The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	829193	838672	3200938	integrase	Pseudomonas_phage(20.0%)	11	831563:831577	843120:843134
WP_011538120.1|829193_831602_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.5	8.5e-205
831563:831577	attL	GCTCAAGGGTGGCGA	NA	NA	NA	NA
WP_011538121.1|832172_833177_-|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	26.6	4.6e-11
WP_166485533.1|833334_833490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026687.1|833486_833927_-	hypothetical protein	NA	A0A1B0T6F9	Thiobacimonas_phage	67.5	3.9e-23
WP_011538123.1|833923_834868_-	hypothetical protein	NA	A0A2R2YB59	Pseudomonas_phage	57.1	7.1e-06
WP_011538124.1|834864_835524_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	65.1	4.0e-80
WP_011538125.1|835669_836443_-	hypothetical protein	NA	A0A2I7RMG9	Vibrio_phage	28.2	1.7e-05
WP_011538126.1|836464_836770_-	DUF1364 domain-containing protein	NA	A0A088F868	Sulfitobacter_phage	59.4	1.2e-28
WP_011538127.1|836838_837342_-	hypothetical protein	NA	A0A0U2C161	Paracoccus_phage	65.0	7.5e-55
WP_011538128.1|837341_837950_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	52.2	3.8e-53
WP_011538129.1|837949_838672_-	ERF family protein	NA	K4NWX3	Pseudomonas_phage	41.0	9.2e-38
843120:843134	attR	TCGCCACCCTTGAGC	NA	NA	NA	NA
>prophage 2
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	847786	858688	3200938	capsid,terminase	Pseudomonas_phage(36.36%)	18	NA	NA
WP_011538145.1|847786_848365_+|terminase	terminase small subunit	terminase	A0A0M3LS14	Mannheimia_phage	61.2	7.4e-22
WP_193339811.1|848288_849593_+|terminase	terminase	terminase	D2XJL9	Escherichia_phage	61.5	3.0e-140
WP_011538147.1|849589_850969_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	39.1	2.9e-72
WP_011538148.1|850955_852005_+|capsid	minor capsid protein	capsid	A0A0H5BBX3	Pseudomonas_phage	39.9	2.2e-64
WP_011538149.1|852234_852918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538150.1|852930_853899_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	64.3	1.4e-110
WP_011538151.1|853962_854214_+	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	77.4	3.5e-05
WP_011538152.1|854215_854683_+	hypothetical protein	NA	W6B0V7	Acinetobacter_phage	33.8	6.4e-08
WP_011538153.1|854679_855129_+	hypothetical protein	NA	A0A2H4GY65	Pseudomonas_phage	41.6	2.1e-24
WP_011538154.1|855125_855500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538155.1|855499_855901_+	hypothetical protein	NA	A0A1V0DY73	Dinoroseobacter_phage	49.6	3.2e-24
WP_011538156.1|855897_856296_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_044026695.1|856292_856484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538157.1|856571_857060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538158.1|857162_857633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538159.1|857758_858004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538160.1|858000_858372_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	42.6	2.1e-17
WP_011538161.1|858385_858688_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	30.1	1.2e-07
>prophage 3
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	1064390	1072047	3200938	tRNA	uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_011538335.1|1064390_1065344_+	fatty acid desaturase	NA	A0A1V0S9E0	Catovirus	23.0	7.4e-19
WP_011538336.1|1065464_1066124_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011538337.1|1066243_1067536_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.2	1.4e-84
WP_011538338.1|1067791_1068076_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	58.2	1.8e-21
WP_011538339.1|1068110_1069775_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	23.4	7.4e-06
WP_011538340.1|1069778_1070747_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.9	7.2e-62
WP_011538341.1|1070994_1071348_+	Mth938-like domain-containing protein	NA	NA	NA	NA	NA
WP_011538342.1|1071432_1072047_+	heme ABC exporter ATP-binding protein CcmA	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	32.9	2.9e-08
>prophage 4
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	1136089	1150618	3200938	capsid,tail,protease,portal,head	Paracoccus_phage(27.27%)	18	NA	NA
WP_193339806.1|1136089_1137433_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	38.7	5.1e-74
WP_011538398.1|1137682_1138888_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.4	2.1e-58
WP_011538399.1|1138880_1139105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538400.1|1139139_1139712_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	45.9	5.8e-27
WP_011538401.1|1139732_1140929_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	43.9	1.4e-67
WP_011538402.1|1141107_1141710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538403.1|1141706_1142045_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011538404.1|1142041_1142449_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011538405.1|1142484_1142898_+|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	34.2	1.4e-06
WP_011538406.1|1142901_1143225_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_166485589.1|1143236_1143437_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_011538408.1|1143440_1144100_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	29.9	5.7e-10
