2211013_2211406_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_011565154.1|2211505_2212978_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.2	9.1e-16
WP_011565155.1|2212974_2213949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041328270.1|2213936_2214395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328271.1|2214491_2214689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011565158.1|2214702_2215083_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011565159.1|2215174_2216770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761332.1|2217101_2217338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787712.1|2217517_2217724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083760184.1|2217816_2218722_-	carotenoid biosynthesis protein	NA	NA	NA	NA	NA
WP_156787713.1|2218632_2219475_+	prenyltransferase	NA	NA	NA	NA	NA
WP_011565163.1|2219471_2220896_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011565164.1|2220892_2222038_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011565165.1|2222041_2222284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565166.1|2222326_2222989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787876.1|2222985_2224488_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_156787714.1|2224507_2224900_-	response regulator	NA	NA	NA	NA	NA
WP_011565169.1|2225003_2226236_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_041329108.1|2226259_2227036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041329109.1|2227423_2228140_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	34.7	1.7e-20
WP_041328273.1|2228241_2228451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565172.1|2228450_2228846_-	roadblock/LC7 domain-contain protein	NA	NA	NA	NA	NA
WP_156787715.1|2229157_2230789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049761333.1|2231044_2232118_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	37.6	2.7e-54
WP_011565175.1|2232410_2232824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328275.1|2232820_2233189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565177.1|2233563_2233962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083760028.1|2233961_2234156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787716.1|2234933_2235182_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	39.4	6.4e-07
WP_083760030.1|2235103_2235544_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	H6WZH1	Escherichia_phage	47.8	2.5e-22
WP_156787717.1|2235453_2235813_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2235619:2235634	attR	GTAGGTCCGCCTGCTG	NA	NA	NA	NA
WP_011565180.1|2237019_2237343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156787718.1|2237342_2237504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156787719.1|2237700_2237898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760185.1|2238224_2239076_-	hypothetical protein	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	36.6	1.4e-21
WP_011565183.1|2239014_2240640_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_049761334.1|2240658_2240853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083760186.1|2240722_2241589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083760032.1|2241619_2241928_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041328278.1|2242004_2243198_-	DNA (cytosine-5-)-methyltransferase	NA	R4TMW4	Halovirus	38.9	1.2e-18
WP_083760033.1|2243218_2245201_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_011565186.1|2245199_2245460_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011565188.1|2247063_2247357_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011565189.1|2247895_2248858_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011565190.1|2249889_2250909_-	amidohydrolase	NA	NA	NA	NA	NA
WP_083760034.1|2250905_2252078_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011565192.1|2251974_2253114_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011565193.1|2253125_2254160_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_083760035.1|2254292_2255351_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011565195.1|2255332_2256121_+	cyclase family protein	NA	NA	NA	NA	NA
WP_083760037.1|2257129_2257405_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083760187.1|2257423_2258131_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_156787720.1|2258213_2258444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565197.1|2259324_2260332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787721.1|2261517_2262642_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083760040.1|2262608_2263511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565198.1|2263616_2265611_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049761342.1|2265638_2266958_-	MFS transporter	NA	NA	NA	NA	NA
WP_011565200.1|2267215_2268502_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011565201.1|2268518_2269892_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011565202.1|2269936_2270821_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_041328281.1|2270833_2271844_-	proline racemase family protein	NA	NA	NA	NA	NA
WP_083760188.1|2271833_2272475_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011565206.1|2273302_2274277_-	nuclease	NA	V5UN65	Mycobacterium_phage	40.7	8.4e-18
WP_011565207.1|2274286_2274661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565208.1|2274972_2275233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565209.1|2275229_2275511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787722.1|2275507_2275855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565211.1|2275851_2278077_-	MarR family transcriptional regulator	NA	A0A2K9V2Z1	Faecalibacterium_phage	36.0	7.2e-25
WP_156787877.1|2278087_2278276_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156787723.1|2278848_2279259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787724.1|2279189_2280365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565215.1|2281757_2283401_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_011565216.1|2283413_2284196_+	cyclase family protein	NA	NA	NA	NA	NA
WP_011565218.1|2285215_2287531_+	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_011565219.1|2287546_2288311_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_156787878.1|2288385_2288787_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041329117.1|2288803_2289607_+	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011565222.1|2289608_2290781_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011565223.1|2290805_2292437_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.2	1.9e-54
WP_011565224.1|2292436_2292835_+	RidA family protein	NA	NA	NA	NA	NA
WP_011565225.1|2293249_2293594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049761346.1|2294003_2295887_+	serine/threonine protein kinase	NA	T2AWK4	Cannes_8_virus	28.5	6.1e-17
WP_011565227.1|2296157_2296397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787725.1|2296762_2297257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011565230.1|2297663_2299394_+|transposase	IS1182-like element ISRxy1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_008148	Rubrobacter xylanophilus DSM 9941, complete genome	3225748	2503415	2530125	3225748	transposase	Paenibacillus_phage(60.0%)	27	NA	NA
WP_083760057.1|2503415_2503580_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083760058.1|2503583_2503745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011563563.1|2503763_2504585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011565425.1|2505225_2505852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041328316.1|2506547_2506814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156787887.1|2506786_2507017_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011565429.1|2507595_2508837_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011565430.1|2508856_2509123_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_011565431.1|2509115_2512049_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011565432.1|2512082_2512757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011565433.1|2512788_2514129_+	type III glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011565434.1|2514141_2515059_+	glutamine amidotransferase family protein	NA	NA	NA	NA	NA
WP_049761369.1|2515028_2515736_+	protein glxC	NA	NA	NA	NA	NA
WP_011565436.1|2515738_2517121_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_156787739.1|2517895_2518048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083760059.1|2518029_2518617_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	41.0	1.3e-29
WP_156787740.1|2518598_2519135_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	48.5	1.6e-34
WP_083760061.1|2519174_2519588_+	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	36.0	3.0e-09
WP_156787741.1|2519656_2519974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156787742.1|2520346_2520988_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011565440.1|2522043_2522427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049761373.1|2522740_2525287_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_049761374.1|2526101_2528039_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_011565443.1|2528028_2528718_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.6	1.2e-05
WP_011565444.1|2528731_2529217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083760062.1|2529298_2529802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083760192.1|2529702_2530125_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.4	2.3e-20
