The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008146	Mycobacterium sp. MCS, complete genome	5705448	1952719	1960445	5705448		Bacillus_phage(16.67%)	8	NA	NA
WP_011559210.1|1952719_1953577_+	short chain dehydrogenase	NA	W8CYX9	Bacillus_phage	37.2	2.9e-06
WP_011559211.1|1953584_1954757_-	ATP-binding protein	NA	A0A077SLJ9	Escherichia_phage	35.7	1.4e-56
WP_011559212.1|1954766_1955834_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	26.5	1.0e-13
WP_011559213.1|1955837_1956440_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011559214.1|1956535_1957102_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	33.1	1.2e-08
WP_011559215.1|1957567_1957819_+	NrdH-redoxin	NA	V5UN81	Mycobacterium_phage	64.5	1.6e-21
WP_011559216.1|1957851_1958310_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_082947857.1|1958276_1960445_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.5e-205
>prophage 2
NC_008146	Mycobacterium sp. MCS, complete genome	5705448	3068724	3081958	5705448	capsid,portal,integrase,terminase	Streptomyces_phage(22.22%)	18	3065599:3065614	3081089:3081104
3065599:3065614	attL	ACCGTCGGCGCCGACG	NA	NA	NA	NA
WP_011768245.1|3068724_3069183_-	transglycosylase	NA	A0A1J0GVU2	Streptomyces_phage	58.7	1.8e-26
WP_011560302.1|3069612_3069933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560303.1|3069932_3070778_-|capsid	phage major capsid protein	capsid	Q7Y410	Yersinia_phage	24.2	5.6e-10
WP_011560304.1|3071024_3071480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560305.1|3071476_3072067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560306.1|3072063_3073383_-|portal	phage portal protein	portal	A0A1B3B111	Gordonia_phage	30.5	3.2e-36
WP_011560307.1|3073379_3074849_-|terminase	terminase	terminase	Q9T214	Streptomyces_phage	35.4	2.6e-55
WP_011560308.1|3074848_3075223_-	HNH endonuclease	NA	U5PTU3	Clavibacter_phage	53.7	3.0e-16
WP_011560309.1|3075602_3075848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560310.1|3075844_3076189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041309710.1|3076181_3076364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560311.1|3076360_3077461_-	hypothetical protein	NA	A0A2P1CJ11	Microbacterium_phage	29.3	5.5e-10
WP_011560312.1|3077457_3077733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560313.1|3077729_3078098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011560314.1|3078094_3078364_-	DNA-binding protein	NA	A0A2D1GF53	Mycobacterium_phage	58.2	4.8e-08
WP_011560315.1|3078375_3079017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011560316.1|3079013_3080153_+|integrase	site-specific integrase	integrase	A0A023ZX87	Mycobacterium_phage	47.2	1.2e-87
WP_011560317.1|3080380_3081958_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0CPG0	Kaumoebavirus	32.7	1.1e-40
3081089:3081104	attR	ACCGTCGGCGCCGACG	NA	NA	NA	NA
>prophage 3
NC_008146	Mycobacterium sp. MCS, complete genome	5705448	4374561	4382747	5705448		Gordonia_phage(16.67%)	10	NA	NA
WP_011561485.1|4374561_4375797_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	51.9	1.3e-68
WP_011561486.1|4375783_4375996_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011561487.1|4376059_4377175_+	steroid Delta-isomerase	NA	Q76TT0	Molluscum_contagiosum_virus	33.0	9.2e-29
WP_011561488.1|4377184_4377505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011561489.1|4377579_4378296_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.4	1.4e-14
WP_083775455.1|4378381_4378651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011561491.1|4378610_4380155_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.1	9.4e-157
WP_011561492.1|4380154_4381063_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011561493.1|4381055_4381931_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	28.9	2.3e-14
WP_011561494.1|4381976_4382747_+	NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	42.5	2.1e-11
>prophage 1
NC_008147	Mycobacterium sp. MCS Plasmid1, complete sequence	215075	139057	180428	215075	protease,integrase,transposase	Mycobacterium_phage(36.36%)	32	156232:156251	160178:160197
WP_011562855.1|139057_140440_-|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	40.1	4.7e-75
WP_011562854.1|140439_141858_-	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
WP_011767998.1|141860_143519_-	plasmid partitioning protein ParA	NA	NA	NA	NA	NA
WP_011562852.1|143549_144380_-	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_011562851.1|144372_144612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011562850.1|145240_146899_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	29.1	1.9e-09
WP_011562849.1|147023_147893_+	ParA family protein	NA	NA	NA	NA	NA
WP_011562848.1|147885_148137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011562847.1|148571_148931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083775489.1|149242_150646_+	recombinase family protein	NA	A0A2D1GQ20	Mycobacterium_phage	37.6	5.2e-61
WP_041310603.1|150865_151822_+	ATPase AAA	NA	A0A0R6PCP6	Moraxella_phage	31.5	2.2e-10
WP_041310606.1|151818_154431_+	peptidase S8	NA	NA	NA	NA	NA
WP_011562843.1|154728_155166_-	hypothetical protein	NA	NA	NA	NA	NA
156232:156251	attL	CGATCGTTATCTGGAGTCCT	NA	NA	NA	NA
WP_085975522.1|156267_157467_+|integrase	integrase	integrase	A0A220NQQ9	Corynebacterium_phage	33.3	1.3e-12
WP_011562840.1|157511_159677_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_011562839.1|159666_160077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011562837.1|160414_161491_-	hypothetical protein	NA	NA	NA	NA	NA
160178:160197	attR	AGGACTCCAGATAACGATCG	NA	NA	NA	NA
WP_085975518.1|161877_163172_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	51.2	7.6e-59
WP_085975518.1|165102_166396_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	51.2	7.6e-59
WP_011562832.1|166473_166791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085975523.1|166959_168122_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	32.2	9.3e-32
WP_011562829.1|168173_168767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011562828.1|168759_170202_-	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	28.1	6.2e-09
WP_011562827.1|170291_170630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011562825.1|171674_172142_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_041310618.1|172151_172688_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011562823.1|173235_173805_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011562822.1|173894_174359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085975524.1|174355_177211_-	MMPL family RND transporter	NA	NA	NA	NA	NA
WP_011562820.1|177189_177633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083775482.1|178134_179139_+	hypothetical protein	NA	A0A2P1JR32	Mycobacterium_phage	40.7	2.4e-36
WP_011562043.1|179003_180428_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	6.9e-37