WP_011538409.1|1144113_1144746_+	DUF2460 domain-containing protein	NA	A0A0K1Y6G4	Rhodobacter_phage	46.4	1.5e-47
WP_011538410.1|1144745_1145624_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	43.2	5.2e-59
WP_011538411.1|1145620_1146058_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.7	1.3e-31
WP_011538412.1|1146070_1149991_+	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	39.4	1.1e-228
WP_044027074.1|1150014_1150299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538414.1|1150411_1150618_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	47.5	1.1e-09
>prophage 5
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	1326778	1415831	3200938	integrase,capsid,plate,terminase,tail,tRNA,portal	Escherichia_phage(26.83%)	99	1376499:1376555	1415926:1415982
WP_044027096.1|1326778_1329430_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	39.1	1.0e-81
WP_011538572.1|1329436_1329724_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_011538573.1|1329843_1330620_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011538574.1|1330688_1332509_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	44.7	2.5e-23
WP_011538575.1|1332635_1332965_-	multidrug transporter	NA	NA	NA	NA	NA
WP_011538576.1|1333105_1334272_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011538577.1|1334268_1334517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538578.1|1334516_1335170_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011538579.1|1335356_1335815_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011538580.1|1335881_1336925_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	25.6	1.6e-14
WP_011538581.1|1336940_1338461_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011538582.1|1338499_1338814_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_166485591.1|1338886_1339591_+	FkbM family methyltransferase	NA	M4QNU8	Ostreococcus_lucimarinus_virus	30.1	1.2e-05
WP_011538584.1|1339653_1340409_+	Fe-S cluster assembly ATPase SufC	NA	G3M9Y6	Bacillus_virus	26.9	7.7e-11
WP_011538585.1|1340408_1341689_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_011538586.1|1341697_1342183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538587.1|1342182_1342761_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_011538588.1|1342753_1343974_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	39.1	9.3e-91
WP_011538589.1|1344151_1344583_-	universal stress protein	NA	NA	NA	NA	NA
WP_011538590.1|1344582_1347180_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_011538591.1|1347285_1348257_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_011538592.1|1348351_1349239_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011538593.1|1349386_1351786_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011538594.1|1352243_1353467_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044027097.1|1353562_1354474_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011538596.1|1354553_1355243_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.6	1.4e-40
WP_011538597.1|1355246_1355957_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011538598.1|1355973_1356771_-	phosphate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011538599.1|1356783_1358151_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011538600.1|1358150_1359629_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011538601.1|1359738_1360779_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.8	2.2e-64
WP_011538602.1|1361080_1362121_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.5	8.0e-35
WP_044026731.1|1362174_1363332_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2I2L687	Orpheovirus	27.0	4.0e-11
WP_011538604.1|1363358_1363880_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011538605.1|1363876_1364530_-	guanylate kinase	NA	S4VT50	Pandoravirus	51.2	1.3e-11
WP_011538606.1|1364545_1365442_-	YicC family protein	NA	NA	NA	NA	NA
WP_011538607.1|1365683_1366631_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011538608.1|1366860_1368231_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011538609.1|1368431_1369436_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011538610.1|1369442_1370549_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011538611.1|1370688_1371888_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011538612.1|1371994_1372786_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	1.0e-10
WP_011538613.1|1372782_1373496_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.8	8.3e-15
WP_011538614.1|1373499_1374510_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011538615.1|1374506_1375832_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166485592.1|1375913_1376240_-	hypothetical protein	NA	NA	NA	NA	NA
1376499:1376555	attL	GTGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
WP_044026732.1|1376647_1377655_-	late control protein D	NA	A0A088FRU7	Escherichia_phage	42.6	1.1e-70
WP_166485543.1|1377645_1377915_-|tail	tail protein X	tail	A0A1B2LRT9	Wolbachia_phage	47.1	2.1e-11
WP_011538619.1|1377835_1378246_-|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	46.3	1.1e-27
WP_011538620.1|1378245_1380720_-|tail	phage tail tape measure protein	tail	A0A0U2BXT9	Paracoccus_phage	27.6	3.3e-26
WP_011538621.1|1380843_1381143_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011538622.1|1381152_1381659_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	51.8	3.2e-45
WP_011538623.1|1381658_1382876_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	58.5	2.9e-145
WP_011538624.1|1382989_1383349_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_011538625.1|1383349_1383850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538626.1|1383851_1384859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049763235.1|1384858_1385179_-	hypothetical protein	NA	K4I1G2	Acidithiobacillus_phage	38.1	2.0e-08
WP_011538628.1|1385180_1385909_-|tail	phage tail protein	tail	A0A193GYM0	Enterobacter_phage	46.2	2.9e-39
WP_044026733.1|1385919_1386453_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	37.4	2.9e-28
WP_011538630.1|1386445_1387345_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	55.1	8.1e-84
WP_011538631.1|1387344_1387683_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	57.8	1.9e-30
WP_011538632.1|1387731_1388022_-	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	60.0	1.8e-24
WP_011538633.1|1388021_1388399_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_011538634.1|1388395_1388932_-	hypothetical protein	NA	A0A1W6JT55	Escherichia_phage	45.6	1.2e-34
WP_011538635.1|1388931_1389480_-	hypothetical protein	NA	A0A193GYC6	Enterobacter_phage	47.8	1.7e-36
WP_011538636.1|1389484_1389796_-	hypothetical protein	NA	A0A193GYM3	Enterobacter_phage	49.1	6.1e-23
WP_011538637.1|1389795_1390053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084789042.1|1390119_1392057_-|capsid	phage major capsid protein	capsid	A0A088FRT0	Escherichia_phage	51.0	1.6e-169
WP_044027107.1|1392127_1393675_-|portal	phage portal protein	portal	A0A1W6JT60	Escherichia_phage	54.0	3.1e-139
WP_044026734.1|1393737_1394265_-	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	47.4	1.9e-37
WP_011538641.1|1394278_1396231_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	60.6	5.1e-224
WP_011538642.1|1396227_1396782_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	50.6	7.3e-35
WP_011538643.1|1396954_1397338_-	bacteriophage spanin2 family protein	NA	I6R9K4	Celeribacter_phage	36.6	5.4e-05
WP_049763236.1|1397337_1398066_-	lysozyme	NA	A0A0A8KXN5	Burkholderia_phage	46.3	1.4e-25
WP_011538645.1|1398108_1398345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538646.1|1398592_1399195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538647.1|1399239_1399593_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_011538648.1|1399674_1400223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538649.1|1400405_1400966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485544.1|1400969_1401383_-	DUF1064 domain-containing protein	NA	A0A0U2C0S3	Paracoccus_phage	55.6	6.4e-20
WP_011538651.1|1401379_1401808_-	hypothetical protein	NA	A0A1X9HXA5	Ruegeria_phage	63.6	1.9e-38
WP_084789017.1|1401813_1402398_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	47.1	4.5e-35
WP_011538653.1|1402390_1402690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538654.1|1402686_1403685_-	helix-turn-helix domain-containing protein	NA	A0A2H4JAS0	uncultured_Caudovirales_phage	31.4	8.9e-07
WP_011538655.1|1403887_1404421_-	class I SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	46.1	3.2e-40
WP_044026736.1|1404697_1404880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538658.1|1405183_1405507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026737.1|1405503_1405716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538659.1|1405802_1406438_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011538660.1|1406798_1407716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538661.1|1407722_1408715_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011538662.1|1409153_1409492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026739.1|1409889_1412286_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_011538664.1|1412749_1413019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044026740.1|1413247_1413550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538666.1|1413692_1414379_+	hypothetical protein	NA	A0A0U2BXK1	Paracoccus_phage	72.7	8.3e-97
WP_044026741.1|1414406_1414586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044026742.1|1414632_1414836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011538667.1|1414829_1415831_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1415926:1415982	attR	GTGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
>prophage 6
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	1714469	1738018	3200938	capsid,terminase,tail,portal,head	Rhodobacter_phage(50.0%)	27	NA	NA
WP_011538936.1|1714469_1714868_-	hypothetical protein	NA	A0A1X9HVL7	Ruegeria_phage	56.5	7.6e-34
WP_011538937.1|1714864_1715674_-	glycoside hydrolase family 108 protein	NA	A0A1V0DY74	Dinoroseobacter_phage	52.5	4.0e-66
WP_011538938.1|1715675_1716110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538169.1|1716106_1716403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538939.1|1716409_1716757_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_011538940.1|1716734_1717235_-	DUF4376 domain-containing protein	NA	A0A1B1P734	Rhodovulum_phage	45.9	1.5e-18
WP_049763241.1|1717215_1717500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538942.1|1718304_1719249_-	hypothetical protein	NA	A0A2I7RB26	Vibrio_phage	24.4	2.8e-10
WP_011538943.1|1719248_1723772_-|tail	tail tape measure protein	tail	G8DH54	Emiliania_huxleyi_virus	78.3	2.7e-10
WP_011538944.1|1724206_1724542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538945.1|1724640_1725090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538946.1|1725188_1725638_-	hypothetical protein	NA	M4QQ74	Salicola_phage	37.6	9.5e-17
WP_011538947.1|1725698_1725983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485595.1|1726024_1726330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538949.1|1726377_1726833_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_044026766.1|1726845_1727238_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011538951.1|1727251_1727833_-|head,tail	phage head-tail connector protein	head,tail	I3UM02	Rhodobacter_phage	47.6	8.7e-39
WP_011538952.1|1727836_1728298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538953.1|1728294_1728756_-	hypothetical protein	NA	I3UM00	Rhodobacter_phage	64.7	3.8e-45
WP_011538954.1|1728819_1730139_-|capsid	phage major capsid protein	capsid	I3ULZ9	Rhodobacter_phage	77.0	1.2e-184
WP_011538955.1|1730141_1731089_-	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	68.3	2.0e-109
WP_011538956.1|1731085_1732372_-|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	63.7	3.0e-156
WP_011538957.1|1732374_1734075_-|terminase	terminase large subunit	terminase	I3ULZ6	Rhodobacter_phage	46.1	1.5e-134
WP_011538958.1|1734085_1734631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026769.1|1734671_1735037_-	HNH endonuclease	NA	I3ULZ4	Rhodobacter_phage	61.1	9.7e-28
WP_166485547.1|1735225_1735813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538961.1|1736143_1738018_-	hypothetical protein	NA	G8EY43	Synechococcus_phage	25.0	3.1e-29
>prophage 7
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	1752566	1773068	3200938	capsid,terminase,tail,protease,portal,head	Paracoccus_phage(25.0%)	25	NA	NA
WP_011538981.1|1752566_1752965_-	hypothetical protein	NA	A0A1X9HVL7	Ruegeria_phage	55.8	1.7e-33
WP_011538982.1|1752961_1753771_-	glycoside hydrolase family 108 protein	NA	A0A1V0DY74	Dinoroseobacter_phage	51.3	9.9e-65
WP_011538983.1|1753772_1754207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538169.1|1754203_1754500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538939.1|1754506_1754854_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_011538985.1|1754831_1755464_-	DUF4376 domain-containing protein	NA	A0A1B1P734	Rhodovulum_phage	45.5	1.9e-18
WP_044026777.1|1755460_1756978_-	hypothetical protein	NA	A0A0F7LB88	uncultured_marine_virus	44.3	9.5e-53
WP_011538987.1|1756974_1757919_-	hypothetical protein	NA	A0A2I7RB26	Vibrio_phage	24.4	3.3e-11
WP_011538988.1|1757915_1762442_-|tail	tail tape measure protein	tail	G8DH54	Emiliania_huxleyi_virus	46.5	7.9e-10
WP_011538989.1|1762470_1762809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044026780.1|1762849_1763800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538991.1|1763993_1764332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538945.1|1764430_1764880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538946.1|1764978_1765428_-	hypothetical protein	NA	M4QQ74	Salicola_phage	37.6	9.5e-17
WP_011538947.1|1765488_1765773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026782.1|1765814_1766168_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_011538993.1|1766167_1766623_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_011538994.1|1766619_1766958_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_011538995.1|1766957_1767530_-|head,tail	phage head-tail connector protein	head,tail	A0A141GEW4	Brucella_phage	44.7	5.4e-33
WP_044026783.1|1767526_1767709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011538996.1|1767771_1768983_-|capsid	phage major capsid protein	capsid	A0A0U2C0U7	Paracoccus_phage	66.1	5.5e-136
WP_044027158.1|1769007_1769685_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	57.6	6.4e-49
WP_011538998.1|1769677_1770901_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	60.8	2.7e-130
WP_011538999.1|1770901_1772683_-|terminase	terminase	terminase	B0VK29	Azospirillum_phage	41.1	7.4e-121
WP_011539000.1|1772660_1773068_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
>prophage 8
NC_008044	Ruegeria sp. TM1040, complete sequence	3200938	3188662	3198017	3200938		Cedratvirus(14.29%)	8	NA	NA
WP_011540331.1|3188662_3190258_+	phosphoglycerate dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	38.6	3.1e-46
WP_011540332.1|3190436_3191171_+	serine/threonine protein phosphatase	NA	A0A1V0EF12	Caulobacter_phage	36.5	2.3e-28
WP_044027312.1|3191377_3192409_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	64.7	5.9e-14
WP_011540334.1|3192425_3193610_-	glycine C-acetyltransferase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.1	6.3e-36
WP_011540335.1|3193774_3194341_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	43.3	1.6e-05
WP_011540336.1|3194449_3195625_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_011540337.1|3195734_3197261_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	32.0	1.3e-20
WP_011540338.1|3197264_3198017_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	A0A097BYE1	Leuconostoc_phage	26.7	2.7e-08
>prophage 1
NC_008043	Ruegeria sp. TM1040 megaplasmid, complete sequence	821788	569522	637490	821788	integrase,transposase	Mycobacterium_phage(20.0%)	50	616861:616875	641494:641508
WP_084789006.1|569522_570452_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_085978750.1|570524_571620_+|transposase	IS3-like element ISSisp1 family transposase	transposase	NA	NA	NA	NA
WP_011537149.1|572580_575973_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	25.3	7.2e-16
WP_011537150.1|575969_578069_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011537151.1|578093_579023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537152.1|579024_580188_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011537153.1|580184_581759_-	SAM-dependent DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	29.1	8.7e-25
WP_044026482.1|582227_583835_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_166485520.1|583831_584038_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_084789007.1|584347_584524_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	46.3	2.9e-06
WP_011537156.1|586362_586938_-	BRO family protein	NA	S5M7W3	Mycobacterium_phage	32.1	4.9e-10
WP_011537157.1|587242_589153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537158.1|589305_590034_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011537159.1|590037_593316_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.3	1.1e-61
WP_166485502.1|593427_594546_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011537161.1|594680_596180_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.4	6.5e-86
WP_011537156.1|596706_597282_+	BRO family protein	NA	S5M7W3	Mycobacterium_phage	32.1	4.9e-10
WP_011537162.1|597613_598792_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011537163.1|599008_599191_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_011537164.1|599187_600210_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_011537165.1|600206_600788_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_005620785.1|600919_601138_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011537166.1|601222_602101_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_011537167.1|602194_602782_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011537168.1|602781_603177_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011537169.1|603177_603633_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_011537170.1|603636_604116_-	UPF0262 family protein	NA	NA	NA	NA	NA
WP_011537171.1|604395_605700_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011537173.1|606234_607506_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011537174.1|607505_607982_+	DUF2948 family protein	NA	NA	NA	NA	NA
WP_011537175.1|608023_608818_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_011537176.1|608967_609945_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_011537177.1|609941_610790_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011537178.1|610812_611502_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_011537179.1|611668_612097_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011537180.1|612349_613423_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_044026484.1|613573_614725_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011537182.1|614750_615059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537183.1|615048_616101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537184.1|616097_616508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537185.1|616504_617992_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	26.4	1.4e-45
616861:616875	attL	CGCGGCAGGCTGTCA	NA	NA	NA	NA
WP_011537186.1|618301_621514_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011537187.1|628193_629282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166485503.1|629291_630899_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011537189.1|631197_632346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011537190.1|632526_632745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009176818.1|632863_633052_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166485504.1|633224_633923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044026487.1|634103_635282_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	33.9	2.1e-15
WP_011537194.1|636896_637490_+|integrase	tyrosine-type recombinase/integrase	integrase	B0VK72	Azospirillum_phage	40.8	6.6e-18
641494:641508	attR	TGACAGCCTGCCGCG	NA	NA	NA	NA
